CN108277260A - A method of detection BRAFV600E gene mutations - Google Patents
A method of detection BRAFV600E gene mutations Download PDFInfo
- Publication number
- CN108277260A CN108277260A CN201810336729.4A CN201810336729A CN108277260A CN 108277260 A CN108277260 A CN 108277260A CN 201810336729 A CN201810336729 A CN 201810336729A CN 108277260 A CN108277260 A CN 108277260A
- Authority
- CN
- China
- Prior art keywords
- brafv600e
- gene
- detection
- probe
- dna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6834—Enzymatic or biochemical coupling of nucleic acids to a solid phase
- C12Q1/6837—Enzymatic or biochemical coupling of nucleic acids to a solid phase using probe arrays or probe chips
Abstract
A method of detection BRAFV600E gene mutations belong to biotechnology.The method trivial operations for solving existing detection BRAFV600E gene mutations, can not determine mutating alkali yl, it is difficult to micromation and high-throughput problem.This method uses DNA microarray technology, fixed gene probe, dimer is formed after hybridizing with mutated gene segment, again using the DNA complementary strands with fluorescent dye CY5 as marker, biochip is marked by hybridization reaction, in conjunction with microarray Fluorescence Scanner, the fluorescence signal of fluorescent dye on biochip is obtained, it can be achieved that oriented detection to BRAFV600E gene mutations.This method is easy, and sensitivity can reach 0.1nM, can detect BRAFV600E gene mononucleotide mutation, and the detection of mutator is limited to：0.1nM, gene frequency are down to 0.1%, detection range：3 orders of magnitude.
Description
Technical field
The invention belongs to biotechnologies, and in particular to a method of detection BRAFV600E gene mutations.
Background technology
BRAF gene (v-raf Murine Sarcoma filterable virus oncogene autoploid B1) is located on No. 7 chromosomes, is compiled
Code BRAF kinases finds have mutation, the single gene mutation in the wherein sites BRAFV600E to be often happened in Several Kinds of Malignancy
In thyroid papillary carcinoma.The central lymph node transfer of it and tumour and invasion are closely related, for BRAF V600E into
Row genetic test contributes to clinician to judge whether need preventative cleaning cervical lymph node in art.It is now common
The method of BRAFV600E includes Sanger PCR sequencing PCRs, fluorescent quantitation-PCR (RT-PCR), immunohistochemistry technique
(IHC) etc..The advantages of Sanger PCR sequencing PCRs is the higher detectable known and unknown mutation of accuracy, but sensitivity is relatively low (only
It is that just can detect to reach 50% or more in mutation rate) cost is higher, and time-consuming.RT-PCR detections are more accurate, currently make
With more, but its of high cost, space and personnel requirement are high and can only detect known mutations.Immunohistochemical Method specific antibody
VE1 identifies V600E mutains, and BRAFV600E gene mutations are speculated on protein level, with preferable sensitivity and specifically
Degree, but can not accurately detect mutating alkali yl and known mutations can only be detected.In recent years, nucleic acid probe as gene probe one
Kind, there is very strong affinity and selectivity, be widely used in biochemical analysis.
Biochip is current genomics, and the important tool of proteomics research has high throughput, and to detecting sample
The advantages that product consumption is few (biology of gene, Genome Biol.2001,2, research0004.1~0004.13), due to
The combination of gene probe molecule and target molecule has the characteristics that highly sensitive, high specific, thus by nucleic acid probe,
The specific recognition of BRAFV600E mutators has not been reported with the combined technology of biochip.
Invention content
The purpose of the present invention is to solve the method trivial operations of existing detection BRAFV600E gene mutations, sample disappears
Consumption is big, it is difficult to micromation and the problem of small throughput, and a kind of method of detection BRAFV600E gene mutations is provided.
The present invention provides a kind of method of detection BRAFV600E gene mutations, includes the following steps：
Step 1：Two kinds of BRAFV600E gene probes and sampling liquid are mixed to get two kinds of BRAFV600E gene probe points
Then sample solution carries out point sample on substrate, obtain BRAFV600E capture genetic chips；
Step 2：The DNA extracted in cell or tissue is subjected to the reaction of two step asymmetric PCRs, obtains single-stranded mesh to be detected
Gene；
Step 3：The BRAFV600E that step 1 obtains is captured what the gene probe on genetic chip was obtained with step 2
The target gene fragment of cls gene to be checked or pure saltant type target gene fragment to be detected carry out hybridization reaction, obtain gene spy
Needle-target gene dimer biochip；
Step 4：The DNA that gene probe-target gene dimer biochip that step 3 obtains and CY5 are marked is mutual
It mends chain hybridization solution and carries out hybridization reaction, obtain the BRAFV600E biochips of fluorescent marker；
Step 5：By the BRAFV600E biochips for the fluorescent marker that step 4 obtains be put into microarray scanner into
Row detection, obtains the fluorescent assay signal of BRAFV600E biochips, realizes the detection to BRAFV600E gene mutations.
Preferably, two kinds of BRAFV600E gene probes are saltant type and wild type.
Preferably, a concentration of 10~50 μM of the BRAFV600E gene probes in the step one.
Preferably, the gene probe in the step one is 3 '-NH2The DNA probe of modification.
Preferably, the condition of two step of asymmetric PCR in the step 2 is：First reacted 3 minutes at 94 DEG C；So
It is reacted at being reacted 20 seconds, 68 DEG C at being reacted 30 seconds, 47 DEG C at 94 DEG C successively afterwards 20 seconds, 30 cycles；It is finally anti-at 68 DEG C
It answers 5 minutes；4 DEG C of preservations.
Preferably, the step three is specially：
The target gene fragment of cls gene to be checked or pure saltant type target gene fragment to be detected are put into hybridization solution,
Obtain the target gene fragment of cls gene to be checked hybridization solution or or pure saltant type target gene fragment hybridization solution to be detected,
It is then immersed in heating 2min~3min in boiling water, 40~47 DEG C are placed on after being loaded onto rapidly on BRAFV600E capture genetic chips,
In the climatic chamber of 25%~45% relative humidity, make the BRAFV600E gene probes on BRAFV600E capture genetic chips
Carry out hybridization reaction with the DNA complementary strands of cls gene to be checked, react 2 hours, after by washing, obtain gene probe-mesh
Gene dimer biochip.
Preferably, the hybridization solution includes：The lauryl sodium sulfate of mass fraction 0.1%~0.2%, pH=
7.0 buffered containing 0.4mol/L~0.5mol/L sodium chloride and 40mmol/L~50mmol/L trisodium citrates (two water) is molten
Liquid.
Preferably, in the hybridization solution of the target gene fragment of the cls gene to be checked cls gene to be checked purpose base
Because of a concentration of 0.01nM~100nM of segment.
Preferably, it is 30 DEG C that the hybridization reaction of the step four, which is in temperature, and relative humidity is 25%~45%
It is carried out in climatic chamber.
Preferably, the DNA complementary strand thereof solution that CY5 is marked in the step four is the DNA complementations for marking CY5
Chain is put into be obtained in hybridization solution, a concentration of 0.1 μM~0.2 μM of the DNA complementary strands of CY5 labels.
Inventive principle
A kind of method of detection BRAFV600E gene mutations of the present invention, this method use DNA microarray technology, fixed base
Because of probe, dimer is formed after hybridizing with mutated gene segment, then using the DNA complementary strands with fluorescent dye CY5 as marker,
Biochip is marked by hybridization reaction, in conjunction with microarray Fluorescence Scanner, obtains the fluorescence letter of fluorescent dye on biochip
Number, it can be achieved that oriented detection to BRAFV600E gene mutations.
Beneficial effects of the present invention
A kind of method of detection BRAFV600E gene mutations provided by the invention, detection method simplicity, sample consumption
Few, time loss is short, and there is versatility, sensitivity can reach 0.1nM, and detection range is wide, the experimental results showed that：Utilize this method
The detection range of the BRAFV600E gene mutations obtained is：0 μM~100 μM, when its a concentration of 100 μM, fluorescence signal becomes
In saturation；BRAFV600E detection in Gene Mutation is limited to：0.1nM, gene frequency are down to 0.1%, detection range：3 numbers
Magnitude.
Description of the drawings
Fig. 1 is the procedure schematic diagram of detection BRAFV600E gene mutations of the present invention；
Fig. 2 is the array light after two step hybridization reactions with the synthesis mutated DNA sequences that are obtained of method of the present invention
Learn picture；
Fig. 3 is the lattice optics picture of the BRAFV600E mutator various concentrations obtained with the method for the present invention；
Fig. 4 is the standard point diagram of the BRAFV600E mutators detection obtained with the method for the present invention；
Fig. 5 is the gene frequency array light of the BRAFV600E mutators detection obtained with the method for the present invention
Learn picture and standard point diagram；
Fig. 6 is to be detected obtained lattice optics picture to actual clinical sample with the method for the present invention.
Specific implementation mode
The present invention provides a kind of method of detection BRAFV600E gene mutations, includes the following steps：
Step 1：Two kinds of BRAFV600E gene probes and sampling liquid are mixed to get two kinds of BRAFV600E gene probe points
Then sample solution carries out point sample on substrate, obtain BRAFV600E capture genetic chips；
Step 2：The DNA extracted in cell or tissue is subjected to the reaction of two step asymmetric PCRs, obtains single-stranded mesh to be detected
Gene；
Step 3：The BRAFV600E that step 1 obtains is captured what the gene probe on genetic chip was obtained with step 2
The target gene fragment of cls gene to be checked or pure saltant type target gene fragment to be detected carry out hybridization reaction, obtain gene spy
Needle-target gene dimer biochip；
Step 4：The DNA that gene probe-target gene dimer biochip that step 3 obtains and CY5 are marked is mutual
It mends chain hybridization solution and carries out hybridization reaction, obtain the BRAFV600E biochips of fluorescent marker；
Step 5：By the BRAFV600E biochips for the fluorescent marker that step 4 obtains be put into microarray scanner into
Row detection, obtains the fluorescent assay signal of BRAFV600E biochips, realizes the detection to BRAFV600E gene mutations.
According to the present invention, by two kinds, (i.e. saltant type and wild type, the mutability BRAFV600E gene probes have
SEQ No.1 sequences, wildness BRAFV600E gene probes have SEQ No.2 sequences) BRAFV600E gene probes and point sample
Liquid is mixed to get BRAFV600E gene probe spotting solutions, in the BRAFV600E gene probe spotting solutions
The concentration of BRAFV600E gene probes is preferably 10~50 μM, more preferably 30 μM, and the BRAFV600E gene probes are excellent
It is selected as 3 '-NH2DNA probe (the 3 '-NH of modification2The DNA probe of modification is selected from Shanghai life work biotechnology and services limited public affairs
Department), take sample solution described in 10 μ of μ L~20 L in sample panel, it is enterprising in 48 biochip point sample systems of SmartArrayer
(biochip selects Beijing Bo Ao Bioisystech Co., Ltd to produce to row point samplePolymer three-dimensional substrate D), point sample
Amount：0.6~1nL/ points, for the array point obtained and the activity for keeping biomolecule, sampling liquid composition is preferably：Matter
The lauryl sodium sulfate for measuring score 0.004%~0.006%, containing 0.4mol/L~0.5mol/L sodium chloride, 1mol/L~
40mmol/L~50mmol/L trisodium citrates (two water) buffer solution (PH=7.0) of 2mol/L glycine betaines is good by point sample
It is 30 DEG C~40 DEG C that chip, which is put into temperature, in the climatic chamber that relative humidity is 70%~90%, is reacted 12 hours so that
Amino on BRAFV600E gene probes is reacted with the aldehyde radical of chip surface, and BRAFV600E gene probes are connected to chip base
On bottom, 25mL~35mL wash liquids 2~3 times, each 2min~3min are used after reaction, then with the ultrapure washings of Milli-Q
It washs 2~3 times, to remove loose BRAFV600E gene probes, the washing lotion composition is preferably each 2min~3min：
Containing 0.01%~0.03% lauryl sodium sulfate, 0.15mol/L~0.16mol/L sodium chloride, 15mmol/L~
17mmol/L trisodium citrates (two water) buffer solution (pH=7.0) after washing, selects sealer to unreacted active aldehyde radical
Group is closed, and BRAFV600E capture genetic chips are obtained.The sealer preferably comprises 1% ethanol amine,
0.14mol/L~0.16mol/L sodium chloride, 15mmol/L~25mmol/L disodium hydrogen phosphates (Shi Ershui), 15mmol/L~
25mmol/L sodium dihydrogen phosphates (two water) buffer solution (pH=7.5)
According to the present invention, using the DNA extracted in cell or tissue as template in the step two, 1 μ L templates is taken, are added
Enter 1 μ L forward primers F1 (the forward primer F1 has SEQ No.3 sequences), (described reversely draws 1 μ L reverse primers R1
Object R1 has SEQ No.4 sequences), the oneTaqDNA polymerases of 10 μ L (select New England Biolabs productions
OneTaqDNA polymerases), 7 μ L aqua sterilisas form 20 μ LPCR systems, carry out first step PCR reactions.The PCR reaction conditions
Preferably：First reacted 3 minutes at 94 DEG C；Then it is reacted at being reacted 20 seconds, 68 DEG C at being reacted 30 seconds, 47 DEG C at 94 DEG C successively
20 seconds, 30 cycles；Finally reacted 5 minutes at 68 DEG C；4 DEG C of preservations.Using first step PCR product as the mould of second step PCR
Plate, takes 2.5 μ L templates that 2.5 μ L forward primers F1, the oneTaqDNA polymerases of 25 μ L are added, and 20 μ L aqua sterilisas form 50 μ
LPCR systems carry out second step PCR reactions.The condition of the described second step PCR reactions is preferably：3 points are first reacted at 94 DEG C
Clock；Then it is reacted at being reacted 20 seconds, 68 DEG C at being reacted 30 seconds, 47 DEG C at 94 DEG C successively 20 seconds, 30 cycles；Finally at 68 DEG C
Lower reaction 5 minutes；4 DEG C of preservations.The product of gained is directly used in the hybridization reaction in step 3.
It is according to the present invention, the target gene fragment of 0.01nM~100nM cls genes to be checked or 0.01nM~100nM is pure prominent
(DNA synthesis is selected from Shanghai Sangon Biological Engineering Technology And Service Co., Ltd to modification target gene fragment to be detected, and pure saltant type waits for
Testing goal genetic fragment has SEQ No.6 sequences) it is put into the 25 μ L hybridization solutions of μ L~30, obtain the mesh of cls gene to be checked
Genetic fragment hybridization solution or pure saltant type target gene fragment to be detected hybridization solution, be then immersed in boiling water plus
Hot 2min~3min is placed on 40~47 DEG C after being loaded onto rapidly on BRAFV600E capture genetic chips, and 25%~45% is relatively wet
In the climatic chamber of degree, make the BRAFV600E gene probes on BRAFV600E capture genetic chips and cls gene to be checked
DNA complementary strands carry out hybridization reaction, react 2 hours, after use washing lotion 1 to rinse 10~20 seconds successively, and under the conditions of 37 DEG C
Washing 3 times, each 3min~4min；It is washed 3 times at room temperature with washing lotion 2 again, each 4min~5min；Finally with 4 DEG C
Milli-Q milli-Q waters 3 times, each 2min~3min, centrifugal drying 1min~2min obtain gene probe-target gene
Dimer biochip.The hybridization solution is preferably：The lauryl sodium sulfate of mass fraction 0.1%~0.2%, pH=
7.0 buffered containing 0.4mol/L~0.5mol/L sodium chloride and 40mmol/L~50mmol/L trisodium citrates (two water) is molten
Liquid.The washing lotion 1 is preferably：Contain 0.01%~0.02% lauryl sodium sulfate, 0.6mol/L~0.8mol/L chlorine
Change sodium 60mmol/L~70mmol/L, trisodium citrate (two water) buffer solution (pH=7.0)；Washing lotion 2 is preferably：Contain
0.01%~0.02% lauryl sodium sulfate, 0.15mol/L~0.16mol/L sodium chloride 15mmol/L~17mmol/L lemons
Lemon acid trisodium (two water) buffer solution (pH=7.0).
According to the present invention, gene probe-target gene dimer biochip and CY5 are marked in the step four
DNA complementary strands (the DNA complementary strands of CY5 labels have SEQ No.5 sequences) hybridization solution carries out hybridization reaction, 25 μ of μ L~30 L
The hybridization solution of the DNA complementary strands of CY5 labels containing 200nM is 30 DEG C in temperature, and relative humidity is 25%~45% condition
Under, react 1 hour, after first use washing lotion 1 rinse 10~20 seconds, and at room temperature wash 3 times, each 3min~4min；Again
Fluorescent marker is obtained with Milli-Q milli-Q waters 3 times, each 2min~3min, centrifugal drying 1min~2min
BRAFV600E biochips.The hybridization solution of the DNA complementary strands of the described CY5 labels is preferably：Mass fraction 0.1%~
0.2% lauryl sodium sulfate, pH=7.0 containing 0.1mol/L~0.2mol/L sodium chloride and 10mmol/L~
The buffer solution of 20mmol/L trisodium citrates (two water).The washing lotion 1 is preferably：Contain the 12 of 0.01%~0.02%
Sodium alkyl sulfate, the buffering of 0.15mol/L~0.16mol/L sodium chloride 15mmol/L~17mmol/L trisodium citrates (two water)
Solution (pH=7.0).
According to the present invention, gene probe-target gene dimer biochip and CY5 are marked in the step five
Biochip after DNA complementary strands progress hybridization is put into the LuxScan- of Beijing Bo Ao Bioisystech Co., Ltd production
It is detected in 10K/A type microarray scanners, obtains the fluorescent assay signal of BRAFV600E biochips, it can be achieved that right
The detection of BRAFV600E gene mutations.
With reference to specific embodiment, the present invention will be further described in detail.
Embodiment 1
1, by two kinds of BRAFV600E gene probes (i.e. saltant type and wild type, the mutability BRAFV600E genes
Probe has SEQ No.1 sequences (5 '-GAT TTC TCT GTA GCT-T10-NH2- 3 '), wildness BRAFV600E genes are visited
Needle set has SEQ No.2 sequences (5 '-GAT TTC ACT GTA GCT-T10-NH2- 3 ') it) is mixed to get with sampling liquid
BRAFV600E gene probes solution (DNA synthesis is selected from Shanghai Sangon Biological Engineering Technology And Service Co., Ltd), BRAFV600E
A concentration of 30 μm of ol/L of gene probe, take sample solution described in 15 μ L in sample panel, in the biological cores of SmartArrayer 48
Point sample is carried out on piece spotting system, and (production method of biochip applications standard selects Beijing Bo Ao Bioisystech Co., Ltd
ProductionPolymer three-dimensional substrate D), for the array point obtained and the activity for keeping biomolecule, the point sample
Liquid group becomes：The lauryl sodium sulfate of mass fraction 0.005%, pH=7.0's contains 0.45mol/L sodium chloride, 1.5mol/
45mmol/L trisodium citrates (two water) buffer solution (PH=7.0) of L glycine betaines, it is 30 that the good chip of point sample, which is put into temperature,
DEG C, in the climatic chamber that relative humidity is 80%, reacts 12 hours, use 30mL wash liquids after reaction 3 times, every time
3min, then with Milli-Q milli-Q waters 3 times, each 3min, the washing lotion group becomes：Contain 0.01% dodecyl sulphur
Sour sodium, 0.15mol/L sodium chloride, 15mmol/L trisodium citrates (two water) buffer solution (pH=7.0) after washing, select 1%
Ethanol amine, 0.15mol/L sodium chloride, 20mmol/L disodium hydrogen phosphates (Shi Ershui), 20mmol/L sodium dihydrogen phosphates (two water)
Buffer solution (pH=7.5) closes unreacted active aldehyde radical group, obtains BRAFV600E capture genetic chips；
2, in a concentration of 30 μM of BRAFV600E capture genetic chips and immersion boiling water that obtain step 1 after heating 3min
Pure saltant type target gene fragment to be detected (DNA synthesis is selected from Shanghai Sangon Biological Engineering Technology And Service Co., Ltd, pure prominent
Modification target gene fragment to be detected has SEQ No.6 sequences (5 '-GATTTTGGTCTAGCTACAGAGAAATCTCGATGGAG
TGGGTCCCATCAGTTTGAACA GTTGTCTGGATCC-3 ')) hybridization solution, be placed on 44 DEG C after rapid sample-adding, 40% phase
To in the climatic chamber of humidity, react 2 hours, after use washing lotion 1 to rinse 20 seconds successively, and wash 3 under the conditions of 37 DEG C
It is secondary, each 4min；It is washed 3 times at room temperature with washing lotion 2 again, each 5min；Finally with 4 DEG C of Milli-Q milli-Q waters 3
Secondary, each 3min, centrifugal drying 1min obtain gene probe-target gene dimer biochip；The hybridization solution
For：The lauryl sodium sulfate of mass fraction 0.15%, pH=7.0's contains 0.45mol/L sodium chloride and 45mmol/L lemons
Sour trisodium (two water) buffer solution.The washing lotion 1 is：Containing 0.01% lauryl sodium sulfate, 0.6mol/L sodium chloride,
60mmol/L trisodium citrates (two water) buffer solution (pH=7.0)；Washing lotion 2 be containing 0.01% lauryl sodium sulfate,
0.15mol/L sodium chloride, the buffer solution (pH=7.0) of 15mmol/L trisodium citrates (two water)；
3, the DNA complementary strands of the gene probe for obtaining step 2-target gene dimer biochip and CY5 labels
(the DNA complementary strands of CY5 labels have SEQ No.5 sequences (5 '-Cy5-T10- GGA TCC AGA CAA CTG-3 ')) carry out it is miscellaneous
Reaction is handed over, the hybridization solution of the DNA complementary strands for the CY5 labels that 25 μ L contain 200nM is added on chip, is 30 DEG C in temperature,
Relative humidity be 40% under the conditions of, react 1 hour, after first use washing lotion 1 rinse 10~20 seconds, and at room temperature wash 3 times,
Each 4min；Again fluorescent marker is obtained with 4 DEG C of Milli-Q milli-Q waters 3 times, each 3min, centrifugal drying 1min
BRAFV600E biochips.The hybridization solution of the DNA complementary strands of the described CY5 labels is：The dodecane of mass fraction 0.15%
Base sodium sulphate, pH=7.0's contains 0.15mol/L sodium chloride and 15mmol/L trisodium citrates (two water) buffer solution.It is described
Washing lotion 1 be：Contain 0.015% lauryl sodium sulfate, 0.15mol/L sodium chloride 16mmol/L trisodium citrates (two water)
Buffer solution (pH=7.0).
4, by the DNA complementary strands of gene probe-target gene dimer biochip and CY5 labels in the step 3
Carry out the micro- battle array of LuxScan-10K/A types that the biochip after hybridization is put into the production of Beijing Bo Ao Bioisystech Co., Ltd
It is detected in column scan instrument, obtains the fluorescent assay signal of BRAFV600E biochips.
According to the above experimental procedure, obtained result is as shown in Fig. 2, Fig. 3, Fig. 4 and Fig. 5.
When Fig. 2 is a concentration of 10nM of the saltant type synthesis target gene fragment that is obtained with the method for the embodiment of the present invention 1
Fluorescence signal lattice optics picture；Wherein, a concentration of 10nM of target gene to be measured, Cy5 label DNA complementary strands it is dense
Degree is 200nM.First row dot matrix detects saltant type BRAFV600E genes in figure, and secondary series detects wild type BRAFV600E bases
Cause；
Fig. 3 is the lattice optics of the BRAFV600E mutator various concentrations obtained with the method for the embodiment of the present invention 1
Picture, wherein a concentration of 30 μM of probe BRAFV600E gene probes, a concentration of 0.01nmol/ of target gene fragment to be measured
L, 0.025nmol/L, 0.05nmol/L, 0.1nmol/L, 0.25nmol/L, 0.5nmol/L, 1nmol/L, 2.5nmol/L,
A concentration of 200nM of the DNA complementary strands of 5nmol/L, 10nmol/L, 50nmol/L, 100nmol/L, Cy5 label；
Fig. 4 is the standard point diagram of the BRAFV600E mutators detection obtained with the method for the embodiment of the present invention 1, it
Be illustrated respectively in BRAFV600E capture genetic chip on, fluorescence signal with the variation of target gene fragment concentration to be measured and
The image of variation and corresponding data extraction figure, wherein abscissa are the concentration of target gene fragment to be measured, and ordinate is glimmering
Light signal strength ratio, a concentration of 30 μM of probe BRAFV600E, a concentration of 0.1~100nM of target gene to be measured, Cy5 label
DNA complementary strands a concentration of 200nM, the detection of the BRAFV600E mutators obtained using this method is limited to：
0.1nmol/L, wherein fluorescence signal increases, a concentration of 100 μM when its with the increase of BRAFV600E mutator concentration
When, fluorescence signal tends to be saturated.
Fig. 5 is the pure mesh of saltant type under conditions of the different gene frequencies obtained with the method for the embodiment of the present invention 1
Fluorescence signal of gene in the case of different gene frequencies lattice optics picture (figure A) and standard point diagram (scheming B).
Wherein, a concentration of 30 μM of probe BRAFV600E, for gene frequency from 0.01% to 45%, synthesis target gene fragment is total
When allelic concentration is 20nM, a concentration of 200nM of the DNA complementary strands of Cy5 labels.
Embodiment 2
1, by two kinds of BRAFV600E gene probes (i.e. saltant type and wild type, the mutability BRAFV600E genes
There is probe SEQ No.1 sequences, wildness BRAFV600E gene probes to have SEQ No.2 sequences) it is mixed to get with sampling liquid
BRAFV600E gene probes solution (DNA synthesis is selected from Shanghai Sangon Biological Engineering Technology And Service Co., Ltd), BRAFV600E
A concentration of 30 μm of ol/L of gene probe, take sample solution described in 15 μ L in sample panel, in the biological cores of SmartArrayer 48
Point sample is carried out on piece spotting system, and (production method of biochip applications standard selects Beijing Bo Ao Bioisystech Co., Ltd
ProductionPolymer three-dimensional substrate D), for the array point obtained and the activity for keeping biomolecule, the point sample
Liquid group becomes：The lauryl sodium sulfate of mass fraction 0.005%, pH=7.0's contains 0.45mol/L sodium chloride, 1.5mol/
45mmol/L trisodium citrates (two water) buffer solution (PH=7.0) of L glycine betaines, it is 30 that the good chip of point sample, which is put into temperature,
DEG C, in the climatic chamber that relative humidity is 80%, reacts 12 hours, use 30mL wash liquids after reaction 3 times, every time
3min, then with Milli-Q milli-Q waters 3 times, each 3min, the washing lotion group becomes：Contain 0.01% dodecyl sulphur
Sour sodium, 0.15mol/L sodium chloride, 15mmol/L trisodium citrates (two water) buffer solution (pH=7.0) after washing, select 1%
Ethanol amine, 0.15mol/L sodium chloride, 20mmol/L disodium hydrogen phosphates (Shi Ershui), 20mmol/L sodium dihydrogen phosphates (two water)
Buffer solution (pH=7.5) closes unreacted active aldehyde radical group, obtains BRAFV600E capture genetic chips；
2, in a concentration of 30 μM of BRAFV600E capture genetic chips and immersion boiling water that obtain step 1 after heating 3min
People's tissue extraction DNA carry out the hybridization solution of product after asymmetric PCR, be placed on 44 DEG C after rapid sample-adding, 40% relative humidity
Climatic chamber in, react 2 hours, after use washing lotion 1 to rinse 20 seconds successively, and wash 3 times under the conditions of 37 DEG C, every time
4min；It is washed 3 times at room temperature with washing lotion 2 again, each 5min；Finally with 4 DEG C of Milli-Q milli-Q waters 3 times, every time
3min, centrifugal drying 1min obtain gene probe-target gene dimer biochip；The tissue extraction DNA is carried out not
Symmetrically the process of PCR is：It takes 1 μ L tissue extractions DNA as template, 1 μ L forward primer F1, (the forward primer F1 is added
With SEQ No.3 sequences (5 '-AGGTGATTTTGGTCTAGCTACA-3 ')), the 1 μ L reverse primers R1 (reverse primers
R1 has SEQ No.4 sequences (5 '-GGATCCAGACAACTGTTCAAAC-3 ')), the oneTaqDNA polymerases of 10 μ L (are selected
The oneTaqDNA polymerases of New England Biolabs productions), 7 μ L aqua sterilisas form 20 μ LPCR systems, carry out first
Walk PCR.Condition is：94 DEG C 3 minutes；94 DEG C 30 seconds, 47 DEG C 20 seconds, 68 DEG C 20 seconds, 30 cycle；68 DEG C 5 minutes；Slow cooling
It is preserved to 4 DEG C.Using first step PCR product as the template of second step PCR, take 2.5 μ L templates that 2.5 μ L forward primer F1 are added,
The oneTaqDNA polymerases of 25 μ L, 20 μ L aqua sterilisas form 50 μ LPCR systems, carry out second step PCR under the same conditions.Institute
The product obtained reacts after being dissolved in hybridization solution for chip hybridization；The hybridization solution is：The 12 of mass fraction 0.15%
Sodium alkyl sulfate, pH=7.0's contains 0.45mol/L sodium chloride and 45mmol/L trisodium citrates (two water) buffer solution.Institute
The washing lotion 1 stated is：Contain 0.01% lauryl sodium sulfate, 0.6mol/L sodium chloride, 60mmol/L trisodium citrates (two
Water) buffer solution (pH=7.0)；Washing lotion 2 is the 0.15mol/L sodium chloride containing 0.01% lauryl sodium sulfate,
The buffer solution (pH=7.0) of 15mmol/L trisodium citrates (two water)；
3, the DNA complementary strands of the gene probe for obtaining step 2-target gene dimer biochip and CY5 labels
(the DNA complementary strands of CY5 labels have SEQ No.5 sequences) carries out hybridization reaction, and 25 μ L are added on chip and contain 200nM's
The hybridization solution of the DNA complementary strands of CY5 labels is 30 DEG C in temperature, under the conditions of relative humidity is 40%, reacts 1 hour, finish
First washing lotion 1 is used to rinse 10~20 seconds afterwards, and washed 3 times at room temperature, each 4min；Again with 4 DEG C of Milli-Q milli-Q waters
3 times, each 3min, centrifugal drying 1min, obtain the BRAFV600E biochips of fluorescent marker.The DNA of the CY5 labels
The hybridization solution of complementary strand is：The lauryl sodium sulfate of mass fraction 0.15%, pH=7.0's contains 0.15mol/L chlorinations
Sodium and 15mmol/L trisodium citrates (two water) buffer solution.The washing lotion 1 is：Contain 0.015% dodecyl sulphate
Sodium, 0.15mol/L sodium chloride 16mmol/L trisodium citrates (two water) buffer solution (pH=7.0).
4, by the DNA complementary strands of gene probe-target gene dimer biochip and CY5 labels in the step 3
Carry out the micro- battle array of LuxScan-10K/A types that the biochip after hybridization is put into the production of Beijing Bo Ao Bioisystech Co., Ltd
It is detected in column scan instrument, obtains the fluorescent assay signal of BRAFV600E biochips.
According to the above experimental procedure, we obtain, and the results are shown in Figure 6.
Fig. 6 is to be detected obtained lattice optics picture, sample point to actual clinical sample with the method for the present invention
Cancerous tissue not from two thyroid cancer patients.Wherein first row dot matrix detection saltant type BRAFV600E genes (figure A), the
Two row detection wild type BRAFV600E genes (figure B).In the tissue DNA that can be seen that two patients by lattice optics picture
BRAFV600E gene mutations are detected on the basis of containing wild type unmutated BRAFV600E genes, i.e. mutation sun
Property.
Its detailed process is shown referring to the procedure that Fig. 1, Fig. 1 are detection BRAFV600E gene mutations of the present invention
It is intended to, wherein a is BRAFV600E gene probes, and b is target gene fragment to be measured, that is, BRAFV600E mutators, and c marks for CY5
The DNA complementary strands of note, a, c are the DNA synthesized by Shanghai Sangon Biological Engineering Technology And Service Co., Ltd, and b is given birth to by Shanghai
The product that the DNA or tissue extraction DNA of work biotechnology Services Co., Ltd synthesis are obtained through asymmetric PCR.
Sequence table
<110>Jilin University
<120>A method of detection BRAFV600E gene mutations
<160> 6
<170> SIPOSequenceListing 1.0
<210> 1
<211> 15
<212> DNA
<213>Artificial sequence (2 Ambystoma laterale x Ambystoma jeffersonianum)
<400> 1
gatttctctg tagct 15
<210> 2
<211> 15
<212> DNA
<213>Artificial sequence (2 Ambystoma laterale x Ambystoma jeffersonianum)
<400> 2
gatttcactg tagct 15
<210> 3
<211> 22
<212> DNA
<213>Artificial sequence (2 Ambystoma laterale x Ambystoma jeffersonianum)
<400> 3
aggtgatttt ggtctagcta ca 22
<210> 4
<211> 22
<212> DNA
<213>Artificial sequence (2 Ambystoma laterale x Ambystoma jeffersonianum)
<400> 4
ggatccagac aactgttcaa ac 22
<210> 5
<211> 15
<212> DNA
<213>Artificial sequence (2 Ambystoma laterale x Ambystoma jeffersonianum)
<400> 5
ggatccagac aactg 15
<210> 6
<211> 69
<212> DNA
<213>Artificial sequence (2 Ambystoma laterale x Ambystoma jeffersonianum)
<400> 6
gattttggtc tagctacaga gaaatctcga tggagtgggt cccatcagtt tgaacagttg 60
tctggatcc 69
Claims (10)
1. a kind of method of detection BRAFV600E gene mutations, which is characterized in that include the following steps：
Step 1：It is molten that two kinds of BRAFV600E gene probes with sampling liquid are mixed to get two kinds of BRAFV600E gene probe point samples
Then liquid carries out point sample on substrate, obtain BRAFV600E capture genetic chips；
Step 2：The DNA extracted in cell or tissue is subjected to the reaction of two step asymmetric PCRs, obtains single-stranded purpose base to be detected
Cause；
Step 3：Gene probe on BRAFV600E that step 1 obtains capture genetic chip is obtained with step 2 to be checked
The target gene fragment of cls gene or pure saltant type target gene fragment to be detected carry out hybridization reaction, obtain gene probe-mesh
Gene dimer biochip；
Step 4：The DNA complementary strands of the gene probe that step 3 is obtained-target gene dimer biochip and CY5 labels
Hybridization solution carries out hybridization reaction, obtains the BRAFV600E biochips of fluorescent marker；
Step 5：The BRAFV600E biochips for the fluorescent marker that step 4 obtains are put into microarray scanner and are examined
It surveys, obtains the fluorescent assay signal of BRAFV600E biochips, realize the detection to BRAFV600E gene mutations.
2. a kind of method of detection BRAFV600E gene mutations according to claim 1, which is characterized in that described two
Kind BRAFV600E gene probes are saltant type and wild type.
3. a kind of method of detection BRAFV600E gene mutations according to claim 1, which is characterized in that the step
A concentration of 10~50 μM of BRAFV600E gene probes in rapid one.
4. a kind of method of detection BRAFV600E gene mutations according to claim 1, which is characterized in that the step
Gene probe in rapid one is 3 '-NH2The DNA probe of modification.
5. a kind of method of detection BRAFV600E gene mutations according to claim 1, which is characterized in that the step
The condition of two step of asymmetric PCR in two is：First reacted 3 minutes at 94 DEG C；Then 30 seconds are reacted at 94 DEG C successively, 47
It is reacted at being reacted 20 seconds, 68 DEG C at DEG C 20 seconds, 30 cycles；Finally reacted 5 minutes at 68 DEG C；4 DEG C of preservations.
6. a kind of method of detection BRAFV600E gene mutations according to claim 1, which is characterized in that the step
Rapid three are specially：
The target gene fragment of cls gene to be checked or pure saltant type target gene fragment to be detected are put into hybridization solution, obtained
The hybridization solution of the target gene fragment of cls gene to be checked or or pure saltant type target gene fragment hybridization solution to be detected, then
It immerses and heats 2min~3min in boiling water, 40~47 DEG C are placed on after being loaded onto rapidly on BRAFV600E capture genetic chips, 25%
In the climatic chamber of~45% relative humidity, BRAFV600E is made to capture the BRAFV600E gene probes on genetic chip and wait for
Detect gene DNA complementary strands carry out hybridization reaction, react 2 hours, after by washing, obtain gene probe-purpose base
Because of dimer biochip.
7. a kind of method of detection BRAFV600E gene mutations according to claim 6, which is characterized in that described is miscellaneous
Hand over solution include：The lauryl sodium sulfate of mass fraction 0.1%~0.2%, pH=7.0 containing 0.4mol/L~
0.5mol/L sodium chloride and 40mmol/L~50mmol/L trisodium citrates (two water) buffer solution.
8. a kind of method of detection BRAFV600E gene mutations according to claim 1, which is characterized in that described waits for
Detect gene target gene fragment hybridization solution in cls gene to be checked target gene fragment a concentration of 0.01nM~
100nM。
9. a kind of method of detection BRAFV600E gene mutations according to claim 1, which is characterized in that the step
It is 30 DEG C that rapid four hybridization reaction, which is in temperature, is carried out in the climatic chamber that relative humidity is 25%~45%.
10. a kind of method of detection BRAFV600E gene mutations according to claim 1, which is characterized in that the step
The DNA complementary strand thereof solution that CY5 is marked in rapid four is that the DNA complementary strands that CY5 is marked are put into hybridization solution to obtain, institute
A concentration of 0.1 μM~0.2 μM of the DNA complementary strands for the CY5 labels stated.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810336729.4A CN108277260A (en) | 2018-04-16 | 2018-04-16 | A method of detection BRAFV600E gene mutations |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810336729.4A CN108277260A (en) | 2018-04-16 | 2018-04-16 | A method of detection BRAFV600E gene mutations |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN108277260A true CN108277260A (en) | 2018-07-13 |
Family
ID=62811501
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810336729.4A Pending CN108277260A (en) | 2018-04-16 | 2018-04-16 | A method of detection BRAFV600E gene mutations |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108277260A (en) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1570140A (en) * | 2003-07-25 | 2005-01-26 | 宋克 | Double probe gene chip signal amplification method |
| CN101182579A (en) * | 2007-11-19 | 2008-05-21 | 中国科学院上海微系统与信息技术研究所 | Nanometer detecting probe chip without amplifying genom DNA and detection method |
| US7632639B2 (en) * | 2003-02-21 | 2009-12-15 | Eisai R&D Management Co., Ltd. | Signal amplification method for detecting mutated gene |
| CN105506122A (en) * | 2016-01-08 | 2016-04-20 | 珠海赛乐奇生物技术股份有限公司 | Probe set for IL28B gene polymorphism detection, gene chip and kit |
-
2018
- 2018-04-16 CN CN201810336729.4A patent/CN108277260A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US7632639B2 (en) * | 2003-02-21 | 2009-12-15 | Eisai R&D Management Co., Ltd. | Signal amplification method for detecting mutated gene |
| CN1570140A (en) * | 2003-07-25 | 2005-01-26 | 宋克 | Double probe gene chip signal amplification method |
| CN101182579A (en) * | 2007-11-19 | 2008-05-21 | 中国科学院上海微系统与信息技术研究所 | Nanometer detecting probe chip without amplifying genom DNA and detection method |
| CN105506122A (en) * | 2016-01-08 | 2016-04-20 | 珠海赛乐奇生物技术股份有限公司 | Probe set for IL28B gene polymorphism detection, gene chip and kit |
Non-Patent Citations (2)
| Title |
|---|
| 王瑶琪: "分化型甲状腺癌相关基因微阵列基因芯片检测方法的构建", 《中国优秀硕士学位论文全文数据库》 * |
| 陈琰等: "应用微阵列芯片检测与2型糖尿病相关的单核苷酸多态性", 《高等学校化学学报》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JP3785517B2 (en) | Nucleic acid melting temperature measurement method | |
| JP3638516B2 (en) | Nucleic acid detection method and nucleic acid detection kit | |
| CN102634587B (en) | Method for combined and extended detection of continuous mutation of base by deoxyribonucleic acid (DNA) chips | |
| KR20020008195A (en) | Microarray-based analysis of polynucleotide sequence variations | |
| CN105671212A (en) | Preparation and application of adenovirus parting gene chip | |
| CN101586149B (en) | Oligonucleotide chip and application thereof | |
| CN114790483B (en) | SNP locus combination related to fuzzing rate of fine wool sheep and application thereof | |
| CN102435730A (en) | High flux detection method and biochip based on nucleic acid address coding | |
| CN113624823A (en) | Signal probe based on tetrahedral nano-structure DNA, preparation method and application thereof | |
| CN102559915A (en) | Method for detecting ATP aptamer and ATP | |
| CN108277260A (en) | A method of detection BRAFV600E gene mutations | |
| CN104357584A (en) | Preparation and application of guiding gene chip for HCV infection individual treatment | |
| WO2008102924A1 (en) | Microarray for detection of mitochondrial dna mutation and method for diagnosis of diabetes using the same | |
| CN102286636A (en) | Dengue virus detection and parting method, special chip and kit | |
| CN100400673C (en) | Method for detecting mononucleotide polymorphism and point mutation | |
| CN108517357A (en) | A kind of kit and its detection method detecting sudden cardiac death related SNP on sudden cardiac death correlation SCN5A genes | |
| CN103173543A (en) | Detection chip for predicating mutation of radiation adverse reaction relevant gene | |
| CN1392269A (en) | Nano gold mark silver dyeing detection method of gene chip | |
| CN104962651A (en) | CYP2C19 genotyping detection kit | |
| CN110144393A (en) | A kind of kit and genetic chip detecting ATP7B gene common mutations | |
| CN102787160A (en) | Method for high throughput detection of gene polymorphism | |
| TWI570242B (en) | Method of double allele specific pcr for snp microarray | |
| Wang et al. | DNA microarray-based resonance light scattering assay for multiplexed detection of DNA mutation in papillary thyroid cancer | |
| CN109486951B (en) | Lung cancer targeted drug gene detection kit, primers and method | |
| Pan'kov et al. | Kinetic effects on signal normalization in oligonucleotide microchips with labeled immobilized probes |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20180713 |
|
| RJ01 | Rejection of invention patent application after publication |