WO2008102924A1 - Microarray for detection of mitochondrial dna mutation and method for diagnosis of diabetes using the same - Google Patents

Microarray for detection of mitochondrial dna mutation and method for diagnosis of diabetes using the same Download PDF

Info

Publication number
WO2008102924A1
WO2008102924A1 PCT/KR2007/000958 KR2007000958W WO2008102924A1 WO 2008102924 A1 WO2008102924 A1 WO 2008102924A1 KR 2007000958 W KR2007000958 W KR 2007000958W WO 2008102924 A1 WO2008102924 A1 WO 2008102924A1
Authority
WO
WIPO (PCT)
Prior art keywords
probe
mutation
microarray
mtdna
detecting
Prior art date
Application number
PCT/KR2007/000958
Other languages
French (fr)
Inventor
Byung Hak Jhun
Kyong Soo Park
Hong Kyu Lee
Young Min Cho
Cheol Min Kim
Hyun Jung Jang
Original Assignee
Pusan National University Industry-University Cooperation Foundation
Genein Co., Ltd.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Pusan National University Industry-University Cooperation Foundation, Genein Co., Ltd. filed Critical Pusan National University Industry-University Cooperation Foundation
Priority to PCT/KR2007/000958 priority Critical patent/WO2008102924A1/en
Publication of WO2008102924A1 publication Critical patent/WO2008102924A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/16—Primer sets for multiplex assays

Definitions

  • the present invention relates to a method for detecting a diabetes-related mitochondrial DNA (hereinafter, referred to as mtDNA) mutation and a method for diagnosing eind predicting diabetes using the same. More particularly, the present invention relates to a method for simultaneously amplifying mutation distributed at various positions over the whole mtDNA in a single test tube, a microarray comprising target probes for detecting diabetes-related mtDNA mutation, negative control probes capable of determining whether the normal wild type and mutant type are mixed and the extent to which they are mixed in case of heteroplasmy and discriminating positivity and false positivity probe by background measurement through non-specific cross hybridization, and quality control probes capable of control the quality in the preparation of the microarray and the process (quality control probe, hereinafter refer to as QC probe) , and a method for detecting mtDNA mutation and diagnosing and expecting diabetes using the same.
  • quality control probe hereinafter refer to as QC probe
  • Diabetes is a group of diseases commonly showing increase of blood sugar and developed by many causes such as disorder in insulin secretion or insulin resistance causing factors. It accompanies with common chronic degenerative diseases such as high blood pressure, abnormal lipidemia, fatness, atherosclerosis and the like and causes complication in various organisms such as eye, kidney, nerve, blood and the like, leading to serious result such as increase in chronic diseases, malfunction and death (Johns DR, N Engl J Med. 333:638-44, 1995, Rozwodowska M, Med Sci Monit. 6:817-22, 2000).
  • the number of the diabetes patients increases to at least three hundred million on 2025 since it increases from a hundred thirty five million on 1995 to a hundred seventy million on 2000. Also, the number of the diabetes patients including those who may develop diabetes in Korea is about 5 million, it is expected that the number increases to about 10% of the total population on 2010 and to about 14.4% on 2030 (Dae-Duk specialized region headquarter report, 2007).
  • the diabetes is developed by hereditary cause and environmental factors and is the disease most affected by the hereditary cause among the chronic adult diseases developed by hereditary cause.
  • hereditary disorders such as insulin, insulin receptor, and glucokinase gene and the like are known.
  • less than 5% of diabetes are known for the cause gene and the rest is not known for the hereditary causes.
  • the studies on the hereditary causes of diabetes are focused on the genes positioned on the chromosome.
  • the role of the mitochondria in the development of diabetes attracts the public interest and it has been found that the mutation in mtDNA itself contributes to the development of diabetes (Sato A, Biosci Rep. 23: 313-37, 2003, Lowell BB, Shulman GI, Science, 307:384-7, 2005) .
  • mtDNA is associated with the development of diabetes since diabetes is found in the mitochondrial disorders and maternal inheritance is predominant in type 2 (adult) diabetes patients.
  • the secretion of insulin in ⁇ 3 cell of the pancreas where the insulin is produced is carried out as follows. As a result of the glucose oxidation, ATP is produced in the mitochondrial, K + channel is closed, depending on the ATP/ADP ratio, calcium channel is open, depending on the cell membrane voltage and calcium is introduced into the cell, while insulin is secreted.
  • the most common disorders are the point mutations of mitochondrial tRNA Leu(DUR) gene, which are more than 60% of the whole mtDNA, which are known to them more than ten kinds of it's mutations.
  • the most known mutation is the 3243 point mutation of the mitochondrial tRNA Leu(UUR) gene which is also shown in MELAS symptoms.
  • One of the characteristics of the diabetes including mitochondrial genetic disorder, particularly, 3243 point mutation of mitochondrial tRNA Leu(UUR) gene is the maternal hereditary by mitochondrial hereditary and hearing hardness is accompanied (Shanske S, Wong LJ, Mitochondrion.
  • the diabetes is caused by not only a certain gene but polygenetic disorders and affected by environment. Therefore, the expectation of genetic susceptibility may be detected by a kit including a set of genes in a single experiment.
  • various molecular biological detection methods are used for detection of point mutation. Representative examples of the methods include PCR-restriction fragment length polymorphism analysis
  • the PCR-RFLP method includes confirming amplification by electrophoresis after PCR process, keeping PCR product with point mutant specific restriction enzyme for about 3 hours, and examining the difference in the length by electrophoresis on about 3% or more agarose gel.
  • This method has defects in that 1) when EtBr (Ethidium Bromide) is used for detection by (in) agarose gel, it shows a low sensitivity on heteroplasmy, 2) it is not convenient by use of radioactive material, 3) it should be performed by many experiments and takes a long period of time, and 4) the incomplete cutting may occur by restriction enzyme treatment.
  • the direct sequencing method is useful in the detection of the known mutant or novel mtDNA mutation and known as ⁇ gold standard test method'. However it has two major defects. 1) In case of heteroplasmy where mtDNA polymorphism exists at a high frequency, the major mtDNA may be detected but the minor mtDNA may not be detected. 2) It has a low sensitivity and 3) the experiment should be repeated to analyze point mutant diversely distributed throughout mtDNA of total 16,539 bases by the base sequencing method which detects about 500 to 600 bases at a time (Wong LJ, Boles RG, Clin Chem. 50:1-20, 2005).
  • the analysis methods using the reverse hybridization theory are known to detect various mutation in a single experiment.
  • the biochip is the most wide concept, includes various biomolecules such as nucleic acid, proteins or ligands attached onto a support or semiconductor chip used for the medical purpose.
  • the DNA chip is also referred to as DNA array or DNA microarray and classified into cDNA chip, oligonucleotide chip ( or oligo chip) and BAC chip according to the types of the immobilized nucleic acids.
  • the studies and diagnosis using the DNA chip are divided into two fields, confirmation of gene expression and detection of genetic mutation.
  • cDNA chip and oligonucleotide chip are used and for the detection of genetic mutation, oligonucleotide chip and BAC chip are used.
  • the oligonucleotide chip is a method for study and diagnosis useful in the identification of pathogenic microorganism, detection of drug-resistance and detection of single nucleotide polymorphism (Cheol-MLn Kim, Hee-Kyung Park, Korean Medical Association, 46: 16 L6-1624, 2003).
  • Du W et al. (Du W, et al., Anal Biochem. , 322:14-25, 2003) used the DNA chip in a method for detection of mtDNA mutation.
  • a probe is designed to detect point mutation of the 3243th base and the 8344th base and used limitedly for detecting mutations diversely distributed over about 16.6 kb, a large amount of probe is integrated on a spot using a microwell as a support, and the number of probes integrated on the well since a probe is integrated on a well.
  • the microarray used in this study is for sequence analysis of whole mtDNA and needs a large number of probes to detect the whole 16.6 kb to position the four bases of A, C, G and T of the probe at the center of the probe, which increases the cost for the analysis.
  • the oligo chip by Jang HJ et al. (Jang HJ, et al., J Clin Microbiol. , 42:4181-4188, 2004, Cheol-Min Kim et ai., Korean Patent Registration No. 10-0650162, 2006) was used in the detection of drug-resistant HBV by point mutation. Also, the quality control was performed through the whole process of the oligo chip and when the normal and mutated HBV are mixed, whether they are mixed and the major type and the minor type were verified. The quality control of many factors in the preparation of the microarray is very important and particularly, the immobilization of probes is the critical factor to determine the quality of the microarray .
  • the present inventors established a method for quality control of the microarray using quality control probes, which is efficient and economical method for quality control of the microarray distinguished from the conventional inefficient method (See Cheol-Min Kim et al., Korean Patent Registration No. 10- 0590901, 2006) .
  • Cheol-Min Kim et al. (Cheol- Min Kim et al., Korean Patent Registration No. 10-0650162, 2006) studied the negative control probe for determining whether the wild type and mutant are mixed and discriminating the positivity and false positivity probes.
  • the negative control probe is useful in the determining of whether the wild type and mutant are mixed and discrimination of the major type and the minor type.
  • a microarray is prepared to include target probes for mtDNA mutation detection, QC probes for quality control of microarray through the whole process, and negative control probes for determining whether the normal and mutated mtDNA are mixed and the extent to which they are mixed and discriminating positivity and false positivity probes to detect a plurality of mutations distributed various positions through mtDNA in a single experiment and a microarray for diagnosis of diabetes is prepared using the same.
  • the present invention has been completed by the microarray and mtDNA mutation detection method.
  • an oligonucleotide for amplifying mtDNA including the sequence of any one of SEQ ID NOS: 1 to 4 or a complementary base sequence thereof.
  • an oligonucleotide for detecting mtDNA mutation including the base sequence of any one of SEQ ID NOs: 29 to 52.
  • an oligonucleotide for amplifying mutation at the target mutation site of the oligonucleotide or it's nearby site for detecting mtDNA mutation including the base sequence of any one of SEQ ID NOS: 5 to 28 or a complementary base sequence thereof.
  • a kit for detecting mitochondrial DNA mutation comprising at least one of the oligonucleotide for amplifying mtDNA and the oligonucleotide for detecting mtDNA mutation.
  • the oligonucleotide may be radioacti vely or non-radioactively labeled and the non-radioactively labeling is performed using biotin, Dig (digoxigenin) , FRET (fluorescence resonance energy transfer) , fluorescence (CyS, Cy3 and the like) .
  • the oligonucleotide can be used as a primer or a probe, including a primer for amplifying other target DNA.
  • a negative control probe for determining homoplasmy or heteroplasmy and distinguishing positivity and false positivity comprising an oligonucleotide designed by positioning a base selected from 2 types bases, except for the wild type base and the mutant base, at the point mutation site of mtDNA.
  • the negative control probe preferably comprises the base sequence of any one of SEQ ID NOS: 53 to 76.
  • a microarray comprising a target probe for detecting mtDNA mutation attached to a support.
  • the target probe comprises an oligonucleotide for detecting nucleotide mutation of mtDNA, preferably at least one oligonucleotide comprising any one of SEQ ID NOs: 29 to 52 or a complementary sequence thereof.
  • the negative control probe comprises oligonucleotides capable of determining whether wild mtDNA and mutant mtDNA are mixed, that is, discriminating homoplasmy and heteroplasmy and determining the extent of mixing, and discriminating positivity and false positivity by measurement of background of non-specific cross-hybridizaion, preferably oligonucleotides comprising nucleotide sequences of SEQ ID NOS: 53 to 76 or nucleotide sequences complementary thereto.
  • the probe includes nucleotide analogues, peptides or proteins selected from traditional nucleic acids such as deoxynucleotide (DNA) and ribonucleotide (RNA) , and peptidenucleotide (PNA), (LNA) and di-hexitol nucleotide
  • the nucleotide analogues are stable for enzymes such as nuclease, specifically bind to base sequences and are thermally stable.
  • the probe can be prepared for sense or antisense. Therefore, the oligonucleotide can be base sequences of the SEQ ID NOS: or sequences complement thereto.
  • the support is formed of slide glass, plastic, membrane, semiconductive chip, silicone, gel, nano material, ceramic, metallic material, optical fiber or a combination thereof.
  • the microarray according to the present invention can be prepared by the pin microarray method (McQuain MK, et al., Anal Biochem. , 320:281-91, 2003), the ink jet method (Okamoto T, et al., Nat Biotechnol .
  • the microarray for a diagnosis kit may further comprise an extracting reagent for isolating genomic DNA, a kit for amplifying DNA in a small amount, a kit for amplifying a target nucleotide labeled with fluorescent material such as biotin, hybridization solution, non- hybridization washing solution, cover slip, cover seal, dye, non-stained binding washing solution and instructions.
  • an extracting reagent for isolating genomic DNA a kit for amplifying DNA in a small amount
  • a kit for amplifying a target nucleotide labeled with fluorescent material such as biotin, hybridization solution, non- hybridization washing solution, cover slip, cover seal, dye, non-stained binding washing solution and instructions.
  • the amplification kit may be amplified using an RCA (rolling circle amplification) kit capable of amplifying 16.6 kb DNA of double stranded structure in a reaction tube by a single experiment or primers of SEQ ID NOS: 1 to 2 and primers of SEQ ID NOS: 3 to 4.
  • RCA rolling circle amplification
  • a detection method comprising the steps of isolating nucleic ac Ld from a sample, amplifying target DNA in the isolated nucleic acid, hybridizing the amplified DNA with a probe on the microarray and detecting signals of hybrids from in the above step.
  • the step for amplifying the target DNA can be performed using a general PCR reaction, modified pCR reactions such as Hot-start PCR, Nested PCR, Multiplex PCR, RT-PCR (reverse transcriptase PCR), DOP (degenerate oligonucleotide primer) PCR, Quantitative RT-PCR, In-Situ PCR, Micro PCR, or Lab-on a chip PCR, and isothermal amplification such as RCA (rolling circle amplification) .
  • modified pCR reactions such as Hot-start PCR, Nested PCR, Multiplex PCR, RT-PCR (reverse transcriptase PCR), DOP (degenerate oligonucleotide primer) PCR, Quantitative RT-PCR, In-Situ PCR, Micro PCR, or Lab-on a chip PCR, and isothermal amplification such as RCA (rolling circle amplification) .
  • signal amplification reaction such as tyramide signal amplification ( Karsten SL, et al., Nucleic Acids Res., 30:E4, 2002), or probe amplification such as branched DNA, gold nanoparticle probe, and Raman-active dye(Cao YC, et al . , Science, 297:1536-1540, 2002) can be used.
  • separation of nucleic acid may be performed by a common DNA or RNA separation method or kit, and the PCR detection method may be commonly performed by electrophoresis using agarose gel, the detection of microarray signals may be performed using a common fluorescent dye such as Cy3 or Cy 5, and a scanner for signal detection.
  • a method for detecting mtDNA mutation for mtDNA mutation related diseases including diabetes a method for detecting mtDNA mutation, and method and kit for diagnosing mtDNA mutation.
  • a detection method capable of simultaneously performing at least one of amplification of whole mtDNA by a single reaction, simultaneous detection of a plurality of mtDNA mutations distributed at various positions by a single experiment, quality control of the whole processes of the microarray and mixing of at least one types, detection of positivity and false positivity probe by measurement of background of non-specific cross-hybridization, and discrimination of homoplasmy and heteroplasmy .
  • the present invention is explained in detail as follows.
  • the present invention relates to a probe for detecting mtDNA mutation attached on a support, a quality control probe for quality control of a microarray and a microarray comprising a negative control probe for discriminating whether a wild mtDNA and a mutant mtDNA are mixed (homoplasmy or heteroplasmy) , and a method for diagnosing diabetes using the same comprising the steps of:
  • the microarray includes the target probe and fluorescent- labeled QC probe, and a plurality of sets comprising the negative control probe and QC probe at each spot on the support in the step (iii) .
  • the microarray according to the present invention, it is possible to detect mtDNA mutation from a plurality of test subjects at a time by a single experiment using a cover seal and to diagnose diabetes using the microarray. Also, according to the present invention, optimal reaction conditions are established to simultaneously amplify primers specific to a plurality of target mutations, whereby the hybridization and washing can be performed under the same conditions.
  • FIG. 1 shows the microarray of an example according to the present invention
  • FIG. 2 shows the result of the hybridization of the microarray for 663A>G mutation of mitochondrial DNA for verifying specificity of the target probes
  • FIG. 3 shows the result of the hybridization of the microarray for 4833A>G mutation of mitochondrial DNA for verifying specificity of the target probes
  • FIG. 4 shows the result of the scanner analysis of a slide after QC probe, target probe and negative control probe were mixed in a predetermined rate and immobilized on the slide and the slide was washed;
  • FIG. 5 shows the result of the specific hybridization of the probe for detecting a mitochondrial DNA mutation
  • FIG. 6 shows the result of the hybridization of the microarray prepared according to the present invention
  • FIG. 7 and FIG. 8 show the result of hybridization of the microarray according to the present invention, which includes images of scanner analysis and a graph showing the result of signal analysis of normal and mutated probe of target mutation and negative control probe;
  • FIG. 9 illustrates the results of hybridization and sequence analysis using the microarray of heteroplasmy according to the present invention. [Best Mode]
  • Example 1 Isolation of DNA mtDNA used in the present invention was obtained from immortalized B-cell line and genomic DNA isolated from blood of a patient and used as a template DNA for polymerase chain reaction.
  • the oligonucleotides (primers) for amplifying mtDNA according to the present invention are SEQ ID NOS: 1 to 28 shown in Table 1.
  • the probe for detecting mtDNA mutation was prepared by synthesizing a probe containing a dT spacer having a base of amino-modifier C6-15 at 5' -end and a probe having 15-25 sequences, followed by PAGE purification.
  • the target probes prepared according to the present inventions were SEQ ID NOS: 29 to 52 shown in Table 2.
  • SEQ ID NOS: 1 to 4 were outer primers for primary PCR reaction and one DNA were each amplified using primer pairs of SEQ ID NOS: 1 and 2, and SEQ ID NOS: 3 and 4.
  • SEQ ID NOS: 5 to 28 were biotin-labeled primer and used as the inner primer.
  • SEQ ID NOS: 29 to 52 were probes for detecting mtDNA mutation
  • SEQ ID NOS: 29 and 30 were probes for detecting nucleotide mutation 663A>G
  • SEQ ID NOS: 31 and 32 were probes for detecting nucleotide mutation 3243A>G
  • SEQ ID NOS: 33 to 36 were probes for detecting nucleotide mutation 4833A>G
  • SEQ ID NOS: 37 and 38 were probes for detecting nucleotide mutation 5178OA
  • SEQ ID NOS: 39 and 40 were probes for detecting nucleotide mutation 5231G>A
  • SEQ ID NOS: 41 to 44 were probes for detecting nucleotide mutation 7598OA
  • SEQ ID NOS: 45 and 46 were probes for detecting nucleotide mutation 12371OA
  • SEQ ID NOS: 47 and 48 were probes for detecting nucleotide mutation 12406G>A
  • SEQ ID NOS: 49 and 50 were probes
  • Nucleotide probe Nucleotide SEQ ID NO: mutation sequence (5 ' ⁇ 3 ' direction)
  • Example 3 Preparation of fluorescent dye-labeled ZC probes
  • the QC probes used in the present invention were those developed by the present inventors (see Korean Patent Registration No. 10-0590901 by Cheol-Min Kim et al. (2006); Jang HJ, et al., J Clin Microbiol. , 42:4181-4188, 2004; and Korean Patent Registration No. 10-0650162 by Cheol-Min Kim et al . (2006)).
  • the QC probes had the complementary sequence to the nucleotide sequence of the target product or were fluorescent labeled oligonucleotides having any nucleotide sequence, in which the fluorescent material characteristically had excitation/emission wavelength different from the fluorescent material labeling the target product.
  • Example 4 Preparation of negative control probe
  • the negative control probes used in the present invention had the design developed by the present inventors (see Korean Patent Registration No. 10-0650162 by Cheol-Min Kim et al. (2006); and Jang HJ, et al., J Clin Microbiol., 42:4181-4188, 2004) .
  • two bases except for the nucleotides corresponding to the wild type and mutant were used as negative control probes.
  • SEQ ID NOS: 53 and 54 were negative control probes for nucleotide mutation 663A>G
  • SEQ ID NOS: 55 and 56 were negative control probes for nucleotide mutation 3243A>G
  • SEQ ID NOS: 57 to 60 were negative control probes for nucleotide mutation 4833A>G
  • SEQ ID NOS: 61 and 62 were negative control probes for nucleotide mutation 5178OA
  • SEQ ID NOS: 63 and 64 were negative control probes for nucleotide mutation 5231G>A
  • SEQ ID NO: 65 to 68 were negative control probes for nucleotide mutation 7598OA
  • SEQ ID NOS: 69 and 70 were negative control probes for nucleotide mutation 12372OA
  • SEQ ID NOS: 71 and 72 were negative control probes for nucleotide mutation 12406G>A
  • SEQ ID NOS: 73 and 74 were negative control probes for nucleotide mutations for nucleo
  • Example 5 Probe Immobilization on Support
  • Each of the target probes prepared in Example 2 and the negative control probes prepared in Example 4 was diluted to a concentration of 30 to 50 pmol and mixed with 1 to 10 pmol of the QC probes prepared in Example 3 and a micro-spotting solution or 3 X SSC solution.
  • the mixture of the probes was attached onto a support such as slide glass using a microarrayer (Cartesian Technologies, PLXSYS 7500 SQLX Microarrayer, U.S.A.) to prepare a plurality of microarrays in the type of b to c of FlG. 1.
  • a microarrayer Cartesian Technologies, PLXSYS 7500 SQLX Microarrayer, U.S.A.
  • Each kind of the probes was attached onto the support at two spots and left at room temperature for 24 hours or in a dry oven at 50 "C for about 5 hours to be fixed on the surface of the support.
  • the long PCR method was used for one sample to exclude pseudogene.
  • the primary long PCR was performed by preparing total 25 ⁇ i of the PCR reaction mixture using the isolated mtDNA 100 nq/ ⁇ i and mt_01 and mt_02 primer pair and mt_03 and mt_04 primer pair in Table 1, and polymerase for the long PCR.
  • the mixture reacted for 2 minutes at 95 ° C for sufficient denaturalization.
  • the process including the reaction 20 seconds at 95 "C, 40 seconds at 60 ° C and 12 minutes at 68 ° C was repeated 35 times and finally the mixture was extended for 10 minutes at 68 ° C.
  • the amplified reaction product was amplified to 11.2 kb using mt_01 and mt 02 primer and to 6.5 kb using mt 03 and mt 04 primer.
  • the reaction product from the primary amplification was used to prepare the biotin-labeled target product for hybridization using the specific primer for the target mutation amplification of Table 2.
  • the second PCR was performed using 2 ⁇ JL of the primary PCR reaction product and the biotin-labeled target mutation specific primer.
  • mt_S01 and mt_S02 primer for 663A>G in Table 2 mt_S04 and mt_S06 primer for 3243A>G, mt_S07 and mt_S10 primer for 4833A>G, mt_Sll and mt__S14 primer for 5178OA and 5231OA, mt_S17 and mt_S18 primer for 7598OA, mt_S19 and mt_S20 primer for 12372OA and 12406OA, mt_S21 and mt__S22 primer for 13263A>G, and mt_S23 and mt_S24 primer for 16189T>C were used.
  • the PCR reaction solution was reacted for 3 minutes at 95 ° C for sufficient denaturalization, and the process including the reaction for 1 minute at 95 ° C , 1 minute at 57 "C 1 minute at 72 ° C was repeated 30 times and finally, the solution was reacted 10 minutes at 72 ° C .
  • This example was performed by establishing the method and conditions for amplifying pseudogene-free and 16.6 kb mtDNA in a single amplification. 100 nq/ ⁇ i of mtDNA was mixed with 5 ⁇ i of the sample buffer using an RCA kit
  • Example 5 This is to wash the probe unimmobilized on the slide glass after the process in Example 5 or Example 7.
  • the slide glass was washed with a 0.2% SDS buffer solution and then distilled water at room temperature.
  • the washed slide glass was immersed in a sodium borohydride (NaBH 4 ) solution for 5 minutes and then washed again at 100 ° C. Finally, the slide washed with 0.2% SDS solution and then distilled water, followed by centrifugation for fully drying the slide glass.
  • NaBH 4 sodium borohydride
  • the biotin-labeled target products prepared in Example 6 were thermally treated to be denaturated into single strands and cooled to 4 ° C .
  • a hybridization solution containing 1 to 5 ⁇ l of the target products and 10 ⁇ i or 60 ⁇ l of a reaction solution containing Cy5-streptavidin or Cy3- streptavidin (Amersham pharmacia biotech, USA) were prepared.
  • the hybridization solution was portioned on the slide glass after the process in Example 8 and the slide glass was covered with a cover slip or a cover seal to prevent formation of foam. Then, 60 ⁇ lt of the reaction solution was portioned on the glass and left at 40 ° C for 30 minutes while blocking lights.
  • the cover slip was removed using 2 X SSC (300 mm NaCl, 30 mm Na- Citrate, pH 7.0) washing solution, and the slide was washed with 2 X SSC and then 0.2 X SSC, followed by centrifugation for fully drying the slide glass.
  • 2 X SSC 300 mm NaCl, 30 mm Na- Citrate, pH 7.0
  • the hybridized result was scanned using a non-confocal laser scanner (GenePix 4000A, Axon Instruments, U.S.A.) and analyzed by image analysis.
  • FIG. 1 shows the microarray of an example according to the present invention, in which target probes to detect total 10 target mutations and negative control probes are positioned on a slide glass as a support and a microarray is designed to simultaneously perform the experiment for a plurality of samples, that is 2 or 6.
  • FIG. Ia to Ib are views of the microarray to show the positions of the target and negative control probes attached on the support. Ia shows the target probes and the negative control probes to detect mtDNA mutation.
  • the first probe and positions of the probes are identified by the QC probes contained in the microarray according to the present invention.
  • Ib comprises positive probes prepared by mixing the probe at the first position with probes in a predetermined concentration.
  • FIG. 2 and FIG. 3 are the results confirming the probe specificity for the target mutation of the probe designed according to the present invention, which are representative results.
  • FIG. 2 shows the result of the hybridization of the microarray for 663A>G mutation of mtDNA for verifying specificity of the target probes, in which a) for mtDNA having the wild type 663 nucleotide A base, the wild type specific probe (SEQ ID NO: 29) having signal intensity
  • S.I mutant specific probe having S.I of 17172 is clearly distinguished from the mutant specific probe having S.I of 12374 by the negative control probe having S.I of 13500, and b) for DNA having the mutation of 663 nucleotide A—»G, the mutant specific probe (SEQ ID NO: 30) having S.I of 8340 is clearly distinguished from the wild type specific probe having S.I of 4506 by the negative control probe having S.I of 4770.
  • FIG. 3 shows the result of the hybridization of the microarray for 4833A>G mutation of mtDNA for verifying specificity of the target probes, in which a) for mtDNA having the wild type 4833 nucleotide A base, the wild type specific probe (SEQ ID NO: 33) having signal intensity (hereinafter refer to S.I) of 4252 is clearly distinguished from the mutant specific probe having S.I of 443 by the negative control probe having S.I of 552, and b) for DNA having the mutation of 4833 nucleotide A ⁇ G, the mutant specific probe (SEQ ID NO: 34) having S.I of 1826 is clearly distinguished from the wild type specific probe having S.I of 1312 by the negative control probe having S.I of 1352.
  • SEQ ID NO: 33 wild type specific probe having signal intensity (hereinafter refer to S.I) of 4252 is clearly distinguished from the mutant specific probe having S.I of 443 by the negative control probe having S.I of 552, and b) for DNA having the mutation of 4833
  • FIG. 4 shows the result of the scanner analysis of a slide after QC probe, target probe and negative control probe are mixed in a predetermined rate and immobilized on the slide and the slide was washed in FIG. Ib, in which a) shows that the probe immobilized on the slide is good in the immobilized state such as shape and concentration of the probe, that is, the result of the quality control of the prepared microarray is good and b) shows that the shape and concentration of the integrated probe are not uniform and some probes are not integrated on the slide, thereby affecting on the result of the experiment. Therefore, it is noted the poor quality control of the prepared microarray can affect on the precise result analysis.
  • FIG. 5 shows the result of the specific hybridization of the probe for detecting a DNA mutation, including the result of quality control by the QC probe of the prepared microarray and the result of the specific hybridization of the target product expressing the target mutation and the target probe.
  • FIG. 6 shows the result of the hybridization of the microarray prepared according to E 1 IG. Ia, which is obtained from the reaction between mtDNA with 663A>G mutation and the mutant probe of 663_M probe (SEQ ID NO: 30).
  • FIG. 7 and FIG. 8 show the result of hybridization of the target probe onto the microarray prepared according to FIG. Ib, which includes images of scanner analysis and a graph showing the result of signal, analysis of the normal and mutated probe of target mutation and the negative control probe.
  • FIG. 7 and FIG. 8 shows that it is possible to discriminate the probe (12406_M, SEQ ID NO: 48) having S.I 112 to detect G ⁇ A mutation in 12406 nucleotide from 1240 ⁇ _W (SEQ ID NO: 47), 124O6_N1 (SEQ ID NO: 71) and 12406_N2 (SEQ ID NO: 72) of 52, 50 and 43.
  • FIG. 9 illustrates the results of hybridization and sequence analysis using the microarray of heteroplasmy according to the present invention.
  • the wild type specific target probe 663_W SEQ ID NO: 29
  • the mutant specific probe 663_M SEQ ID NO: 30
  • S.I SEQ ID NO: 1691 and 1946
  • SEQ ID NO: 53 SEQ ID NO: 53
  • 663_N2 SEQ ID NO: 54
  • the present invention can be used in a method for detecting mtDNA mutation using a microarray comprising target probes to detect mtDNA mutation, fluorescent-labeled QC probes, and a negative control probe for the target probe to determine homoplasmy or heteroplasmy by examining whether wild and mutant DNA are mixed and to detect positivity and false positivity probe and QC probes attached at spots on a support, and a kit for diagnosing diabetes.
  • a microarray comprising target probes to detect mtDNA mutation, fluorescent-labeled QC probes, and a negative control probe for the target probe to determine homoplasmy or heteroplasmy by examining whether wild and mutant DNA are mixed and to detect positivity and false positivity probe and QC probes attached at spots on a support, and a kit for diagnosing diabetes.
  • the detection method and diagnosis method according to the present invention can be usefully and effectively used in other diseases related to mtDNA mutation.

Abstract

The present invention relates to a microarray for detecting a mitochondrial DNA mutation and a method for diagnosing diabetes using the same. According to the present invention, there is provided a microarray capable of detecting a plurality of mutations in a single experiment comprising 1) a target probe for detecting diabetes-related mitochondrial DNA mutation, 2) a negative control probe for determining homoplasmy or heteroplasmy by examining whether the wild type and the mutant are mixed and the extent to which they are mixed and discriminating positivity and false positivity by background measurement through non-specific cross-hybridization, and 3) a QC probe for quality control of the microarray. Also, the present invention provides a method for amplifying the whole DNA by a single reaction of genome such mitochondrial DNA while excluding pseudogene. According to the present invention, there is provided a method for diagnosing mitochondrial DNA mutation associated diabetes and other mitochondrial DNA mutation associated diabetes using the microarray.

Description

[DESCRI PTION]
[invention Title]
Microarray for detection of mitochondrial DNA mutation and method for diagnosis of diabetes using the same
[Technical Field]
The present invention relates to a method for detecting a diabetes-related mitochondrial DNA (hereinafter, referred to as mtDNA) mutation and a method for diagnosing eind predicting diabetes using the same. More particularly, the present invention relates to a method for simultaneously amplifying mutation distributed at various positions over the whole mtDNA in a single test tube, a microarray comprising target probes for detecting diabetes-related mtDNA mutation, negative control probes capable of determining whether the normal wild type and mutant type are mixed and the extent to which they are mixed in case of heteroplasmy and discriminating positivity and false positivity probe by background measurement through non-specific cross hybridization, and quality control probes capable of control the quality in the preparation of the microarray and the process (quality control probe, hereinafter refer to as QC probe) , and a method for detecting mtDNA mutation and diagnosing and expecting diabetes using the same.
[Background Art]
Diabetes is a group of diseases commonly showing increase of blood sugar and developed by many causes such as disorder in insulin secretion or insulin resistance causing factors. It accompanies with common chronic degenerative diseases such as high blood pressure, abnormal lipidemia, fatness, atherosclerosis and the like and causes complication in various organisms such as eye, kidney, nerve, blood and the like, leading to serious result such as increase in chronic diseases, malfunction and death (Johns DR, N Engl J Med. 333:638-44, 1995, Rozwodowska M, Med Sci Monit. 6:817-22, 2000). World health organization and The International Diabetes Federation expect that the number of the diabetes patients increases to at least three hundred million on 2025 since it increases from a hundred thirty five million on 1995 to a hundred seventy million on 2000. Also, the number of the diabetes patients including those who may develop diabetes in Korea is about 5 million, it is expected that the number increases to about 10% of the total population on 2010 and to about 14.4% on 2030 (Dae-Duk specialized region headquarter report, 2007).
The diabetes is developed by hereditary cause and environmental factors and is the disease most affected by the hereditary cause among the chronic adult diseases developed by hereditary cause. Up to date, hereditary disorders such as insulin, insulin receptor, and glucokinase gene and the like are known. However, less than 5% of diabetes are known for the cause gene and the rest is not known for the hereditary causes. So far, the studies on the hereditary causes of diabetes are focused on the genes positioned on the chromosome. However, recently, the role of the mitochondria in the development of diabetes attracts the public interest and it has been found that the mutation in mtDNA itself contributes to the development of diabetes (Sato A, Biosci Rep. 23: 313-37, 2003, Lowell BB, Shulman GI, Science, 307:384-7, 2005) .
It has been supposed that mtDNA is associated with the development of diabetes since diabetes is found in the mitochondrial disorders and maternal inheritance is predominant in type 2 (adult) diabetes patients. The secretion of insulin in {3 cell of the pancreas where the insulin is produced is carried out as follows. As a result of the glucose oxidation, ATP is produced in the mitochondrial, K+ channel is closed, depending on the ATP/ADP ratio, calcium channel is open, depending on the cell membrane voltage and calcium is introduced into the cell, while insulin is secreted.
Particularly, in diabetes patient, various types of mutations such as point mutation of mtDNA, deletion and insertion have been found. Among them, it has been reported the most common disorder is the mutation, in which A is substituted with G at the 3243th base of the gene coding mitochondrial tRNA leucine to transfer leucine, which develops diabetes by disorder in insulin secretion (van den Ouweland JM, et al., Nat Genet. 1:368-371, 1992, Suzuki Y, et al., Metabolism 46:1019-1023, 1997), and the mutation, in which T is substituted C at the 16189th base of the D-loop control region, which develops associated with insulin resistance and fatness (Kim JH, et al., Diabet Med. 19:681-684, 2002, Gill-Randall R, et al., Diabet Med. 18:413- 416 2001) . One of the features of mtDNA mutation is that heteroplasmy can be observed, in which the wild type mtDNA and mutated mtDNA are present together (Shanske S, Wong LJ, Mitochondrion. 4:403-415, 2004).
In the diabetes patient, various types of disorders such as point mutation, deletion and insertion are found. Among them, the most common disorders are the point mutations of mitochondrial tRNALeu(DUR) gene, which are more than 60% of the whole mtDNA, which are known to them more than ten kinds of it's mutations. The most known mutation is the 3243 point mutation of the mitochondrial tRNALeu(UUR) gene which is also shown in MELAS symptoms. One of the characteristics of the diabetes including mitochondrial genetic disorder, particularly, 3243 point mutation of mitochondrial tRNALeu(UUR) gene is the maternal hereditary by mitochondrial hereditary and hearing hardness is accompanied (Shanske S, Wong LJ, Mitochondrion. 4:403-415, 2004, Urata M, et al., Clin Chem. 50:2045-2051, 2004). Also, the diabetes is caused by not only a certain gene but polygenetic disorders and affected by environment. Therefore, the expectation of genetic susceptibility may be detected by a kit including a set of genes in a single experiment. In the diagnosis of diabetes by mtDNA disorder, various molecular biological detection methods are used for detection of point mutation. Representative examples of the methods include PCR-restriction fragment length polymorphism analysis
(PCR-RFLP analysis) and direct sequencing of the PCR product. The PCR-RFLP method includes confirming amplification by electrophoresis after PCR process, keeping PCR product with point mutant specific restriction enzyme for about 3 hours, and examining the difference in the length by electrophoresis on about 3% or more agarose gel. This method has defects in that 1) when EtBr (Ethidium Bromide) is used for detection by (in) agarose gel, it shows a low sensitivity on heteroplasmy, 2) it is not convenient by use of radioactive material, 3) it should be performed by many experiments and takes a long period of time, and 4) the incomplete cutting may occur by restriction enzyme treatment. The direct sequencing method is useful in the detection of the known mutant or novel mtDNA mutation and known as Λgold standard test method'. However it has two major defects. 1) In case of heteroplasmy where mtDNA polymorphism exists at a high frequency, the major mtDNA may be detected but the minor mtDNA may not be detected. 2) It has a low sensitivity and 3) the experiment should be repeated to analyze point mutant diversely distributed throughout mtDNA of total 16,539 bases by the base sequencing method which detects about 500 to 600 bases at a time (Wong LJ, Boles RG, Clin Chem. 50:1-20, 2005).
In addition, as a molecular biological method useful in the discrimination the difference of the single nucleotide sequence, the analysis methods using the reverse hybridization theory are known to detect various mutation in a single experiment. Among the methods using the reverse hybridization, the biochip is the most wide concept, includes various biomolecules such as nucleic acid, proteins or ligands attached onto a support or semiconductor chip used for the medical purpose. The DNA chip is also referred to as DNA array or DNA microarray and classified into cDNA chip, oligonucleotide chip ( or oligo chip) and BAC chip according to the types of the immobilized nucleic acids. The studies and diagnosis using the DNA chip are divided into two fields, confirmation of gene expression and detection of genetic mutation. For the confirmation of gene expression, cDNA chip and oligonucleotide chip are used and for the detection of genetic mutation, oligonucleotide chip and BAC chip are used. The oligonucleotide chip is a method for study and diagnosis useful in the identification of pathogenic microorganism, detection of drug-resistance and detection of single nucleotide polymorphism (Cheol-MLn Kim, Hee-Kyung Park, Korean Medical Association, 46: 16 L6-1624, 2003).
Du W et al., (Du W, et al., Anal Biochem. , 322:14-25, 2003) used the DNA chip in a method for detection of mtDNA mutation. However, a probe is designed to detect point mutation of the 3243th base and the 8344th base and used limitedly for detecting mutations diversely distributed over about 16.6 kb, a large amount of probe is integrated on a spot using a microwell as a support, and the number of probes integrated on the well since a probe is integrated on a well. Also, in the process for preparing the target product, it is impossible to control the quality of the prepared DNA chip while performing the hybridization after the PCR reaction purification. Maita A et al. (Maita A, et al., Genome Res., 14:812-819, 2006) performed the sequence analysis and mutation analysis of mtDNA using a microarray. The microarray used in this study is for sequence analysis of whole mtDNA and needs a large number of probes to detect the whole 16.6 kb to position the four bases of A, C, G and T of the probe at the center of the probe, which increases the cost for the analysis.
The oligo chip by Jang HJ et al. (Jang HJ, et al., J Clin Microbiol. , 42:4181-4188, 2004, Cheol-Min Kim et ai., Korean Patent Registration No. 10-0650162, 2006) was used in the detection of drug-resistant HBV by point mutation. Also, the quality control was performed through the whole process of the oligo chip and when the normal and mutated HBV are mixed, whether they are mixed and the major type and the minor type were verified. The quality control of many factors in the preparation of the microarray is very important and particularly, the immobilization of probes is the critical factor to determine the quality of the microarray . Therefore, it is important to verify the quality of the microarray before the hybridization, particularly, the immobilization of probes, to obtain a result with high reliability in experiments and diagnosis using the microarray. Also, it is possible to control the quality in the change of the immobilization of the target probe on the microarray after the hybridization. For this, the present inventors established a method for quality control of the microarray using quality control probes, which is efficient and economical method for quality control of the microarray distinguished from the conventional inefficient method (See Cheol-Min Kim et al., Korean Patent Registration No. 10- 0590901, 2006) . For precise detection and diagnosis when the wild type or mutant exist alone and when the wild and mutant are mixed, it is necessary to determine whether at least one types are mixed and the extent to which they are mixed and to discriminate the positivity and false positivity results on each probe by measurement of background by non-specific cross-hybridization. For this, Cheol-Min Kim et al. (Cheol- Min Kim et al., Korean Patent Registration No. 10-0650162, 2006) studied the negative control probe for determining whether the wild type and mutant are mixed and discriminating the positivity and false positivity probes. The negative control probe is useful in the determining of whether the wild type and mutant are mixed and discrimination of the major type and the minor type.
Therefore, present inventors have searched for development of a method for detecting mtDNA mutation in a precise and convenient way and a method for diagnosis of diabetes using the same and found that the target product is prepared using the amplification method to reduce the contamination by the minimized manipulation, a microarray is prepared to include target probes for mtDNA mutation detection, QC probes for quality control of microarray through the whole process, and negative control probes for determining whether the normal and mutated mtDNA are mixed and the extent to which they are mixed and discriminating positivity and false positivity probes to detect a plurality of mutations distributed various positions through mtDNA in a single experiment and a microarray for diagnosis of diabetes is prepared using the same. Thus, the present invention has been completed by the microarray and mtDNA mutation detection method.
[Disclosure] [Technical problem]
Therefore, it is an object of the present invention to provide a microarray for rapidly and precisely detecting mtDNA mutation and a method for diagnosing diabetes using the same .
It is another object of the present invention to provide a method for amplifying mutation distributed at various sites with a minimum of sample and reagent consumption and experimental manipulation to produce a target product .
It is a still another object of the present invention to provide a microarray for detecting mtDNA mutation by the method for amplifying a target product as described above and a method for diagnosing diabetes using the same.
It is a further object of the present invention to provide a method for detecting mtDNA mutation and a method for economically, rapidly and accurately diagnosing a plurality of mtDNA mutation-related diseases by detecting a plurality of mtDNA mutations at a time using a microarray.
[Technical solution]
To accomplish the above objects, according to the present invention, there is provided an oligonucleotide for amplifying mtDNA including the sequence of any one of SEQ ID NOS: 1 to 4 or a complementary base sequence thereof.
Also, according to the present invention, there is provided an oligonucleotide for detecting mtDNA mutation including the base sequence of any one of SEQ ID NOs: 29 to 52.
Also, according to the present invention, there is provided an oligonucleotide for amplifying mutation at the target mutation site of the oligonucleotide or it's nearby site for detecting mtDNA mutation including the base sequence of any one of SEQ ID NOS: 5 to 28 or a complementary base sequence thereof. In another aspect according to the present invention, there is provided a kit for detecting mitochondrial DNA mutation comprising at least one of the oligonucleotide for amplifying mtDNA and the oligonucleotide for detecting mtDNA mutation. In the kit according to the present invention, the oligonucleotide may be radioacti vely or non-radioactively labeled and the non-radioactively labeling is performed using biotin, Dig (digoxigenin) , FRET (fluorescence resonance energy transfer) , fluorescence (CyS, Cy3 and the like) . Also, the oligonucleotide can be used as a primer or a probe, including a primer for amplifying other target DNA.
According to the present invention, there is provided a negative control probe for determining homoplasmy or heteroplasmy and distinguishing positivity and false positivity comprising an oligonucleotide designed by positioning a base selected from 2 types bases, except for the wild type base and the mutant base, at the point mutation site of mtDNA.
According to the present invention, the negative control probe preferably comprises the base sequence of any one of SEQ ID NOS: 53 to 76.
In another aspect of the present invention, there is provided a microarray comprising a target probe for detecting mtDNA mutation attached to a support. In the microarray according to the present invention, the target probe comprises an oligonucleotide for detecting nucleotide mutation of mtDNA, preferably at least one oligonucleotide comprising any one of SEQ ID NOs: 29 to 52 or a complementary sequence thereof.
In the microarray according to the present invention, the negative control probe comprises oligonucleotides capable of determining whether wild mtDNA and mutant mtDNA are mixed, that is, discriminating homoplasmy and heteroplasmy and determining the extent of mixing, and discriminating positivity and false positivity by measurement of background of non-specific cross-hybridizaion, preferably oligonucleotides comprising nucleotide sequences of SEQ ID NOS: 53 to 76 or nucleotide sequences complementary thereto.
In order to accomplish another objects of the present invention, there is provided a method for simultaneously performing at least one of detection of spot mutations using the microarray according to the present invention and discrimination of homoplsamy and heteroplasmy.
In the microarray according to the present invention, the probe includes nucleotide analogues, peptides or proteins selected from traditional nucleic acids such as deoxynucleotide (DNA) and ribonucleotide (RNA) , and peptidenucleotide (PNA), (LNA) and di-hexitol nucleotide
(HNA) . The nucleotide analogues are stable for enzymes such as nuclease, specifically bind to base sequences and are thermally stable. In the microarray according to the present invention, the probe can be prepared for sense or antisense. Therefore, the oligonucleotide can be base sequences of the SEQ ID NOS: or sequences complement thereto.
In the microarray according to the present invention, the support is formed of slide glass, plastic, membrane, semiconductive chip, silicone, gel, nano material, ceramic, metallic material, optical fiber or a combination thereof. The microarray according to the present invention can be prepared by the pin microarray method (McQuain MK, et al., Anal Biochem. , 320:281-91, 2003), the ink jet method (Okamoto T, et al., Nat Biotechnol . , 18;438-441, 2000), photolithography (Lipshutz RJ, et al., Nat Genet., 21:20-24, 1999), or the electronic array method (Sosnowski R, et al., Psychiatr Genet., 12:181-192, 2002), which is well-known to the art.
The microarray for a diagnosis kit according to the present invention may further comprise an extracting reagent for isolating genomic DNA, a kit for amplifying DNA in a small amount, a kit for amplifying a target nucleotide labeled with fluorescent material such as biotin, hybridization solution, non- hybridization washing solution, cover slip, cover seal, dye, non-stained binding washing solution and instructions.
In the diagnosis kit according to the present invention, the amplification kit may be amplified using an RCA (rolling circle amplification) kit capable of amplifying 16.6 kb DNA of double stranded structure in a reaction tube by a single experiment or primers of SEQ ID NOS: 1 to 2 and primers of SEQ ID NOS: 3 to 4.
In order to accomplish another objects of the present invention, there is provided a detection method comprising the steps of isolating nucleic ac Ld from a sample, amplifying target DNA in the isolated nucleic acid, hybridizing the amplified DNA with a probe on the microarray and detecting signals of hybrids from in the above step.
According to the detection method of the present invention, the step for amplifying the target DNA can be performed using a general PCR reaction, modified pCR reactions such as Hot-start PCR, Nested PCR, Multiplex PCR, RT-PCR (reverse transcriptase PCR), DOP (degenerate oligonucleotide primer) PCR, Quantitative RT-PCR, In-Situ PCR, Micro PCR, or Lab-on a chip PCR, and isothermal amplification such as RCA (rolling circle amplification) . Also, with or without undergoing the amplification step, signal amplification reaction such as tyramide signal amplification ( Karsten SL, et al., Nucleic Acids Res., 30:E4, 2002), or probe amplification such as branched DNA, gold nanoparticle probe, and Raman-active dye(Cao YC, et al . , Science, 297:1536-1540, 2002) can be used.
In the method according to the present invention, separation of nucleic acid may be performed by a common DNA or RNA separation method or kit, and the PCR detection method may be commonly performed by electrophoresis using agarose gel, the detection of microarray signals may be performed using a common fluorescent dye such as Cy3 or Cy 5, and a scanner for signal detection.
In order to accomplish another objects of the present invention, there is provided a method for detecting mtDNA mutation for mtDNA mutation related diseases including diabetes, a method for detecting mtDNA mutation, and method and kit for diagnosing mtDNA mutation.
In order to accomplish another objects of the present invention, there is provided a detection method capable of simultaneously performing at least one of amplification of whole mtDNA by a single reaction, simultaneous detection of a plurality of mtDNA mutations distributed at various positions by a single experiment, quality control of the whole processes of the microarray and mixing of at least one types, detection of positivity and false positivity probe by measurement of background of non-specific cross-hybridization, and discrimination of homoplasmy and heteroplasmy . The present invention is explained in detail as follows.
The present invention relates to a probe for detecting mtDNA mutation attached on a support, a quality control probe for quality control of a microarray and a microarray comprising a negative control probe for discriminating whether a wild mtDNA and a mutant mtDNA are mixed (homoplasmy or heteroplasmy) , and a method for diagnosing diabetes using the same comprising the steps of:
( i ) isolation of mtDNA from a sample, as needed, ( ii ) amplifying the mtDNA 16.6 kb full length or a part thereof to at least one suitable pair of primers of Table 1 or Table 2, as needed,
( iii ) hybridizing the target product from the step ( i ) and/or ( ii ) with an oligonucleotide for detecting mtDNA mutation shown in Table 3 to tabLe 4, that is, at lease one probe capable of reacting with a probe sequence, a probe reverse sequence or a probe complementary sequence,
( iv ) detecting a hybrid formed in the step (iii), ( V ) identifying the mtDNA mutation and assuming the possibility of diagnosis of diabetes from hybridization signals obtained in the step (iv) .
In the preferred embodiment of the present invention, the microarray includes the target probe and fluorescent- labeled QC probe, and a plurality of sets comprising the negative control probe and QC probe at each spot on the support in the step (iii) .
In order to accomplish the above objects, on one support of the microarray according to the present invention, it is possible to detect mtDNA mutation from a plurality of test subjects at a time by a single experiment using a cover seal and to diagnose diabetes using the microarray. Also, according to the present invention, optimal reaction conditions are established to simultaneously amplify primers specific to a plurality of target mutations, whereby the hybridization and washing can be performed under the same conditions.
[Description of Drawings]
Further objects and advantages of the invention can be more fully understood from the following detailed description taken in conjunction with the accompanying drawings, in which:
FIG. 1 shows the microarray of an example according to the present invention;
FIG. 2 shows the result of the hybridization of the microarray for 663A>G mutation of mitochondrial DNA for verifying specificity of the target probes;
FIG. 3 shows the result of the hybridization of the microarray for 4833A>G mutation of mitochondrial DNA for verifying specificity of the target probes;
FIG. 4 shows the result of the scanner analysis of a slide after QC probe, target probe and negative control probe were mixed in a predetermined rate and immobilized on the slide and the slide was washed;
FIG. 5 shows the result of the specific hybridization of the probe for detecting a mitochondrial DNA mutation; FIG. 6 shows the result of the hybridization of the microarray prepared according to the present invention;
FIG. 7 and FIG. 8 show the result of hybridization of the microarray according to the present invention, which includes images of scanner analysis and a graph showing the result of signal analysis of normal and mutated probe of target mutation and negative control probe; and
FIG. 9 illustrates the results of hybridization and sequence analysis using the microarray of heteroplasmy according to the present invention. [Best Mode]
Now, the present invention is described in detail based on the following Examples. The Examples are only for illustrative purpose and the present invention is not limited thereto.
Example 1: Isolation of DNA mtDNA used in the present invention was obtained from immortalized B-cell line and genomic DNA isolated from blood of a patient and used as a template DNA for polymerase chain reaction.
Example 2 : Preparation of primer for amplifying mtDNA and probe for detecting mutation
The oligonucleotides (primers) for amplifying mtDNA according to the present invention are SEQ ID NOS: 1 to 28 shown in Table 1. The probe for detecting mtDNA mutation was prepared by synthesizing a probe containing a dT spacer having a base of amino-modifier C6-15 at 5' -end and a probe having 15-25 sequences, followed by PAGE purification. The target probes prepared according to the present inventions were SEQ ID NOS: 29 to 52 shown in Table 2.
In Table 1, SEQ ID NOS: 1 to 4 were outer primers for primary PCR reaction and one DNA were each amplified using primer pairs of SEQ ID NOS: 1 and 2, and SEQ ID NOS: 3 and 4. SEQ ID NOS: 5 to 28 were biotin-labeled primer and used as the inner primer. Also, SEQ ID NOS: 29 to 52 were probes for detecting mtDNA mutation, SEQ ID NOS: 29 and 30 were probes for detecting nucleotide mutation 663A>G, SEQ ID NOS: 31 and 32 were probes for detecting nucleotide mutation 3243A>G, SEQ ID NOS: 33 to 36 were probes for detecting nucleotide mutation 4833A>G, SEQ ID NOS: 37 and 38 were probes for detecting nucleotide mutation 5178OA, SEQ ID NOS: 39 and 40 were probes for detecting nucleotide mutation 5231G>A, SEQ ID NOS: 41 to 44 were probes for detecting nucleotide mutation 7598OA, SEQ ID NOS: 45 and 46 were probes for detecting nucleotide mutation 12371OA, SEQ ID NOS: 47 and 48 were probes for detecting nucleotide mutation 12406G>A, SEQ ID NOS: 49 and 50 were probes for detecting nucleotide mutation 13263A>G, and SEQ ID NOS: 51 and 52 were probes for detecting nucleotide mutation 16189T>C.
Figure imgf000020_0001
Figure imgf000020_0002
4833 mt_S10 GGTAATTGAGGAGTATGCTA 14
5178/ 5231 mt _S11 CGTACAACCCTAACATAACC 15
5178/ 5231 mt _S12 ATATTATCCTAACTACTACCGC 16
5178/ 5231 mt _S13 TCTTCGATAATGGCCCATTTG 17
5178/ 5231 mt _S14 GGTGGGGATGATGAGGCTATTG 18
5178/ 5231 mt _S15 GGTTAAGGAGGGTGATGGTG 19
5178/ 5231 mt S16 GGAGATAGGTAGGAGTAGCG 20
7598 mt _S17 AGAACCCTCCATAAACCTGG 21
7598 mt _S18 GGACTAGGAAGCAGATAAGG 22
12372/ 12406 mt _S19 GGTGCAACTCCAAATAAAAG 23
12372/ 12406 mt _S20 GGTTGTGGCTCAGTGTCAGT 24
13263 mt _S21 CACTATGCTTAGGCGCTATC 25
13263 mt _S22 GATGTGGTCTTTGGAGTAGA 26
16181 mt _S23 ATTACTGCCAGCCACCATGA 27
16181 mt S24 GGATTTGACTGTAATGTGCT 28
[Table 3] Probes for detecting target nucleotide mutation
Nucleotide probe Nucleotide SEQ ID NO: mutation sequence (5 ' →3 ' direction)
663A>G 663_W TGGTCCTAGCCTTTC 29
663A>G 663_M TGGTCCTGGCCTTTC 30
3243A>G 3243_W ATGGCAGAGCCCGGT 31
3243A>G 3243_M ΆTGGCAGGGCCCGGT 32
4833A>G 4833_W CCAAGGCACCCCTCT 33
4833A>G 4833_M CCAAGGCGCCCCTCT 34
4833A>G 4833 W-2 GGTTACCCAAGGCACCCCTCT 35
4833A>G 4833_M-2 GGTTACCCAAGGCGCCCCTCT 36
5178OA 5178_W CTGAAACAAGCTAACATGAC 37
5178OA 5178_M CTGAAACAAGATAACATGAC 38
5231OA 5231_W GAGGCCTGCCCCCGC 39
5231G>A 5231_M GAGGCCTACCCCCGC 40
Figure imgf000022_0001
Example 3 : Preparation of fluorescent dye-labeled ZC probes The QC probes used in the present invention were those developed by the present inventors (see Korean Patent Registration No. 10-0590901 by Cheol-Min Kim et al. (2006); Jang HJ, et al., J Clin Microbiol. , 42:4181-4188, 2004; and Korean Patent Registration No. 10-0650162 by Cheol-Min Kim et al . (2006)). The QC probes had the complementary sequence to the nucleotide sequence of the target product or were fluorescent labeled oligonucleotides having any nucleotide sequence, in which the fluorescent material characteristically had excitation/emission wavelength different from the fluorescent material labeling the target product. Therefore, even after the integrated probe was verified, by analyzing the QC probe labeled with a fluorescent material of a specific wavelength using the microarray before this experiment for diagnosis and study, it is possible to verify the hybridization with the probe attached onto the support without spectral interference.
Example 4 : Preparation of negative control probe The negative control probes used in the present invention had the design developed by the present inventors (see Korean Patent Registration No. 10-0650162 by Cheol-Min Kim et al. (2006); and Jang HJ, et al., J Clin Microbiol., 42:4181-4188, 2004) . Also, according to the present invention, among the four bases, two bases except for the nucleotides corresponding to the wild type and mutant were used as negative control probes. Thus, it was possible to discriminate the positive and false positive probe by non- specific hybridization.
In Table 4, 1) SEQ ID NOS: 53 and 54 were negative control probes for nucleotide mutation 663A>G, 2) SEQ ID NOS: 55 and 56 were negative control probes for nucleotide mutation 3243A>G, 3) SEQ ID NOS: 57 to 60 were negative control probes for nucleotide mutation 4833A>G, 4) SEQ ID NOS: 61 and 62 were negative control probes for nucleotide mutation 5178OA, 5) SEQ ID NOS: 63 and 64 were negative control probes for nucleotide mutation 5231G>A, 6) SEQ ID NO: 65 to 68 were negative control probes for nucleotide mutation 7598OA, 7) SEQ ID NOS: 69 and 70 were negative control probes for nucleotide mutation 12372OA, 8) SEQ ID NOS: 71 and 72 were negative control probes for nucleotide mutation 12406G>A, 9) SEQ ID NOS: 73 and 74 were negative control probes for nucleotide mutation 13263A>G, and 10) SEQ ID NOS: 75 and 76 were negative control probes for nucleotide mutation 16189T>C.
Figure imgf000024_0001
Example 5 : Probe Immobilization on Support Each of the target probes prepared in Example 2 and the negative control probes prepared in Example 4 was diluted to a concentration of 30 to 50 pmol and mixed with 1 to 10 pmol of the QC probes prepared in Example 3 and a micro-spotting solution or 3 X SSC solution. The mixture of the probes was attached onto a support such as slide glass using a microarrayer (Cartesian Technologies, PLXSYS 7500 SQLX Microarrayer, U.S.A.) to prepare a plurality of microarrays in the type of b to c of FlG. 1. Each kind of the probes was attached onto the support at two spots and left at room temperature for 24 hours or in a dry oven at 50 "C for about 5 hours to be fixed on the surface of the support.
Example 6 : Preparation of target product 1) Long PCR
Upon detection of the target mutation distributed on various positions of total about 16.6 kb mtDNA, the long PCR method was used for one sample to exclude pseudogene. The primary long PCR was performed by preparing total 25 βi of the PCR reaction mixture using the isolated mtDNA 100 nq/βi and mt_01 and mt_02 primer pair and mt_03 and mt_04 primer pair in Table 1, and polymerase for the long PCR. The mixture reacted for 2 minutes at 95°C for sufficient denaturalization. The process including the reaction 20 seconds at 95 "C, 40 seconds at 60°C and 12 minutes at 68 °C was repeated 35 times and finally the mixture was extended for 10 minutes at 68 °C. The amplified reaction product was amplified to 11.2 kb using mt_01 and mt 02 primer and to 6.5 kb using mt 03 and mt 04 primer.
The reaction product from the primary amplification was used to prepare the biotin-labeled target product for hybridization using the specific primer for the target mutation amplification of Table 2. The second PCR was performed using 2 μJL of the primary PCR reaction product and the biotin-labeled target mutation specific primer. In this Example, mt_S01 and mt_S02 primer for 663A>G in Table 2, mt_S04 and mt_S06 primer for 3243A>G, mt_S07 and mt_S10 primer for 4833A>G, mt_Sll and mt__S14 primer for 5178OA and 5231OA, mt_S17 and mt_S18 primer for 7598OA, mt_S19 and mt_S20 primer for 12372OA and 12406OA, mt_S21 and mt__S22 primer for 13263A>G, and mt_S23 and mt_S24 primer for 16189T>C were used. The PCR reaction solution was reacted for 3 minutes at 95°C for sufficient denaturalization, and the process including the reaction for 1 minute at 95 °C , 1 minute at 57 "C 1 minute at 72 °C was repeated 30 times and finally, the solution was reacted 10 minutes at 72 °C .
2) RCA
This example was performed by establishing the method and conditions for amplifying pseudogene-free and 16.6 kb mtDNA in a single amplification. 100 nq/μi of mtDNA was mixed with 5 βi of the sample buffer using an RCA kit
(Amersham Bioscience, TempliPhi™ 100 Amplification kit) , denatured at 95 °C for 3 minutes and left at 4 °C for a while. 5 μi of the mixture of the prepared reaction buffer and the enzyme mix was added to a reaction tube. The contents of the tube were isothermally amplified at 30 °C for about 3 to 12 hours. After the amplification, the product was thermally treated at 65°C for 10 minutes and then used as the reagent for the second PCR. The second PCR was performed by the same process as the long PCR of 1) . Example 7 : Assessment of probe immobilization quality
The assessment was performed by following the method developed by the present inventors (see Korean Patent Registration No. 10-0590901 by Cheol-Min Kim et al. (2006); Jang HJ, et al., J Clin Microbiol. , 42:4181-4188, 2004; and Korean Patent Registration No. 10-0650162 by Cheol-Min Kim et al. (2006))
Example 8 : Unimmobilized Probe Washing
This is to wash the probe unimmobilized on the slide glass after the process in Example 5 or Example 7. The slide glass was washed with a 0.2% SDS buffer solution and then distilled water at room temperature. The washed slide glass was immersed in a sodium borohydride (NaBH4) solution for 5 minutes and then washed again at 100°C. Finally, the slide washed with 0.2% SDS solution and then distilled water, followed by centrifugation for fully drying the slide glass.
Example 9: Hybridization and staining
The biotin-labeled target products prepared in Example 6 were thermally treated to be denaturated into single strands and cooled to 4 °C . A hybridization solution containing 1 to 5 βl of the target products and 10 μi or 60 βl of a reaction solution containing Cy5-streptavidin or Cy3- streptavidin (Amersham pharmacia biotech, USA) were prepared. The hybridization solution was portioned on the slide glass after the process in Example 8 and the slide glass was covered with a cover slip or a cover seal to prevent formation of foam. Then, 60 βlt of the reaction solution was portioned on the glass and left at 40 °C for 30 minutes while blocking lights.
Example 10: Washing of non-specific hybridization target product
To wash out remaining unhybridized target products, the cover slip was removed using 2 X SSC (300 mm NaCl, 30 mm Na- Citrate, pH 7.0) washing solution, and the slide was washed with 2 X SSC and then 0.2 X SSC, followed by centrifugation for fully drying the slide glass.
Example 11: Result analysis
The hybridized result was scanned using a non-confocal laser scanner (GenePix 4000A, Axon Instruments, U.S.A.) and analyzed by image analysis.
FIG. 1 shows the microarray of an example according to the present invention, in which target probes to detect total 10 target mutations and negative control probes are positioned on a slide glass as a support and a microarray is designed to simultaneously perform the experiment for a plurality of samples, that is 2 or 6. FIG. Ia to Ib are views of the microarray to show the positions of the target and negative control probes attached on the support. Ia shows the target probes and the negative control probes to detect mtDNA mutation. Upon the analysis of the result, the first probe and positions of the probes are identified by the QC probes contained in the microarray according to the present invention. The microarray prepared according to FIG. Ib comprises positive probes prepared by mixing the probe at the first position with probes in a predetermined concentration. By such microarray, it is possible to identify the position of the first probe through the positive probe upon the analysis of the result. Therefore, two views of the microarray can be usefully used in the present invention.
FIG. 2 and FIG. 3 are the results confirming the probe specificity for the target mutation of the probe designed according to the present invention, which are representative results.
FIG. 2 shows the result of the hybridization of the microarray for 663A>G mutation of mtDNA for verifying specificity of the target probes, in which a) for mtDNA having the wild type 663 nucleotide A base, the wild type specific probe (SEQ ID NO: 29) having signal intensity
(hereinafter refer to S.I) of 17172 is clearly distinguished from the mutant specific probe having S.I of 12374 by the negative control probe having S.I of 13500, and b) for DNA having the mutation of 663 nucleotide A—»G, the mutant specific probe (SEQ ID NO: 30) having S.I of 8340 is clearly distinguished from the wild type specific probe having S.I of 4506 by the negative control probe having S.I of 4770.
FIG. 3 shows the result of the hybridization of the microarray for 4833A>G mutation of mtDNA for verifying specificity of the target probes, in which a) for mtDNA having the wild type 4833 nucleotide A base, the wild type specific probe (SEQ ID NO: 33) having signal intensity (hereinafter refer to S.I) of 4252 is clearly distinguished from the mutant specific probe having S.I of 443 by the negative control probe having S.I of 552, and b) for DNA having the mutation of 4833 nucleotide A→G, the mutant specific probe (SEQ ID NO: 34) having S.I of 1826 is clearly distinguished from the wild type specific probe having S.I of 1312 by the negative control probe having S.I of 1352.
FIG. 4 shows the result of the scanner analysis of a slide after QC probe, target probe and negative control probe are mixed in a predetermined rate and immobilized on the slide and the slide was washed in FIG. Ib, in which a) shows that the probe immobilized on the slide is good in the immobilized state such as shape and concentration of the probe, that is, the result of the quality control of the prepared microarray is good and b) shows that the shape and concentration of the integrated probe are not uniform and some probes are not integrated on the slide, thereby affecting on the result of the experiment. Therefore, it is noted the poor quality control of the prepared microarray can affect on the precise result analysis.
FIG. 5 shows the result of the specific hybridization of the probe for detecting a DNA mutation, including the result of quality control by the QC probe of the prepared microarray and the result of the specific hybridization of the target product expressing the target mutation and the target probe.
FIG. 6 shows the result of the hybridization of the microarray prepared according to E1IG. Ia, which is obtained from the reaction between mtDNA with 663A>G mutation and the mutant probe of 663_M probe (SEQ ID NO: 30).
FIG. 7 and FIG. 8 show the result of hybridization of the target probe onto the microarray prepared according to FIG. Ib, which includes images of scanner analysis and a graph showing the result of signal, analysis of the normal and mutated probe of target mutation and the negative control probe. FIG. 7 and FIG. 8 shows that it is possible to discriminate the probe (12406_M, SEQ ID NO: 48) having S.I 112 to detect G→A mutation in 12406 nucleotide from 1240β_W (SEQ ID NO: 47), 124O6_N1 (SEQ ID NO: 71) and 12406_N2 (SEQ ID NO: 72) of 52, 50 and 43.
FIG. 9 illustrates the results of hybridization and sequence analysis using the microarray of heteroplasmy according to the present invention. When the wild type mtDNA and the mutant mtDNA for the target mutation 663A>G are mixed together, the wild type specific target probe 663_W (SEQ ID NO: 29) and the mutant specific probe 663_M (SEQ ID NO: 30) have S.I of 1691 and 1946, respectively, which are higher than S.I 650 and 251 of the negative control probe 663_N1 (SEQ ID NO: 53) and 663_N2 (SEQ ID NO: 54) . Thus, it is noted that two target probes are all positive heteroplasmy. In order to confirm the result, the sequence analysis was performed. As a result, it was confirmed that the graph showing the wild type A base and the graph showing the mutant G base are mixed.
[industrial Applicability]
As described above, the present invention can be used in a method for detecting mtDNA mutation using a microarray comprising target probes to detect mtDNA mutation, fluorescent-labeled QC probes, and a negative control probe for the target probe to determine homoplasmy or heteroplasmy by examining whether wild and mutant DNA are mixed and to detect positivity and false positivity probe and QC probes attached at spots on a support, and a kit for diagnosing diabetes. According to the present invention it is possible to detect mtDNA mutation, to determine whether homoplasmy and heteroplasmy are mixed and to detect positive probe and false positive probe by measurement of non-specific cross- hybridization background in a simple and precise way by a single experiment.
Also, the detection method and diagnosis method according to the present invention can be usefully and effectively used in other diseases related to mtDNA mutation.

Claims

[CLAIMS]
[Claim l]
An oligonucleotide for amplifying mtDNA comprising the sequence of any one of SEQ ID NO: 1 to 4 or a complementary sequence thereof.
[Claim 2]
An oligonucleotide for detecting mtDNA mutation comprising the sequence of any one of SEQ ID NO: 29 to 52.
[Claim 3] An oligonucleotide for amplifying the target mutation site according to claim 2 or it's nearby site comprising the sequence of any one of SEQ ID NOS: 5 to 28 or a complementary sequence thereof.
[Claim 4] A negative control probe for determining homoplasmy or heteroplasmy and distinguishing positivity and false positivity comprising oligonucleotide designed by positioning a base selected from two types bases except for the wild type base and the mutant base at the point mutation site of mtDNA. [Claim 5]
The negative control probe according to claim 4, which comprises the sequence of any one of SEQ ID NOS: 53 to 76. [Claim β]
A kit for detecting mitochondrial DNA mutation comprising at least one oligonucleotide according to claims 1 to 3.
[Claim 7]
A microarray for detecting mitochondrial DNA mutation comprising the oligonucleotide for detecting mtDNA mutation according to claim 2 as a probe.
[Claim 8] The microarray according to claim 7, which further comprises the negative control probe according to claim 4.
[Claim 9]
The microarray according to claim 8, which further comprises a QC probe for quality control.
[Claim 10]
The microarray according to any one of claims 7 to 9, in which the probe is a nucleotide analogues selected from deoxynucleotide (DNA) , ribonucleotide (RNA) , or peptide nucleotide (PNA), locked nucleotide (LNA) and de-hexitol nucleotide (HNA) .
[Claim 11]
The microarray according to any one of claims 7 to 9, in which the substrate to support the probe is formed of slide glass, plastic, membrane, semiconductive chip, silicone, gel, nano material, ceramic, metallic material, optical fiber or a combination thereof.
[Claim 12]
A method for detecting a mitochondrial DNA mutation comprising the steps of: isolating nucleic acid existing in a sample; amplifying a target DNA in the isolated nucleic acid; hybridizing the amplified DNA with probes on the microarray according to any one of claims 7 to 9; and detecting a signal of the hybrid formed in the above step.
[Claim 13]
The method according to claim 12, in which the amplification step includes amplification of a target DNA by the primary reaction of RCA, nested-PCR, LA-PCR and the like and target mutant specific amplification by the secondary reaction of multiplex PCR and single-specific PCR.
[Claim 14] The method according to claim 12, in which the amplification step includes RCA (rolling circle amplification) or multiplex PCR, or a combination thereof.
[Claim 15] A method for diagnosing diabetes using the method for detecting mitochondrial DNA gene mutation according to claim 12. [Claim lβ]
The method according to claim 15, in which the probe on the microarray comprises at least one diabetes-related point mutation.
PCT/KR2007/000958 2007-02-23 2007-02-23 Microarray for detection of mitochondrial dna mutation and method for diagnosis of diabetes using the same WO2008102924A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
PCT/KR2007/000958 WO2008102924A1 (en) 2007-02-23 2007-02-23 Microarray for detection of mitochondrial dna mutation and method for diagnosis of diabetes using the same

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
PCT/KR2007/000958 WO2008102924A1 (en) 2007-02-23 2007-02-23 Microarray for detection of mitochondrial dna mutation and method for diagnosis of diabetes using the same

Publications (1)

Publication Number Publication Date
WO2008102924A1 true WO2008102924A1 (en) 2008-08-28

Family

ID=39710191

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2007/000958 WO2008102924A1 (en) 2007-02-23 2007-02-23 Microarray for detection of mitochondrial dna mutation and method for diagnosis of diabetes using the same

Country Status (1)

Country Link
WO (1) WO2008102924A1 (en)

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2010096875A1 (en) * 2009-02-27 2010-09-02 Verva Pharmaceuticals Ltd A drug identification protocol for type 2 diabetes based on gene expression signatures
CN101956017A (en) * 2010-10-22 2011-01-26 广州阳普医疗科技股份有限公司 Gene chip for detecting mutation of 18 loci of susceptibility genes of type 2 diabetes
WO2011144818A1 (en) * 2010-05-19 2011-11-24 Mas-Metabolic Analytical Services Oy Method for detection of predisposition to atherosclerosis, coronary heart disease and related conditions
CN113322317A (en) * 2021-07-05 2021-08-31 北京华诺奥美基因生物科技有限公司 Primer pair, probe set and kit for mitochondrial obesity gene mutation detection
CN114134224A (en) * 2021-12-07 2022-03-04 中国人民解放军总医院 Mitochondrial detection site related to sports muscle injury, detection method and application

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2005012573A1 (en) * 2003-08-05 2005-02-10 Cheol-Min Kim Microarray comprising probes for drug-resistant hepatitis b virus detection, quality control and negative control, and method for detecting drug-resistant hepatitis b virus using the same

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2005012573A1 (en) * 2003-08-05 2005-02-10 Cheol-Min Kim Microarray comprising probes for drug-resistant hepatitis b virus detection, quality control and negative control, and method for detecting drug-resistant hepatitis b virus using the same

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
BAI R.-K. AND WONG L.-J.C.: "Detection and quantification of heteroplasmic mutant mitochondrial DNA by real-time ARMS-qPCR analysis: a single-step approach", CLINICAL CHEMISTRY, vol. 50, no. 6, 8 April 2004 (2004-04-08), pages 1 - 6 *
GILL-RANDALL R. ET AL.: "Analysis of a polcytosine tract and heteroplasmic length variation in the mitochondrial DNA D-loop of patients with diabetes, MELAS syndrome and race-matched controls", DIABETIC MEDICINE, vol. 18, no. 5, May 2001 (2001-05-01), pages 413 - 416 *
KEIICHI KAMEOKA ET AL.: "Novel mitochondrial DNA mutation in tRNALys (8296A G) associated with diabetes", BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS, vol. 245, no. 2, 1998, pages 523 - 527 *
LIU S.M. ET AL.: "Development of a DNA chip screening mitochondrial DNA mutations in patients with diabetes mellitus", ZHONGHUA YI XUE ZA ZHI, vol. 86, no. 40, 31 October 2006 (2006-10-31), pages 2853 - 2857 *

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2010096875A1 (en) * 2009-02-27 2010-09-02 Verva Pharmaceuticals Ltd A drug identification protocol for type 2 diabetes based on gene expression signatures
WO2011144818A1 (en) * 2010-05-19 2011-11-24 Mas-Metabolic Analytical Services Oy Method for detection of predisposition to atherosclerosis, coronary heart disease and related conditions
CN101956017A (en) * 2010-10-22 2011-01-26 广州阳普医疗科技股份有限公司 Gene chip for detecting mutation of 18 loci of susceptibility genes of type 2 diabetes
CN101956017B (en) * 2010-10-22 2013-03-06 广州阳普医疗科技股份有限公司 Gene chip for detecting mutation of 18 loci of susceptibility genes of type 2 diabetes
CN113322317A (en) * 2021-07-05 2021-08-31 北京华诺奥美基因生物科技有限公司 Primer pair, probe set and kit for mitochondrial obesity gene mutation detection
CN114134224A (en) * 2021-12-07 2022-03-04 中国人民解放军总医院 Mitochondrial detection site related to sports muscle injury, detection method and application
CN114134224B (en) * 2021-12-07 2022-12-02 中国人民解放军总医院 Mitochondrial detection site related to sports muscle injury, detection method and application

Similar Documents

Publication Publication Date Title
JP4860869B2 (en) Method for amplifying and detecting a plurality of polynucleotides on a solid support
KR101176091B1 (en) Detection of chromosomal disorders
US6376191B1 (en) Microarray-based analysis of polynucleotide sequence variations
US8637302B2 (en) Method for single nucleotide polymorphism and mutation detection using real time polymerase chain reaction microarray
CN103946397B (en) Bifunctional oligonucleotide probes for universal real-time multiplex assay detection
US20050191636A1 (en) Detection of STRP, such as fragile X syndrome
JP5663491B2 (en) Target nucleic acid detection method
US8017327B2 (en) Single nucleotide polymorphism genotyping detection via the real-time invader assay microarray platform
WO2008102924A1 (en) Microarray for detection of mitochondrial dna mutation and method for diagnosis of diabetes using the same
US20090143245A1 (en) Microarrays for genotyping and methods of use
WO2001068913A2 (en) Nucleic acid detection method and system
KR20140000439A (en) Oligonucleotide for detection of mutations in genes associated with korean nonsyndromic hearing loss, dna chip, diagnositic kit and method for detection of the mutations using the oligonucleotides
EP3447154A1 (en) Method for detection of mutations, polymorphisms and specific dna sequences on dna matrices with dna imaging techniques for the use in medical diagnostics and forensic genetics
JP5613160B2 (en) Method for detecting or analyzing a target sequence in genomic DNA
JP2022145606A (en) Highly sensitive methods for accurate parallel quantification of nucleic acids
RU2402771C2 (en) Method of screening cardiovascular diseases and biochip for said method realisation
TWI570242B (en) Method of double allele specific pcr for snp microarray
EP1207209A2 (en) Methods using arrays for detection of single nucleotide polymorphisms
JPWO2005001091A1 (en) Probe set for detecting nucleic acid mutation and polymorphism, DNA array on which it is immobilized, and method for detecting mutation and polymorphism using the same
JP2007068429A (en) Method for judging contracted digestive system disease by il-10 polymorphism detection and kit therefor
JP2024034944A (en) Hybridization buffer composition and hybridization method
WO2009139515A1 (en) Method for detection of multi-drug resistant hepatitis b virus

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 07715374

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 07715374

Country of ref document: EP

Kind code of ref document: A1