CN108265103B - Pig mitochondrial genome targeted sequence capture kit and application thereof - Google Patents

Abstract

The invention discloses a pig mitochondrial genome targeted sequence capture kit and application thereof, wherein the kit comprises a capture probe of a targeted pig mitochondrial genome sequence, the capture probe consists of a biotin-labeled nucleotide sequence, and the nucleotide sequence is shown as SEQ ID NO: 1-106, the method for obtaining the genome sequence of the pig mitochondria comprises the following steps: 1) extracting the genomic DNA of the pig; 2) constructing a porcine whole genome library; 3) the method is particularly suitable for targeted capture of the mitochondrial genome sequence in the ancient DNA of the pig, and has the advantages of high sensitivity, strong specificity, good stability, higher capture efficiency by combining with a nucleic acid library, 99.99 percent of coverage and low detection cost.

Description

Pig mitochondrial genome targeted sequence capture kit and application thereof

Technical Field

The invention belongs to the technical field of biology, and particularly relates to a kit for capturing a pig mitochondrial genome targeted sequence, a novel method for obtaining a pig mitochondrial genome sequence, and application of the capture kit in obtaining a pig ancient DNA mitochondrial genome sequence.

Background

Generally, the historical agricultural revolution in humans has primarily involved the production of cultivated crops and the domestication of animal origins. The systematic exploration of the origin of livestock is important for understanding the development history of livestock and revealing the influence of livestock on the life style of human beings. It is well known that domestic pigs (Sus scrofa) result from domestication of wild pigs. Currently, boar distribution areas are concentrated on: 1) southern parts of continental europe, i.e., european boars distributed in europe, north africa, and central Tianshan mountain of asia; 2) asia, asian boars distributed in mainland china, taiwan, java, sumatra, and new guinea (huzuwaru and wangchun, 2004, current research and thinking of domestic pig origin). In contrast, the distribution range of pigs is much larger, almost all over the world, and the breeds are also very different and various. The difference in morphology and habit between the domestic and wild boars is significant, which has triggered our thinking: how to acclimatize wild boars with fierce sexual emotions into home boars with different morphologies and habits? When and where the pigs originated? Is a single origin, or multiple origins? These are all problems of long-term concern in academia. For many years, from different angles, scholars at home and abroad explore the origin and domestication of domestic pigs by cumin and have achieved quite abundant results, however, key problems such as identification of domestic pigs and wild pigs at the beginning of domestication are still at a loss.

Since the birth of ancient examination, the development results are different from day to day and are numerous, and a full and informative real material is provided for exploring the origin of pigs. The domestication of the pigs is one of the most great creations in ancient China. It is reported that after 5 years of field investigation and research, Roband doctors of cultural relic archaeology research institute in Hubei province pushed the origin time of Chinese pigs to about 9000 years to the present. The written book of 'Chinese ancient pig domestication, feeding and ritual use' is based on the pig bone heritage, and by means of animal archaeology, animal archaeology theory and method, means and achievements of related subjects and emphasis on quantitative analysis, systematic research of multidimensional visual angle is carried out on the ancient pig heritage in China.

By combining archaeology and by means of a molecular biological method, another important way is opened up for researching the origin of the domestic pig. Molecular biology theories indicate that, on the long-term evolution path, the DNA of organisms remains stably inherited and is tolerant to accidental variation. Obviously, the genetic stability of the DNA ensures the genetic continuity between parents and offspring; the mutation of DNA causes the offspring to be different from the parent, which results in the evolution of the species. The research shows that: the mutation causes a change in the nucleotide sequence in the DNA in proportion to the accumulation of time, i.e., the longer the time, the greater the change in the nucleotide sequence in the DNA. The rate of this change is constant, the longer the two organisms are separated, the greater the difference in their molecules, the so-called "molecular clock". Thus, if the nucleotide sequence of DNA from an existing species is ascertained, it is desirable to estimate the time of segregation of their common ancestors, i.e., the origin of their species. Mitochondria (mitochonddrial DNA, mtDNA) in animals have the characteristics of maternal inheritance, high mutation rate and large copy number, so the mitochondria are often used as the first choice for researching the phylogeny of species.

The mitochondrial DNA research of ancient pigs at home and abroad mainly adopts a PCR amplification method, for example, Wangzhi et al systematically analyzes the origin domestication relationship of domestic pigs in the yellow river basin in China by extracting DNA, performing PCR amplification and sequencing and combining ancient DNA sequence information of domestic pigs of different modern varieties, wild pigs and downstream pigs in yellow river (Wangzhi et al, research on origin domestication of domestic pigs in the yellow river basin by using ancient DNA information, and 2012, scientific report). The 179bp DNA sequences of 5 ancient pig sample mtDNA D-loop genes are obtained through experiments, and comprise 2 Hubei Qinglong spring historic site samples and 3 Qinghai loudspeaker historic site samples. Since the integrity of ancient DNA molecules is affected by the preservation environment, fragmentation easily occurs, and the PCR technology is difficult to amplify the target fragment. For example, the Wangzhi et al research can only obtain 179bp gene fragment. In order to obtain the ancient pig DNA mitochondrial genome sequence which is as long as possible, the invention provides an ancient DNA extraction method capable of avoiding the pollution of modern animal genome, designs and synthesizes a pig mitochondrial genome capture chip, and utilizes a nucleic acid probe-based liquid phase hybridization capture sequencing technology and a bioinformatics means to obtain the sequence information of the ancient pig DNA mitochondrial genome to the maximum extent. Experiments prove that the method provided by the invention is not influenced by ancient DNA fragmentation, the detection sensitivity is high, and the obtained ancient DNA mitochondrial genome full-length sequence coverage is high. The method of the invention not only can carry out the research of pig origin and evolution, but also can be used for screening the nucleotide sequence variation in the modern pig mitochondrial genome sequence, and also can provide a new means for investigating pig genetic resource distribution and detecting pig origin food components.

Disclosure of Invention

The invention aims to provide a pig mitochondrial genome targeted sequence capture kit, which can be used for capturing a complete pig mitochondrial genome sequence in a targeted manner, has high detection sensitivity, sample initial quantity as low as nanogram, and has the advantages of 300x average sequencing depth, 99.99% coverage and low detection cost when high-throughput sequencing is adopted.

The invention also aims to provide a novel method for obtaining the genome sequence of the pig mitochondria, which can obtain the full-length sequence of the genome of the pig mitochondria to the maximum extent by utilizing the liquid phase hybridization and sequencing of a capture probe and a genome library of the pig.

The invention further aims to provide application of the pig mitochondrial genome targeted sequence capture kit in obtaining the pig ancient DNA mitochondrial genome sequence.

In order to achieve the purpose, the invention adopts the following technical scheme:

a kit for capturing a pig mitochondrial genome targeted sequence comprises a capture probe of a pig mitochondrial genome sequence, wherein the capture probe consists of a biotin-labeled nucleotide sequence shown as SEQ ID NO: 1-106, the preparation method is as follows:

1) downloading full-length sequences of pig mitochondrial genomes of 174 different varieties or individuals from an NCBI public database, comparing the sequences to extract a consensus sequence of a conserved region, and then performing full-length splicing on the consensus sequence and a non-conserved sequence;

2) specific RNA probes are designed aiming at the conserved and non-conserved regions after comparison, each probe is 151bp in length, 106 probes can be collected by pig mitochondrial genome probes of different varieties in a targeted mode, and the sequences are shown as SEQ ID NO: 1-106;

3) a large amount of designed probes are synthesized on a chip by adopting an in-situ synthesis technology, and a large amount of probes with biotin labels are amplified by utilizing a polymerase chain reaction or transcription method, so that the specific pig mitochondrial genome sequence capture probes are manufactured.

A novel method for obtaining a genome sequence of pig mitochondria comprises the following steps:

1) extracting the genomic DNA of the pig;

A. removing the polluted surface layer of the specific part of the pig tooth or bone, and grinding into powder;

B. adding lysis solution and proteinase K into the bone meal, respectively incubating for 30min, performing predigestion, centrifuging to remove supernatant, adding lysis solution and proteinase K, and performing formal digestion for 24h, wherein the lysis solution contains 0.5M EDTA and 0.5% SDS;

C. the DNA is concentrated and enriched by a commercial silicon centrifugal column kit;

2) construction of a porcine Whole genome library

A. Filling the tail end;

B. connecting a joint: connecting the SOLID linker 1 (5'-TGTAACATCACAGCATCACCGCCATCAGTCT-3') and the linker 2 (5'-GACTGATGGCGCACTACGACACTACAATGT-3') with the DNA with the ends being filled in;

C. recovering and purifying DNA connected with the SOLID linker;

D. performing balanced linear amplification on the amount of the library template by adopting a nick translation method, wherein a forward primer: 5'-TGTAACATCACAGCATCACCGCCATCAGTCT-3' and reverse primer 5'-GACTGATGGCGCACTACGACACTACAATGT-3';

3) pig mitochondria whole gene capture probe capture sequencing

A. Liquid phase hybridization:

adding salmon sperm DNA and human placenta Cot-1DNA into a prepared pig genome library for carrying out a blocking reaction, then hybridizing with a biotinylated RNA probe, sorting magnetic beads, eluting and purifying;

B. and (3) capturing and sequencing: taking the DNA captured by hybridization, carrying out PCR amplification reaction, and carrying out forward primer: 5'-CGCTCAGCGGCCGCAGCATCACCGCCATCAGT-3' and reverse primer: 5'-CGCTCAGCGGCCGCGTCGTAGTGCGCCATCAGT-3', sequencing the purified and recovered DNA, and splicing the sequencing sequence to obtain the mitochondrial genome sequence.

Compared with the prior art, the invention has the following advantages and beneficial effects:

1. the invention discloses a novel method for obtaining a mitochondrial genome sequence of a pig and provides a method suitable for extracting DNA from a tooth or bone source sample left by an ancient pig.

2. The pig mitochondrial genome targeted sequence capture kit provided by the invention can be used for capturing complete pig mitochondrial genome sequences in a targeted manner, the method is high in detection sensitivity, the initial amount of a sample is as low as nanogram, when high-throughput sequencing is adopted, the average sequencing depth is 300x, the coverage is as high as 99.99%, and the detection cost is low.

Drawings

FIG. 1 is a schematic diagram of the ancient DNA extraction and mitochondrial capture sequencing technology of pigs

FIG. 2 shows the source of probe design sequence for pig mitochondrial genome capture chip

FIG. 3 is a schematic diagram of a copper pounding medicine tank for grinding a sample of swine dental or skeletal fossils

FIG. 4 is an example of an electrophoretic test chart of DNA extraction from a tooth specimen of a pig in the 1970 s and PCR amplification of mitochondrial Cytb and D-loop genes, wherein Sample-1 is an ancient DNA extracted from a tooth specimen of a pig, and Sample-2 is a duplicate.

FIG. 5 comparison of the sequencing sequence of the mitochondrial Cytb gene from the tooth specimen of the pig from the 1970 s (100% match)

FIG. 6 alignment chart of sequencing sequences of mitochondrial D-loop gene from a tooth specimen of a pig from the 1970 s (99% match, G-A variation)

FIG. 7 shows an example of a tooth sample from an ancient pig 1000 years ago (Novgozod-1000 AD)

FIG. 8 is an example of an electrophoretic DNA examination of a sample of an ancient pig's teeth taken 1000 years ago

FIG. 9 is a PCR amplification mitochondrial D-loop gene electrophoresis test chart using ancient DNA extracted from an ancient swine tooth sample 1000 years ago as a template

FIG. 10 partial DNA sample concentrations and amounts from ancient pig teeth or bones

FIG. 11 mitochondrial genome sequence Capture sequencing data from modern and ancient pig samples

FIG. 12 sequencing and assembly of modern pig mitochondrial genome

FIG. 13 sequencing sequence and assembly diagram of ancient pig mitochondrial genome

FIG. 14 comparison of two sequencing of mitochondrial genomes of different teeth of the same individual in ancient pigs (sample 1)

FIG. 15 comparison of the two-time sequencing of mitochondrial genomes of different teeth of the same individual in ancient pigs (sample 2)

FIG. 16 comparison of the two-time sequencing of mitochondrial genomes of different teeth of the same individual in ancient pigs (sample 3)

FIG. 17 analysis of modern pig mitochondrial D-loop gene sequence polymorphism

FIG. 18 analysis of D-loop Gene sequence polymorphism of ancient pig mitochondria

FIG. 19. phylogenetic Tree characterizing the origin of tooth or bone samples from ancient pigs

Detailed Description

Before the present invention is described, it is to be understood that this invention is not limited to the particular methodology and experimental conditions described, as such methodologies and conditions may vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting, since the scope of the present invention will be limited only by the appended claims.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. As used herein, the term "about" when used in reference to a specifically recited value means that the value may vary by no more than 1% from the recited value. For example, as used herein, the expression "about 100" includes 99 and 101 and all values in between (e.g., 99.1, 99.2, 99.3, 99.4, etc.).

Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, the preferred methods and materials are now exemplified.

The present invention will be described in further detail with reference to the following examples. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention. Experimental procedures for conditions not specified in detail in the following examples are generally carried out under conventional conditions such as those described in molecular cloning, A laboratory Manual (Huang Petang et al, Beijing: scientific Press, 2002) by Sambrook. J, USA, or under conditions recommended by the manufacturer. Unless otherwise indicated, percentages and parts are by weight. The test materials and reagents used in the following examples are commercially available without specific reference.

Example 1

A preparation method of a targeted pig mitochondrial genome sequence capture probe comprises the following steps:

1. downloading the full-length sequences of pig mitochondria of 174 different varieties or individuals from an NCBI public database (the sequence source is shown in figure 2), comparing the sequences to extract a consensus sequence of a conserved region, and then performing full-length splicing on the consensus sequence and a non-conserved sequence;

2. designing capture RNA probes aiming at the conserved and non-conserved regions after comparison, wherein the length of each probe is 151bp, the total number of the probe sets of the pig mitochondrial genome of different varieties can be targeted, the probe sequences are shown as SEQ ID:1-106, and the RNA probes are synthesized by Agilent company;

3. based on the Sureprint in situ synthesis technology of the liquid phase sequence capture system of the Agilent oligonucleotide synthesis technology, a large number of oligonucleotide probes of the above 106 151 mers are synthesized on a chip, then sufficient biotin-labeled RNA decoys are obtained after PCR and transcription, the liquid phase hybridization system of RNA-DNA is skillfully established, thereby preparing the pig mitochondrial genome targeted sequence capture kit, and the specific experimental steps are as follows:

1) 106 pools of 151mer oligonucleotide probes were diluted and mixed well with 100. mu.L of 0.1 × TE buffer (10mM Tris-HCl,0.1mM EDTA, pH 8.0), 4. mu.L of the diluted probe mix was taken, 40nmol dNTPs, PCR primer A: 5'-CTGGGAATCGCACCAGCGTGT-3' and B: 5'-CGTGGATGAGGAGCCGCAGTG-3' pmol each, and 5U of hot start enzyme (Taraka), and finally adding water to a total volume of 100. mu.L to perform PCR reaction under the following conditions: 5min at 94 ℃, and then 10-18 cycles of 94 ℃ for 20s, 55 ℃ for 30s and 72 ℃ for 30 s; further extension at 72 deg.C for 5 min; finally 2min at 4 ℃;

2) after the reaction was completed, the PCR product was concentrated by ultrafiltration, subjected to gel electrophoresis, and recovered by cutting with QIAquick gel extraction kit (Qiagen);

3) in order to introduce the T7 promoter sequence, 1 μ L of the purified product is taken, the PCR primer A is changed into T7-A (5'-GGATTCTAATACGACTCACTATAGGGATCGCACCAGCGTGT-3'), the product is amplified again according to the PCR reaction system and conditions, and the product is purified and recovered;

4) 1 μ g of the purified product was taken as a template and transcribed in 100uL MAXiScript T7 transcription (Ambion) containing 0.5mM ATP, CTP, GTP, 0.4mM UTP and 0.1mM Biotin-16-UTP (Roche) under the following conditions: at 37 ℃ for 90 min;

5) unbound nucleotides and DNA template were removed by gel filtration and TURBO DNase (Ambion) and the remaining biotinylated RNA decoy was added to 1U/. mu.L of SUPERAse-In RNase inhibitor (Ambion) and stored at-80 ℃ until needed.

Example 2

A novel method for obtaining a genome sequence of pig mitochondria comprises the following steps:

1. extracting DNA from tooth or bone left by ancient pig, which comprises the following steps:

1) removing the root of the tooth with an electric drill or the like, and grinding about 1mm off the surface thereof to remove the contaminated surface layer;

2) soaking in 10% sodium hypochlorite solution for 2min, washing with ultrapure water for several times, and drying with filter paper;

3) putting into a copper medicine pounding pot, uniformly pounding with a medicine pounding pestle, and grinding the tooth root into powder;

4) weighing about 500mg of the powder into a 2mL centrifuge tube (environmental control should be set here), adding 1mL of lysis buffer (0.5M EDTA, 0.5% SDS) and 20 μ L of protease K, predigesting in a constant temperature shaker at 55 ℃ for 30min, and taking out;

5) centrifuging at 1000rpm for 8min, removing supernatant, adding 1mL lysate (0.5M EDTA, 0.5% SDS) and 20 μ L protease K into each tube, and performing formal digestion in a shaking table at 55 deg.C for 24 hr;

6) centrifuging at 1000rpm for 8min, sucking the supernatant into a 15mL centrifuge tube, adding 5 times volume of Buffer PB (QIAquick PCR Purification Kit), reversing the mixture up and down to mix the mixture uniformly, and performing the following steps according to the instructions of the QIAquick PCR Purification Kit (QIAGEN) Kit;

7) adding 750 mu L of mixed solution into a QIAquick silicon centrifugal column, centrifuging at 13000rpm for 1min, removing filtrate, and repeating for several times until all the mixed solution passes through the centrifugal column;

8) adding 750 μ L Buffer PE into a centrifugal column for washing, centrifuging at 13000rpm for 1min, and removing the filtrate;

9) centrifuging at 13000rpm for 1min, and idling to remove residual alcohol;

10) in the last step, 100. mu.L of Buffer EB was added, incubated at 55 ℃ for 10min, and then centrifuged at 13000rpm for 1min for elution, and DNA was collected with a 1.5mL EP tube and stored at-20 ℃ for further use.

2. Construction of a porcine Whole genome library

1) Filling the tail end in a plain mode:

taking 100 mu L of genome DNA, 8 mu L of dNTPs, 2 mu L of End polising enzyme I (100U/. mu.L, Agilent) and 16 mu L of End polising enzyme II (5U/. mu.L, Agilent), adding sterilized water to make up the total volume to 200 mu L, incubating at the constant temperature of 25 ℃ for 30min for reaction, and then purifying the DNA by using a PureLink PCR purification kit (Invitrogen);

2) connecting a joint:

taking a SOLID joint 1: 5'-TGTAACATCACAGCATCACCGCCATCAGTCT-3' 50 μmol/L and linker 2: 5'-GACTGATGGCGCACTACGACACTACAATGT-3' 50 μ L of 26 μ L each (applied biosystems), 48 μ L of the DNA purified in the previous step, 10 μ L (50U) of T4 DNA ligase, and then supplemented with sterile water to a total volume of 200 μ L, and after incubation at room temperature for 15min, the DNA was purified using a PureLink PCR purification kit (Invitrogen);

3) and (3) recovering the DNA fragments:

placing the prepared 2% SizeSelect Gel (Applied Biosystems) on E-Gel iBase, adding 20 mu L of purified DNA in the previous step into sample loading holes in 3 parts, respectively, filling 50bp ladders with 0.2 mu g of molecular weight control, filling sample-free holes and recovery holes with 20 mu L of water and 25 mu L of water respectively, and sucking out DNA fragments between 150 and 200bp entering the sample recovery holes;

4) notch translation:

the recovered purified fragments required balanced linear amplification of the amount of library template by nick translation, 400. mu.L of Master Mix (Agilent), forward primer per 100. mu.L of recovered sample: 5'-TGTAACATCACAGCATCACCGCCATCAGTCT-3' and reverse primer 5'-GACTGATGGCGCACTACGACACTACAATGT-3', the reaction was carried out according to the following procedure: 20min at 72 ℃ and 5min at 95 ℃; then 10-12 cycles are carried out at 95 ℃ for 15s, 54 ℃ for 15s and 70 ℃ for 1 min; re-extension at 70 deg.C for 5 min; finally 2min at 4 ℃; after the reaction was completed, purification and quantification were performed using PureLink PCR purification kit (Invitrogen), and 1 μ L of the sample product was subjected to Flash Gel (2.2%, Lonza corporation) electrophoresis for 10min for detection.

3. Capture sequencing by utilizing pig mitochondrial genome targeted capture probe

1) Liquid phase hybridization:

taking 500ng of the prepared pig genome library, adding 2.5. mu.g of salmon sperm DNA (Stratagene) and 2.5. mu.g of human placenta Cot-1DNA (Invitrogen), supplementing water to a total volume of 7. mu.L, mixing well, placing into a PCR instrument for incubation at 95 ℃ for 5min and at 65 ℃ for 5min, then adding 13. mu.L of 2 XBidylation buffer (10 XSSPE, 10 XDenhardt's, 10mM EDTA and 0.2% SDS) which has been preheated at 65 ℃ and 6. mu.L of 500ng biotinylated RNA (the biotin-labeled RNA probe described In example 1, the sequence of which is shown In SEQ ID: 1-106) and 20U of SUPERAse-In, and fully hybridizing the library DNA and the RNA probe at a constant temperature of 65 ℃ for 66 h; after completion of the reaction, the hybridization mixture was added to 500ng (50. mu.l) of M-280 streptomycin-labeled magnetic beads Dynabeads (Invitrogen) which had been washed 3 times and resuspended in a solution (200. mu.l of 1M NaCl,10mM Tris-HCl, pH 7.5,1mM EDTA) and adsorbed at 20 ℃ for 30 min; then washed with 0.5mL of 1 XSSC/0.1% SDS at 20 ℃ for 15min, followed by 3 washes with 0.5mL of pre-heated 1 XSSC/0.1% SDS at 65 ℃ (magnetic beads resuspended at wash), each for 10 min; the DNA selected for hybridization was eluted with 50. mu.L of 0.1M NaOH at 20 ℃ for 10min, the supernatant was transferred to a column containing 70. mu.L of 1M Tris-HCl, pH 7.5 for neutralization, then concentrated by desalting on a QIAquick MinElute column (Qiagen) spin column, and finally eluted with 20. mu.L of Buffer EB and stored for further use;

2) and (3) capturing and sequencing:

taking 4 mu L of hybridization capture DNA, carrying out PCR amplification reaction for 14-18 cycles under the action of 200 mu L of Phusion polymerase master mix (Agilent), and carrying out forward primer: 5'-CGCTCAGCGGCCGCAGCATCACCGCCATCAGT-3' and reverse primer: 5'-CGCTCAGCGGCCGCGTCGTAGTGCGCCATCAGT-3' pmol each, and 5U of hot start enzyme (Taraka), and finally adding water to a total volume of 100. mu.L to perform PCR reaction under the following conditions: 5min at 94 ℃, and then 10-18 cycles of 94 ℃ for 20s, 55 ℃ for 30s and 72 ℃ for 30 s; further extension at 72 deg.C for 5 min; finally 2min at 4 ℃; sequencing the purified and recovered DNA on a lllumina HiSeq2000 sequencer according to a standard sequencing process of the lllumina to obtain high-throughput sequencing data;

3) bioinformatics analysis:

the mitochondrial genome sequence assembly analysis process specifically comprises the following steps: (a) obtaining an original short sequence (Raw data) by a sequencer; (b) performing quality control by using FastQC, and removing a joint and low-quality sequencing data in a sequencing sequence by using Trimmomatic according to a quality report; (c) positioning or splicing the clean sequence to the corresponding position of the mitochondrial genome of the pig; (d) counting the number of short sequences of the sequencing result, the size and average depth covered by the target area, and the like.

Example 3

A technical scheme for effectively obtaining the ancient pig DNA mitochondrial genome sequence is formulated and used for comparing the traditional PCR amplification method with the novel mitochondrial genome targeted capture method.

The ancient DNA refers to residual DNA fragments in ancient biological remains or vestiges, and at present, ancient DNA researches mainly use archaeological specimens, generally select and store complete teeth and limb bones without cracks, and pay attention to prevent pollution. In the laboratory detection stage, the steps of sample evaluation, processing, DNA extraction, PCR amplification, sequencing of PCR products, data authenticity check, data processing analysis and the like are carried out. Mitochondria (mitochonddrial DNA, mtDNA) in animals have the characteristics of maternal inheritance, high mutation rate and large copy number, so the mitochondria are often used as the first choice for researching the phylogeny of species. In order to obtain the genomic sequence of the ancient pig DNA mitochondria, two experimental schemes are respectively designed and tested, which are respectively as follows:

scheme (I): the method comprises the following steps of washing pig teeth by using 10% sodium hypochlorite, polishing the surface layer of the teeth by using an electric tool, placing the pig teeth in a copper medicine pounding tank for grinding, weighing and transferring tooth powder, adding a lysate, performing predigestion and formal digestion, then performing multiple washing and adsorption by using a column centrifugation method, and finally performing elution to obtain a trace ancient DNA solution, wherein the genome DNA extraction method is as described in step 1 of example 2 (the ancient DNA extraction is performed in a special ancient DNA extraction laboratory, only one sample is extracted once, the laboratory is cleaned after the extraction is finished, and the next sample is extracted after UV irradiation is performed for 12 hours, so that the cross contamination between modern DNA and different experimental samples can be reduced to the maximum extent). Then, 1. mu.L of the DNA sample was used to determine the nucleic acid concentration by a nucleic acid concentration measuring instrument, and 1% agarose gel was prepared for detection by electrophoresis. And then, a partial sequence of the ancient pig DNA mitochondrion target gene can be obtained by adopting the conventional PCR amplification and Sanger sequencing technology.

The specific experimental procedure of PCR amplification is as follows: mu.L of the extracted DNA or ancient DNA, 0.6. mu.L (10. mu.M) of each of the upstream and downstream primers, 0.3. mu.L of rTaq (Taraka), 3. mu.L of 10xBuffer and 2.4. mu.L of dNTP, and then 20.1. mu.L of sterilized water was added to the PCR reaction tube and mixed well, and the final system was 30. mu.L. The reaction conditions are as follows: 5min at 95 ℃; 32 cycles of 95 ℃ for 30s, 60 ℃ for 30s and 72 ℃ for 30 s; further extension at 72 deg.C for 5 min; 15 ℃ for 2 min. After the PCR reaction was completed, 3. mu.L of the PCR product was mixed with 1. mu.L of 10XLoading buffer (Taraka) containing Gel Red dye, loaded in a pre-prepared 2% SizeSelect Gel (Applied Biosystems), subjected to electrophoresis for about 20min at 120V constant pressure using DL2000 DNA marker (Taraka), and finally examined for band information in a Gel camera.

Scheme (II): the experimental procedure for obtaining ancient pig DNA is the same as that of the scheme (one), except that after obtaining trace ancient pig DNA, mitochondrial genome targeted capture sequencing Technology is used, that is, a specific RNA probe targeting pig mitochondrial genome designed and synthesized in example 1 is hybridized with genomic DNA, mitochondrial DNA is enriched, high-throughput sequencing is performed using mainstream sequencing platforms such as Illumina and Life Technology, and then bioinformatics strategy is performed to obtain ancient pig DNA mitochondrial genome sequence (fig. 1), and the specific method is as shown in example 2.

Based on the two experimental strategies, by setting a comparison experiment, the scheme (II) is finally determined to obtain the ancient pig DNA mitochondrial genome sequence to the maximum extent, and specific experimental comparison results are shown in the following examples 4 and 5. It is worth mentioning that the target region capture sequencing adopts a liquid phase chip capture sequencing technology, the capture efficiency of the target region capture technology combined with a nucleic acid library is higher, the sequencing depth is 200X-1000X, and the average coverage is close to 100%. The probe refers to 174 mitochondrial genome full-length sequences (figure 2) of different domesticated pigs and wild pigs from NCBI database, and on the basis of comprehensively inspecting the common or specific sequences of different pigs, the design and specificity evaluation of the mitochondrial probes of the pigs at the whole genome level are carried out from the thermodynamic perspective, and the analysis of secondary structures (such as dimers, hairpin structures and the like) based on thermodynamics is carried out to reduce the real biochemical reaction environment, so as to design the specific capture probe. Therefore, the probe adopted in the scheme (II) can target different breeds of domesticated pigs or wild pigs, and can obtain the ancient DNA mitochondrial genome sequence of the pigs with unknown sources to the maximum extent.

Example 4

Effect of protocol (i) for obtaining mitochondrial genome sequence of recent and ancient tooth samples of pigs:

1. PCR amplification detection of mitochondria gene of recent pig tooth sample

Based on the technical process of scheme (one), we first tested tooth specimens from recent pigs (about 1970), and it is worth mentioning that the process of extracting pig tooth DNA is improved based on the reference publications, and there are two main points: one is that the electric tool is used to grind the teeth with a small grinding wheel, which not only can remove the contaminants on the surface of the teeth, but also can conveniently grind hard teeth into small fragments (fig. 1 c); and secondly, a copper medicine pounding tank is adopted, compared with the traditional mortar, the copper medicine pounding tank is deep in the inner abdomen and provided with a cover, a copper hammer head can conveniently break hard tooth or bone samples, the cover can be conveniently closed in the grinding process, so that the samples can be operated in a small space which is locally closed, and the secondary pollution of the samples can be effectively prevented (figure 3). To prevent sample cross contamination, the copper pounding pot was cleaned following the following procedure: sodium hypochlorite soaking → rinsing with clear water → high temperature and high pressure sterilization → UV irradiation → tin foil paper packaging.

According to the operation flow of the scheme (I), after a pig tooth DNA sample is obtained, 1 microliter of the DNA sample is subjected to electrophoresis on 1 percent of TAE agarose gel, the detection result is shown in figure 4A, and two repeated experiments are respectively carried out to find that the DNA band is dispersive, which indicates that the extracted DNA is incomplete and degraded. Mitochondrial genes Cytb and D-loop (primer sequences: Cytb-F: 5'cggaacagacctcgtagaatg 3' and Cytb-R: 5'ggtttcgtgcaggaatagga 3'; D-loop-F: 5'tgctagtccccatgcatataa 3' and D-loop-R: 5'cctgccaagcgggttgctgg 3') were detected by PCR amplification and electrophoresed on 2.5% TAE agarose gel to find a band of the gene of interest of a specific size (FIG. 4B). Further, the PCR product was ligated into a conventional TA cloning vector, transformed bacteria and monoclonal bacterial fluid were picked for Sanger sequencing, as shown in fig. 5 and 6, the amplified Cytb gene sequencing sequence was 100% paired with the reference mitochondrial sequence, while the D-loop gene sequencing sequence had a single base mutation (G-a variation) with the reference mitochondrial sequence. Cytb is considered as a stable gene, and D-loop is a high-variation region, and the sequencing result is in accordance with the expectation, which indicates that the experimental scheme of the strategy (I) is feasible aiming at the tooth-derived DNA of the recent pigs.

2. PCR amplification detection of mitochondrial gene of ancient tooth sample of pig

To further test whether the protocol (one) method was used to detect mitochondrial genes in tooth samples from ancient pigs, a sample from Russia from 1000 years ago (FIG. 7) was taken and a trace amount of ancient DNA was extracted according to the protocol (one) method and electrophoretically detected to find that the bands were diffuse and consistent with the DNA band pattern extracted from the teeth of the recent pig from 1970 (FIG. 8). Then, we use PCR amplification technology to amplify the mitochondrial D-loop gene by using the ancient DNA as a template, as shown in FIG. 9, the positive control can amplify the target fragment, and the ancient DNA of the two repeated samples has no target band. And performing PCR detection on the ancient DNA samples of other different ages by using the same method, wherein the electrophoresis detection result does not detect a target band. It can be seen that the strategy according to scheme (one) failed to detect mitochondrial genes derived from DNA extracted from the teeth of ancient pigs 1000 years ago. The reason for this speculation may be: protocol (one) mainly employs PCR amplification technology, which has relatively high requirements for DNA quality, requires integrity of mitochondrial DNA, and may only be suitable for detection of tooth or bone samples in the near-term. In the case of ancient DNA, the mitochondrial genome may already be fragmented, resulting in failure of the PCR primers to anchor to specific sequences and thus failure of the PCR amplification reaction to proceed properly.

Example 5

Effect of protocol (II) for obtaining mitochondrial genome sequence of recent and ancient tooth samples of swine

In view of the method of scheme (one) used in example 4, mitochondrial DNA genes in tooth samples from ancient pigs 1000 years ago were not successfully detected. We continued to test the procedure of scheme (II) in example 3, and separately extracted trace amounts of ancient DNA from tooth samples of various ancient swine in Russia, and measured the concentration of the ancient DNA by a nucleic acid analyzer, as can be seen from FIG. 10, the sample concentration was relatively low, approximately 19-66 ng/. mu.L, and the total volume of each sample was 100. mu.L. By liquid phase capture sequencing as described in example 2, we obtained mitochondrial genome sequences from 4 modern and 12 ancient pigs (fig. 11). Samples of modern pigs were mainly from russia, vietnam and the region of Sinkiang in China. Ancient swine samples were mainly from russia, and are shown in fig. 11 for the specific years. Sequencing results of 4 modern pigs show that 99.9% of the mitochondrial genome sequence of the pigs can be obtained by the method of the scheme (II). It is worth mentioning that 3 ancient pig samples were subjected to library construction and sequencing 2 times, respectively, and different teeth of the same sample were taken. As can be seen in fig. 11, the mitochondrial genome sequence coverage for sample 1 was 27.1% for the first acquisition, while the second sequencing was only 4.5%; the mitochondrial genome sequence coverage for sample 2 was 61.82% for the first acquisition, while the second sequencing was only 5.68; the coverage of the mitochondrial genome sequence obtained in the first time of the sample 3 is 88.91%, the coverage of the mitochondrial genome sequence obtained in the second time is 99.9%, and the full-length sequence of the DNA mitochondrial genome of the sample is basically obtained. In addition, we also found that the sample numbered mtgDNA-60 also obtained the full-length mitochondrial genome sequence, so that the method of the scheme (II) can obtain the mitochondrial genome sequence of not only the sample of the modern pig, but also the full-length mitochondrial genome sequence of the ancient pig DNA.

Example 6

Sequencing and assembly of modern and ancient pig mitochondrial genomes

According to the method of scheme (two) of example 3, we obtained 16 partial or full-length sequences of the pig mitochondrial DNA genome, respectively (FIG. 11). Further, we assembled the genomic sequence of mitochondrial DNA from one of the modern pigs by bioinformatics analysis and found that it could be spliced into a full-length mitochondrial genomic sequence (fig. 11). And then, selecting and assembling the mitochondrial DNA genome sequence of an ancient pig, and finding that the sample with the number of aDNA-45 can be spliced into the full-length mitochondrial genome sequence. Two sequencing comparisons of different tooth mitochondrial genomes of the same individual of the ancient pig, the sequence lengths of the ancient DNAs obtained twice in 3 samples (FIGS. 14, 15 and 16) were inconsistent and the coverage was different. It can be seen that the DNA extracted from different teeth or parts of the same sample may affect the composition of the genomic sequence of the obtained mitochondrial DNA.

The specific analysis flow of the sequencing data is as follows: after obtaining sequencing data, performing quality control by using FastQC, removing joints by using Trimmomatic according to a quality report, filtering low-quality data, then using a full-length mitochondrial sequence of a pig as an index to perform comparison by using bowtie2 and recording the comparison rate, sequencing generated bam files by using samtools and converting the bams into vcf files, finally checking the vcf files in IGV, copying the generated consensus sequence, converting the concansu sequence into a fasta format, and performing annotation and evolutionary tree analysis in Mega.

Example 7

Analysis of D-loop gene sequence polymorphism of modern and ancient pig mitochondria

Mitochondrial dna (mtdna) is extranuclear genetic material in the form of a covalently closed circular double-stranded structure. Compared with nuclear genome, the genome has simple structure and fast evolution speed. The mitochondrial genome comprises a coding region and a non-coding region, wherein a mitochondrial control region (D-loop) belongs to the non-coding region, is a high mutation region, has a base substitution rate 5-10 times higher than that of other regions of mtDNA, and is positioned between tRNA-pro and tRNA-phe of the mtDNA. The detection of the variation of the DNA sequence in the D-loop region can know the differences caused by base inversion, conversion, deletion/insertion and the like, and is helpful for understanding the mechanism and the evolution rule of DNA replication and transcription. Using the mitochondrial genome sequences of modern and ancient pigs obtained in example 5, we analyzed D-loop gene sequence polymorphisms, as shown in FIG. 17, there were base variations in the D-loop gene sequences of 4 modern pigs. Similarly, 12 cases of ancient porcine DNA were analyzed for polymorphisms in the mitochondrial D-loop gene sequence, and only 7 cases obtained partial or full-length sequences of the D-loop gene, and the base compositions were found to be identical by sequence alignment. Thus, the D-loop gene sequence of most ancient DNAs can be obtained by the second protocol.

Example 8

Evolution analysis of mitochondrial DNA genome sequence of tooth or bone source sample of ancient pig

Using the 12 ancient pig mitochondrial DNA genome sequences obtained in example 4 and protocol (II), we constructed a phylogenetic tree using bioinformatics strategies, as can be seen in FIG. 19, ancient DNA samples from Russia clustered together essentially, with only one Swedish branch in the middle. From a geographical point of view, russia and sweden both belong to europe. Therefore, the mitochondrial DNA genome partial or full-length sequence of the ancient pig obtained by the scheme (II) belongs to European pig branches through evolutionary analysis, and is obviously different from the local pig breed in China, and the sequence obtained by the method is further proved to be reliable.

The specific analysis process of origin and evolution of the ancient pig comprises the following steps: the resulting sequences and sequences in the public database were combined into a fasta file, aligned in Mega (alignment), and then the evolutionary tree was calculated in raxml using gtrgama model with african wart pigs as the outlier and validated with MrBayes. And finally, analyzing the result of the evolutionary tree.

SEQUENCE LISTING

<110> university of agriculture in Huazhong

<120> pig mitochondrial genome targeted sequence capture kit and application thereof

<130> pig mitochondrial genome targeted sequence capture kit and application thereof

<160> 106

<170> PatentIn version 3.5

<210> 1

<211> 151

<212> RNA

<213> Artificial sequence

<400> 1

caaccaaaac aagcattcca ttcgtatgca aaccaaaacg ccaagtactt aattactatc 60

tttaaaacaa aaaaacccat aaaaattgcg cacaaacata caaatatgtg accccaaaaa 120

ttttaccatt gaaaaccaaa aaatctaata t 151

<210> 2

<211> 151

<212> RNA

<213> Artificial sequence

<400> 2

accctatgta cgtcgtgcat taattgctag tccccatgca tataagcatg tacatattat 60

tattaatatt acatagtaca tattattatt gatcgtacat agcacatatc atgtcaaata 120

actccagtca acatgcatat caccaccact a 151

<210> 3

<211> 151

<212> RNA

<213> Artificial sequence

<400> 3

agcttaacta ccatgccgcg tgaaaccagc aacccgcttg gcagggatcc ctcttctcgc 60

tccgggccca taaaccgtgg gggtttctat tgatgaactt taacaggcat ctggttctta 120

cttcaggacc atctcaccta aaatcgccca c 151

<210> 4

<211> 151

<212> RNA

<213> Artificial sequence

<400> 4

ccttaaataa gacatctcga tggactaatg actaatcagc ccatgctcac acataactga 60

ggtttcatac atttggtatt ttttaatttt tggggatgct tagactcagc catggccgtc 120

aaaggcccta acacagtcaa atcaattgta g 151

<210> 5

<211> 151

<212> RNA

<213> Artificial sequence

<400> 5

cttcatggaa ctcatgatcc ggcacgacaa tccaaacaag gtgctattca gtcaatggtt 60

acaggacata acgtacatac acgtgcgtac acgtgcgtac acgtgcgtac acgtgcgtac 120

acgtgcgtac acgtgcgtac acgtgcgtac a 151

<210> 6

<211> 151

<212> RNA

<213> Artificial sequence

<400> 6

tgcgtacacg tgcgtacacg tgcgtacacg tgcgtacacg tgcgtacacg tgcgtacacg 60

cgcatataag caggtaaatt attagctcat tcaaaccccc cttacccccc attaaactta 120

tgctctacac accctataac gccttgccaa a 151

<210> 7

<211> 151

<212> RNA

<213> Artificial sequence

<400> 7

caaaaacaaa gcagagtgta caaatacaat aagcctaact tacactaaac aacatttaac 60

aacacaaacc accatatctt ataaaacact tacttaaata cgtgctacga aagcaggcac 120

ctacccccct agatttttac gccaatctac c 151

<210> 8

<211> 151

<212> RNA

<213> Artificial sequence

<400> 8

aatttaaaat tacaacacaa taacctccca aaatataagc acctatttaa gtatacgccc 60

acaatctgaa tatagcttat agttaatgta gcttaaatta tcaaagcaag gcactgaaaa 120

tgcctagatg agcctcacag ctccataaac a 151

<210> 9

<211> 151

<212> RNA

<213> Artificial sequence

<400> 9

ttggtcctgg cctttctatt aattcttaat aaaattacac atgcaagtat ccgcgccccg 60

gtgagaatgc cctccagatc ttaaagatca aaaggagcag gtatcaagca cacctataac 120

ggtagctcat aacgccttgc tcaaccacac c 151

<210> 10

<211> 151

<212> RNA

<213> Artificial sequence

<400> 10

cagcagtgat aaaaattaag ccatgaacga aagtttgact aagttatatt aattagagtt 60

ggtaaatctc gtgccagcca ccgcggtcat acgattaacc caaattaata gatccacggc 120

gtaaagagtg tttaagaaaa aaaatcacaa t 151

<210> 11

<211> 151

<212> RNA

<213> Artificial sequence

<400> 11

attataacta agctgtaaaa agccctagtt aaaataaaat aacccacgaa agtgactcta 60

ataatcctga cacacgatag ctaggaccca aactgggatt agatacccca ctatgcctag 120

ccctaaaccc aaatagttac ataacaaaac t 151

<210> 12

<211> 151

<212> RNA

<213> Artificial sequence

<400> 12

agagtactac tcgcaactgc ctaaaactca aaggacttgg cggtgcttca catccaccta 60

gaggagcctg ttctataatc gataaacccc gatagacctt accaaccctt gccaattcag 120

cctatatacc gccatcttca gcaaacccta a 151

<210> 13

<211> 151

<212> RNA

<213> Artificial sequence

<400> 13

aatagtaagc acaatcatag cacataaaaa cgttaggtca aggtgtagct tatgggttgg 60

aaagaaatgg gctacatttt ctacataaga atatccacca cacgaaagtt tttatgaaac 120

taaaaaccaa aggaggattt agcagtaaat c 151

<210> 14

<211> 151

<212> RNA

<213> Artificial sequence

<400> 14

gaatagagtg cttgattgaa taaggccatg aagcacgcac acaccgcccg tcaccctcct 60

caagcatgta gtaataaaaa taacctatat tcaattacac aaccatgcaa gaagagacaa 120

gtcgtaacaa ggtaagcata ctggaaagtg t 151

<210> 15

<211> 151

<212> RNA

<213> Artificial sequence

<400> 15

tggattacca aagcatagct taaactaaag cacctagttt acacctagaa gatcccacaa 60

tgtatgggta ctttgaacca aagctagctc aacatactaa acaaatacaa aaatacacca 120

aaataaaata aaacattcac ctaacattaa a 151

<210> 16

<211> 151

<212> RNA

<213> Artificial sequence

<400> 16

atttttatcc tgacgctata gagatagtac cgtaagggaa agatgaaaga ataaaataaa 60

agtaaaaaaa agcaaagatt accccttcta ccttttgcat aatggtttaa ccagaaaaaa 120

tctaacaaag agaactttag ctagataccc c 151

<210> 17

<211> 151

<212> RNA

<213> Artificial sequence

<400> 17

cgaaaccaga cgagctaccc atgagcagtt taaaagaacc aactcatcta tgtggcaaaa 60

tagtgagaag acttgtaggt agaggtgaaa agcctaacga gcctggtgat agctggttgt 120

ccgagaaaga attttagttc aaccttaaaa a 151

<210> 18

<211> 151

<212> RNA

<213> Artificial sequence

<400> 18

ctaaattcca atgtattttt aagagatagt ctaaaaaggt acagcttttt agaaacggat 60

acaaccttga ctagagagta aaatcttaat actaccatag taggcctaaa agcagccatc 120

aattgagaaa gcgttaaagc tcaacaaatt c 151

<210> 19

<211> 151

<212> RNA

<213> Artificial sequence

<400> 19

ccaaaaacta ataacaaact cctagcccaa taccggacta atctattgaa acatagaagc 60

aataatgtta atatgagtaa caagaagcct ttctcctcgc acacgcttac atcagtaact 120

aataatatac tgataattaa caaccaataa a 151

<210> 20

<211> 151

<212> RNA

<213> Artificial sequence

<400> 20

ccaaaacaac actaaaacgt ttattaatta cattgttaac ccaacacagg agtgcaccaa 60

ggaaagatta aaagaagtaa aaggaactcg gcaaacacaa accccgcctg tttaccaaaa 120

acatcacctc tagcattact agtattagag g 151

<210> 21

<211> 151

<212> RNA

<213> Artificial sequence

<400> 21

tgcccagtga caccagttta acggccgcgg tattctgacc gtgcaaaggt agcataatca 60

cttgttctcc aaataaggac ttgtatgaat ggccacacga gggttttact gtctcttact 120

tccaatcagt gaaattaacc ttcccgtgaa g 151

<210> 22

<211> 151

<212> RNA

<213> Artificial sequence

<400> 22

aataaaaaaa taagacgaga agaccctatg gagctttaat taactattcc aaaagttaaa 60

caactcaacc acaaagggat aaaacataac ttaacatgga ctagcaattt cggttggggt 120

gacctcggag tacaaaaaac cctccgagtg a 151

<210> 23

<211> 151

<212> RNA

<213> Artificial sequence

<400> 23

tctagacaaa ccagtcaaaa taaccataac atcacttatt gatccaaaat tttgatcaac 60

ggaacaagtt accctaggga taacagcgca atcctgttct agagttccta tcgacaatag 120

ggtttacgac ctcgatgttg gatcaggaca c 151

<210> 24

<211> 151

<212> RNA

<213> Artificial sequence

<400> 24

gtgcaaccgc tattaaaggt tcgtttgttc aacgattaaa gtcctacgtg atctgagttc 60

agaccggagc aatccaggtc ggtttctatc tattataaat ttctcccagt acgaaaggac 120

aagagaaatg ggaccaacct cacaaacgcg t 151

<210> 25

<211> 151

<212> RNA

<213> Artificial sequence

<400> 25

gagataatta atgatttaat cttaacctaa ttaactcata ataaatccag ccctagaaca 60

gggcacatta gggtggcaga gaccggtaat tgcgtaaaac ttaaaccttt attaccagag 120

gttcaactcc tctccctaat aacatgttca t 151

<210> 26

<211> 151

<212> RNA

<213> Artificial sequence

<400> 26

attctaagcc taattattcc tatcctactg gccgtagcat tcctcaccct agtagaacga 60

aaagtgctag gttatatgca actacgaaaa ggacccaacg ttgtaggccc ctacggccta 120

ctccaaccca tcgccgatgc cctaaaacta t 151

<210> 27

<211> 151

<212> RNA

<213> Artificial sequence

<400> 27

aagaacccct acgaccagcc acatcctcaa tctccatgtt cattattgca ccaatcctag 60

ccttatccct agcactaaca atatgagttc cactaccaat accctaccct ctaatcaaca 120

taaatctagg agtactattc atgctagcca t 151

<210> 28

<211> 151

<212> RNA

<213> Artificial sequence

<400> 28

tagcagtcta ctctatccta tgatcaggat gagcatccaa ctcaaaatac gcactcatcg 60

gggccctacg agcagtagcc caaacaatct catatgaagt aacactagca atcatcctac 120

tatcagtact cctaataaat ggatcatata c 151

<210> 29

<211> 151

<212> RNA

<213> Artificial sequence

<400> 29

atcaacccta atcacaacac aagagcacat ttgaataatc tttacatcct gacccctagc 60

cataatatga tttatctcaa ccctagcaga aaccaaccga gccccgttcg accttacaga 120

aggagagtca gaacttgtat caggctttaa c 151

<210> 30

<211> 151

<212> RNA

<213> Artificial sequence

<400> 30

tgcagccgga cctttcgcca tattcttcat agcagaatat gccaacatca tcataataaa 60

tgcatttaca gcaattctct tcctaggagc atcccacgac ccacacacac cagaactata 120

tacaatcaac ttcgtactaa aaacactcgc a 151

<210> 31

<211> 151

<212> RNA

<213> Artificial sequence

<400> 31

tcaccttcct atgaatccga gcatcatacc cacgattccg atacgaccaa ctaatacatt 60

tactatgaaa aagcttcctg cccctaacac tagctctatg tatatgacac atctcactcc 120

ctattataac agcaagcatt cccccacaat c 151

<210> 32

<211> 151

<212> RNA

<213> Artificial sequence

<400> 32

gtctgataaa agagttactt tgatagagta aaaaatagag gttcaaaccc tcttatttct 60

agaacaatag gactcgaacc taaacctgag aattcaaaat tctccgtgct accaaaatac 120

accacattct acagtaaggt cagctaagct a 151

<210> 33

<211> 151

<212> RNA

<213> Artificial sequence

<400> 33

tcgggcccat accccgaaaa tgttggttca tacccttccc atactaatta atcccattat 60

ctacactacc cttatcataa cagtaatgtc cggaaccata ctagtaataa tcagctcaca 120

ctgactactc atctgaatcg gattcgaaat a 151

<210> 34

<211> 151

<212> RNA

<213> Artificial sequence

<400> 34

agcaataatc ccagtattaa taaaaaattt taacccacga gccacagaag cagccacaaa 60

atatttccta acacaagcca cagcctccat aatactaata atagccatca tcatcaacct 120

cctatattct ggccaatgga ccattacaaa a 151

<210> 35

<211> 151

<212> RNA

<213> Artificial sequence

<400> 35

acccagtagc aataacaata ataaccatgg ccctagccat aaaactagga ctctcacctt 60

tccacttctg agtcccagaa gtaacccaag gcatttcact acaagcaggc ctactgttac 120

taacatgaca aaaactagcc ccattatcag t 151

<210> 36

<211> 151

<212> RNA

<213> Artificial sequence

<400> 36

atctcacaat caatcagccc aaacctaata ctaactatag ccatattatc aattttaatc 60

ggagggtgag gagggctaaa tcaaacccaa cttcgaaaaa tcatagcata ctcatcaatc 120

gcacacatag gatgaatgac agcagtatta c 151

<210> 37

<211> 151

<212> RNA

<213> Artificial sequence

<400> 37

aacacaacca taacaatctt aaacctacta atttacatca caataacact agcaatattc 60

atactattaa tccacagctc agcaaccaca actttatccc tatcccatac atgaaacaaa 120

atacccgtca tcacaagcct aataatagta a 151

<210> 38

<211> 151

<212> RNA

<213> Artificial sequence

<400> 38

ataggaggcc tgcctccact atcaggattt atgccaaaat gaataattat tcaagaaata 60

acaaaaaatg aaagcatcat catgccaaca ctcatagcaa taacagcact gctaaacctc 120

tatttctaca tacgactagc ctactcctcc t 151

<210> 39

<211> 151

<212> RNA

<213> Artificial sequence

<400> 39

tatgttccca tccaccaaca acataaaaat aaaatgacaa ttcgaacaca caaaacaaat 60

aaaattactt cccacaataa ttgtattatc aacactagtc ctacctataa caccagccct 120

ctcgtcccta aactaggaat ttaggttaac a 151

<210> 40

<211> 151

<212> RNA

<213> Artificial sequence

<400> 40

gagccttcaa agctctaagt aagtacaaag tacttaactc ctgaaaacct aaggactgca 60

ggacttatcc tacatcaatt gaatgcaaat caaacacttt aattaagcta aatcctcact 120

agattggtgg gattacatac ccacgaaact t 151

<210> 41

<211> 151

<212> RNA

<213> Artificial sequence

<400> 41

cagctaaaca ccctaatcaa ctggcttcaa tctacttctc ccgccgcagg aaaaaaaagg 60

cgggagaagt cccggcagaa ttgaagctgc ttctttgaat ttgcaattca acatgatatt 120

caccacggaa ctggcaaaaa gagggcttaa c 151

<210> 42

<211> 151

<212> RNA

<213> Artificial sequence

<400> 42

ttagatttac agtctaatgc ttactcagcc attttaccta tgttcgtaaa tcgttgacta 60

tactcaacaa accacaaaga catcggcacc ctgtacctac tatttggtgc ctgagcagga 120

atagtgggca ctgccttgag cctactaatt c 151

<210> 43

<211> 151

<212> RNA

<213> Artificial sequence

<400> 43

gaactaggtc agcccggaac cctacttggc gatgatcaaa tctataatgt aattgttaca 60

gctcatgcct ttgtaataat cttctttata gtaataccca ttatgattgg gggttttggt 120

aactgactcg taccgctaat aatcggagct c 151

<210> 44

<211> 151

<212> RNA

<213> Artificial sequence

<400> 44

atggcctttc cacgtataaa caacataagt ttctgactac ttccaccatc cttcctatta 60

cttctggcat cctcaatagt agaagccgga gcgggtactg gatgaactgt atacccacct 120

ttagctggaa acttagccca tgcaggggct t 151

<210> 45

<211> 151

<212> RNA

<213> Artificial sequence

<400> 45

gatttaacta ttttctccct acaccttgca ggtgtatcat caatcctagg ggctattaat 60

ttcattacca caattattaa cataaaaccc cccgcaatgt ctcaatacca aacacccctg 120

tttgtctgat cagtactaat cacagccgta c 151

<210> 46

<211> 151

<212> RNA

<213> Artificial sequence

<400> 46

ctatccctgc cagttctagc agctggcatt actatactac tgacagaccg caacctgaac 60

acaacctttt ttgatccagc aggtggtgga gaccctatcc tttatcaaca cttgttctga 120

tttttcggac acccagaagt atacattctc a 151

<210> 47

<211> 151

<212> RNA

<213> Artificial sequence

<400> 47

accaggattc ggaataatct cccacattgt aacctactat tcaggtaaaa aagaaccatt 60

tggatatata ggcatagtat gagccataat gtccattgga ttcttaggtt ttattgtatg 120

ggctcaccac atattcaccg taggaataga c 151

<210> 48

<211> 151

<212> RNA

<213> Artificial sequence

<400> 48

ccgagcatac tttacatctg ctacaataat cattgctatt cccactggag taaaagtatt 60

tagttgatta gctaccctgc acggcggcaa tattaaatga tcacccgcaa tactatgagc 120

tctgggcttc atcttcctat tcaccgtagg a 151

<210> 49

<211> 151

<212> RNA

<213> Artificial sequence

<400> 49

cgggcattgt actagctaat tcctccctag acattgtatt acatgataca tattatgtag 60

tcgcacactt ccactatgtc ttatctatag gagcagtgtt cgccattata gggggctttg 120

ttcactgatt ccccctattc tccgggtaca c 151

<210> 50

<211> 151

<212> RNA

<213> Artificial sequence

<400> 50

caagcatgag caaaaattca ctttgtaatc atattcgtag gagtaaatat aacattcttt 60

ccacaacact ttctaggact atccggaata cctcgacgat actccgatta tcctgacgca 120

tacacagcat gaaatactat ttcctcaata g 151

<210> 51

<211> 151

<212> RNA

<213> Artificial sequence

<400> 51

tcatctcact aacagcagtg atattaataa tcttcattat ctgagaagca ttcgcatcaa 60

aacgagaagt atctgcagta gaactgacaa gcacaaacct agaatgacta cacggatgtc 120

ctcctcccta tcacacattt gaagaaccaa c 151

<210> 52

<211> 151

<212> RNA

<213> Artificial sequence

<400> 52

acctaaaata agcataagaa aggaaggaat cgaaccctct cccactggtt tcaagccaac 60

gtcataacca ctatgtcttt ctcgataatc gaggtattag taaaatatta cataactttg 120

tcgaagttat attataggtg aaagccctat a 151

<210> 53

<211> 151

<212> RNA

<213> Artificial sequence

<400> 53

tctatggctt accctttcca actaggcttc caagacgcca cttcacccat catagaagaa 60

ctcctacact ttcacgatca caccttaata atcgtattct taatcagctc tttagtgtta 120

tatatcattt cactcatact aacaacaaaa c 151

<210> 54

<211> 151

<212> RNA

<213> Artificial sequence

<400> 54

acacacacta gcacaatgga tgcccaagaa gtagaaacaa tttgaacaat cctacccgct 60

attattctaa ttcttattgc ccttccatca ttacgaatcc tttatataat agacgaaatt 120

aataacccag ccttaaccgt aaaaaccata g 151

<210> 55

<211> 151

<212> RNA

<213> Artificial sequence

<400> 55

ctgaagctac gagtatacag actatgaaga cctcaccttt gactcatata taatccccac 60

atcagatctt aaacctggag aaatacgact actagaagta gacaatcgag ttgttctacc 120

aatagaaata acaatccgaa tattagtatc c 151

<210> 56

<211> 151

<212> RNA

<213> Artificial sequence

<400> 56

agacgtactg cactcatgag ccgtcccatc cctcggttta aaaacagatg ctatcccagg 60

acgactaaac caaacaactc taatatccac acgacctggc ctttattacg gacagtgctc 120

agaaatctgt ggatcaaacc acagcttcat g 151

<210> 57

<211> 151

<212> RNA

<213> Artificial sequence

<400> 57

cattgtactt gaacttgtcc cattaaagta cttcgaaaaa tggtcaacat caatattaac 60

aggttcattg agaagctagt cagcactaac cttttaagtt agagatcggg agcctaaatc 120

tcccctcaat ggtatgccac aactagatac a 151

<210> 58

<211> 151

<212> RNA

<213> Artificial sequence

<400> 58

gattcattac aattacatca ataattataa cattatttat tttattccaa ctaaaaatct 60

caaactactc atacccagca agcccagaat caattgaact caaaactcaa aaacatagca 120

ccccttgaga aataaaatga acgaaaatct a 151

<210> 59

<211> 151

<212> RNA

<213> Artificial sequence

<400> 59

tgcccccacg ataataggac tacctattgt caccttaatt attatattcc caagcttact 60

attcccaaca cccaaacgac tcattaataa ccgcacaatc tcgatccaac aatgattaat 120

ccaactaaca tccaaacaaa taatagctat t 151

<210> 60

<211> 151

<212> RNA

<213> Artificial sequence

<400> 60

aaccaaaaag gccaaacctg atcactaata cttatatctc taattatatt catcggctca 60

acaaacatcc taggcctact accacactca ttcacaccca ccacacaact atcaataaac 120

ctgggtatag caatccccct atgatcagca a 151

<210> 61

<211> 151

<212> RNA

<213> Artificial sequence

<400> 61

tcacaggatt ccgctataaa accaaaacat cactagccca ctttctacca caaggaacac 60

ccgccctatt aattcctatg ctcgtaatta ttgaaactat tagcctattt attcaaccag 120

tagccctagc cgtacgactg acagccaaca t 151

<210> 62

<211> 151

<212> RNA

<213> Artificial sequence

<400> 62

gcacctatta attcatctaa ttggaggggc cacattagca ctactcaaca tcaacactat 60

aacagctttt atcacattta ctatcctcat tctattaact attcttgaat ttgcagtagc 120

tctgatccaa gcttatgtgt ttacactgct a 151

<210> 63

<211> 151

<212> RNA

<213> Artificial sequence

<400> 63

atacctacac gacaatacat aatgacccac caaacacatg cataccacat agtaaaccca 60

agcccatgac cacttaccgg agccctatca gcccttttaa taacatcagg cctaactata 120

tgattccact ttaactctat actcttacta t 151

<210> 64

<211> 151

<212> RNA

<213> Artificial sequence

<400> 64

aggactatta accaatactt tgacaatata ccaatggtga cgagacatta ttcgagagag 60

cactttccaa ggccaccaca catcagttgt ccaaaaaggc ttacgatacg gtataatttt 120

atttattatt tccgaggttc tgttcttcac t 151

<210> 65

<211> 151

<212> RNA

<213> Artificial sequence

<400> 65

ttttgagctt tctaccactc aagcctagca ccaacacccg aattaggagg ttgctgacca 60

ccaacaggaa ttcacccact aaacccccta gaagtacccc tactaaacac ctcaatcctc 120

ctcgcctcag gagtatccat tacctgagcc c 151

<210> 66

<211> 151

<212> RNA

<213> Artificial sequence

<400> 66

gcctaataga aggggaccga aaacacataa tccaagcact atccatcacc attgcactag 60

gcgtatactt caccctcctc caagcctcag aatattacga agcaccattc acaatctccg 120

acggagtgta tggatccact ttctttgtgg c 151

<210> 67

<211> 151

<212> RNA

<213> Artificial sequence

<400> 67

tcacgggttg cacgtaatca tcggatctac tttcctagca gtatgcttac tacgacaact 60

aaaattccac ttcacatcca accaccactt cggctttgaa gccgcagcct gatactgaca 120

cttcgtagat gtagtttgac tattccttta c 151

<210> 68

<211> 151

<212> RNA

<213> Artificial sequence

<400> 68

aatctattga tgaggatcct actcttttag tattaagtag tacaattgac ttccaatcaa 60

tcagtttcgg taaactccga aaaagagtaa taaatattat actaacacta ctcacaaacg 120

taaccctagc ctccctactc gtactaatcg c 151

<210> 69

<211> 151

<212> RNA

<213> Artificial sequence

<400> 69

ctaccccaac taaacgcata ttcagaaaaa acaagcccat atgaatgtgg atttgacccc 60

ataggatcag cacgcctccc attctcaata aaatttttcc tagtagccat tacatttctc 120

ctttttgatc tagaaatcgc ccttctcctt c 151

<210> 70

<211> 151

<212> RNA

<213> Artificial sequence

<400> 70

catgagcatc ccaaacaaac aatctaaaaa caatacttac aatagcacta ttccttctta 60

tcctactaac agcaagccta gcatacgaat gaacccaaaa aggcctagaa tgagcagaat 120

atgataatta gtttaaaaca aaacaaatga t 151

<210> 71

<211> 151

<212> RNA

<213> Artificial sequence

<400> 71

ctcattagac tatgatttac ttcataatta tcaagtgcca ttagtatata taaacatcat 60

tatagcattc gcgatcgccc ttgcagggtt acttatatat cgatctcact taatatcttc 120

actactatgc ctagaaggaa tgatactatc a 151

<210> 72

<211> 151

<212> RNA

<213> Artificial sequence

<400> 72

tcatatcgac tctaattatc ctaaacacac acttcaccct agctaacata atacccatta 60

ttttactagt gtttgcagcc tgcgaagctg cactaggcct gtcactacta gtaatagtat 120

ccaacacata cggtaccgat tacgtccaaa a 151

<210> 73

<211> 151

<212> RNA

<213> Artificial sequence

<400> 73

cttttacaat gctaaaaatt attatcccaa caacaatact actacccata acatgaatat 60

ctaaacacaa cataatctga atcaatgcaa cagtacatag tctcctcatt agcctgatca 120

gtctatccct actaaaccaa ctaggcgaaa a 151

<210> 74

<211> 151

<212> RNA

<213> Artificial sequence

<400> 74

tttttcctta acattcttct ccgactcact atcagcaccc ctactagttc taaccacatg 60

actcctcccc cttatactaa tagctagcca atctcaccta tcaaaagaaa ccacaacccg 120

aaaaaaacta tatattacca tactaatcct a 151

<210> 75

<211> 151

<212> RNA

<213> Artificial sequence

<400> 75

tcctaattat aaccttcacc gccaccgaac taatcctatt ctatatccta ttcgaagcaa 60

cactagtacc cacactaatt atcatcacac gctgaggaaa ccaaacagaa cgactcaatg 120

caggacttta tttcctattc tacaccctag c 151

<210> 76

<211> 151

<212> RNA

<213> Artificial sequence

<400> 76

ctaccactgc tagtagcact agtttatatc caaaatacca caggctcact aaacttctta 60

attatccatt actgatccca cccattatcc aactcttgat caaacatttt tatatgatta 120

gcatgcatca tagccttcat agtaaaaata c 151

<210> 77

<211> 151

<212> RNA

<213> Artificial sequence

<400> 77

gtacggactc catctttgac tgccaaaagc ccatgtagaa gcccccattg caggttcaat 60

agtacttgca gccgtactgc taaaactcgg aggctatggc ataatgcgaa tcactactat 120

tctaaaccca ctaacaaact acatagccta t 151

<210> 78

<211> 151

<212> RNA

<213> Artificial sequence

<400> 78

ttcctcatgc tttccatatg aggcataatc ataaccagct ctatctgctt acgtcaaacc 60

gacctaaaat ccttaatcgc ctattcatca gtaagtcata tagcacttgt aatcgtagca 120

atcataattc aaaccccctg aagcttcata g 151

<210> 79

<211> 151

<212> RNA

<213> Artificial sequence

<400> 79

cacagctctc ataattgccc acggactaac atcctccata ctattctgcc tagccaacac 60

taactatgaa cgagtacaca gccgaaccat aatcctggcc cgaggactgc aaacactcct 120

accactcata gcaacatgat gactagtagc a 151

<210> 80

<211> 151

<212> RNA

<213> Artificial sequence

<400> 80

caaacctagc cctaccccca tccatcaatc taatcggaga attacttatc atcacagcat 60

cattttcatg atccaacatc acaattattc tcataggaat aaacataata attacagccc 120

tctactctct ctacatacta attactacac a 151

<210> 81

<211> 151

<212> RNA

<213> Artificial sequence

<400> 81

aaaatacacc caccacatta acaacatcaa accctcattc acacgagaaa acgccctcat 60

agccctacat attctaccac tactactact gaccttaaac cctaaaataa tcctaggacc 120

cctttactgt agatatagtt taataaaaac c 151

<210> 82

<211> 151

<212> RNA

<213> Artificial sequence

<400> 82

gaatctagta atagaaaatt aaatattctt atctaccgaa aaagtttgca agaactgcta 60

actcatgctt ccacacttaa aaatgtggct ttttcaactt ttaaaggata acagctatcc 120

gttggtctta ggaaccaaaa aattggtgca a 151

<210> 83

<211> 151

<212> RNA

<213> Artificial sequence

<400> 83

aaataaaagt aataaaccca ttcgcctcac tcacattaac cacactaact attctaacca 60

tcccaattat aatatccaac tcaaacatct acaaaactaa cctttaccct aactacgtaa 120

aaaccaccgt atcctacgcc ttcactctca g 151

<210> 84

<211> 151

<212> RNA

<213> Artificial sequence

<400> 84

cttactaata tttatacaca caggccaaga aataatcatt tcaaactgac attgaataac 60

cctacagacc gtagaactct ctcttagctt taaaatagac tatttctcag taatattcat 120

tcccgtagca ctattcgtca catgatcaat t 151

<210> 85

<211> 151

<212> RNA

<213> Artificial sequence

<400> 85

catatgatac atacactcag accccttcat caaccgattc tttaaatacc tactactatt 60

cttaatcact ataataatcc tcgtaaccgc caacaacctc ttccaactat ttatcggatg 120

agaaggcgta ggaatcatat cattcctgct a 151

<210> 86

<211> 151

<212> RNA

<213> Artificial sequence

<400> 86

atgatgacac ggacgaacag acgccaacac agctgcacta caagcaatcc tatacaaccg 60

catcggagac attggatttg tcctatccat agcatgattc ctaacccact caaacgcatg 120

agatcttcaa caaatcttta tactaaacaa t 151

<210> 87

<211> 151

<212> RNA

<213> Artificial sequence

<400> 87

aaacatacca ttaatcggcc tactcctagc tgcagcagga aaatcagctc aattcggact 60

acatccctga ttgccctcag caatagaagg cccaactccc gtatcagcat tactacactc 120

cagtacaata gtagtagcag gggtatttct a 151

<210> 88

<211> 151

<212> RNA

<213> Artificial sequence

<400> 88

cttctacccc ttaatagaaa ctaacaaact agttcaaact ataacactat gcctaggagc 60

tatcaccacc ttatttacag cactatgtgc aatcacacaa aatgatatca aaaaaatcgt 120

agccttctca acttcaagcc aactaggctt g 151

<210> 89

<211> 151

<212> RNA

<213> Artificial sequence

<400> 89

acaatcggca tcaaccaacc ccacctagca tttcttcaca tctgcatgca cgctttcttc 60

aaagcaatac tattcatatg ctccggatcc attatccaca gcctcaatga cgaacaagac 120

atccgaaaaa taggcggact gtataaagca a 151

<210> 90

<211> 151

<212> RNA

<213> Artificial sequence

<400> 90

aacagcacta attattggaa gcctggcatt aacaggaatg ccttatctca caggattcta 60

ctcaaaagac cttatcattg aagcagtaaa tatatcctac acaaacgcct gagccctact 120

aataacatta attgccacat ccctaaccgc t 151

<210> 91

<211> 151

<212> RNA

<213> Artificial sequence

<400> 91

gcactcgaat tatcttcttt gcattcctag ggaaaccacg tttcccaccc ctagtcctaa 60

ttaatgaaaa taacccccta ctaattaact ctattaaacg ccttttaatc ggaagcattt 120

tcgctggctt tatcatctcc aacaacatcc c 151

<210> 92

<211> 151

<212> RNA

<213> Artificial sequence

<400> 92

acagtaccaa acacaacaat acccctttac ataaaaataa cagccctaat cgtaaccatc 60

ataggattca tactagccct agagctaaac aacacaacct actacctgaa acttaaatac 120

ccctcacaaa catacaaatt ttccaacata c 151

<210> 93

<211> 151

<212> RNA

<213> Artificial sequence

<400> 93

atccctccat catacaccgc ctaccaacat accacaacct atctataagc caaaaatccg 60

catcatcatt actagactta atttgactag aaactattct accaaaaaca acctctttca 120

tccaaataaa aatatcaatc atagtatcaa a 151

<210> 94

<211> 151

<212> RNA

<213> Artificial sequence

<400> 94

ctaatcaaac tatactttct ctccttccta atcactatta taatcagcat aacactattt 60

aattaccacg agtaatctct ataataacaa caactccaat aagcaatgat caaccagtaa 120

caataactaa tcaagtacca taactatata a 151

<210> 95

<211> 151

<212> RNA

<213> Artificial sequence

<400> 95

tccccatagc ttcctcacta aaaaaccccg aatcacccgt atcataaatt actcaatccc 60

caagcccatt aaacttaaag ataatttcta cttcctcttc cttcaacgca taataaacca 120

tacaaaactc cattattaaa ccagaaacaa a 151

<210> 96

<211> 151

<212> RNA

<213> Artificial sequence

<400> 96

aaacagtctt attagaaact caaacctcag gatacatctc agtagccata gcagtagtat 60

aaccaaaaac caccaacata ccccccaaat aaatcaaaaa caccattaaa cctaaaaaag 120

acccaccaaa attcaataca ataccacaac c 151

<210> 97

<211> 151

<212> RNA

<213> Artificial sequence

<400> 97

cttacaatca acccaagtcc accataaata ggagagggct tagaagaaaa accaacaaac 60

ccaataacaa aaatagtact taaaataaat gcaatataca ttgtcattat tctcacatgg 120

aatttaacca cgaccaatga catgaaaaat c 151

<210> 98

<211> 151

<212> RNA

<213> Artificial sequence

<400> 98

gtacttcaac tacaagaacc ttaatgacca acatccgaaa atcacaccca ctaataaaaa 60

ttatcaacaa cgcattcatt gacctcccag ccccctcaaa catctcatca tgatgaaact 120

tcggttccct cttaggcatc tgcctaatct t 151

<210> 99

<211> 151

<212> RNA

<213> Artificial sequence

<400> 99

cctaacaggc ctgttcttag caatacatta cacatcagac acaacaacag ctttctcatc 60

agttacacac atttgtcgag acgtaaatta cggatgagtt attcgctatc tacatgcaaa 120

cggagcatcc atattcttta tttgcctatt c 151

<210> 100

<211> 151

<212> RNA

<213> Artificial sequence

<400> 100

cgtaggccga ggtctatact acggatccta tatattccta gaaacatgaa acattggagt 60

agtcctacta tttaccgtta tagcaacagc cttcataggc tacgtcctgc cctgaggaca 120

aatatcattc tgaggagcta cggtcatcac a 151

<210> 101

<211> 151

<212> RNA

<213> Artificial sequence

<400> 101

tatcagctat cccttatatc ggaacagacc tcgtagaatg aatctgaggg ggcttttccg 60

tcgacaaagc aaccctcaca cgattcttcg ccttccactt tatcctgcca ttcatcatta 120

ccgccctcgc agccgtacat ctcctattcc t 151

<210> 102

<211> 151

<212> RNA

<213> Artificial sequence

<400> 102

gaaaccggat ccaacaaccc taccggaatc tcatcagaca tagacaaaat tccatttcac 60

ccatactaca ctattaaaga cattctagga gccttattta taatactaat cctactaatc 120

cttgtactat tctcaccaga cctactagga g 151

<210> 103

<211> 151

<212> RNA

<213> Artificial sequence

<400> 103

aactacaccc cagcaaaccc actaaacacc ccaccccata ttaaaccaga atgatatttc 60

ttattcgcct acgctattct acgttcaatt cctaataaac taggtggagt gttggcccta 120

gtagcctcca tcctaatcct aattttaatg c 151

<210> 104

<211> 151

<212> RNA

<213> Artificial sequence

<400> 104

cacacatcca aacaacgagg cataatattt cgaccactaa gtcaatgcct attctgaata 60

ctagtagcag acctcattac actaacatga attggaggac aacccgtaga acacccgttc 120

atcatcatcg gccaactagc ctccatctta t 151

<210> 105

<211> 151

<212> RNA

<213> Artificial sequence

<400> 105

atcattctag tattgatacc aatcactagc atcatcgaaa acaacctatt aaaatgaaga 60

gtcttcgtag tatataaaat accctggtct tgtaaaccag aaaaggaggg ccacccctcc 120

ccaagactca aggaaggaga ctaactccgc c 151

<210> 106

<211> 151

<212> RNA

<213> Artificial sequence

<400> 106

cacccaaagc tgaaattcta actaaattat tccctgcaac caaaacaagc attccattcg 60

tatgcaaacc aaaacgccaa gtacttaatt actatcttta aaacaaaaaa acccataaaa 120

attgcgcaca aacatacaaa tatgtgaccc c 151

Claims (4)

1. A kit for obtaining the full-length sequence of the mitochondrial genome of the ancient pig is characterized by comprising a capture probe of the mitochondrial genome sequence of the ancient pig, wherein the capture probe consists of a nucleotide sequence marked by biotin, and the nucleotide sequence is shown as SEQ ID NO: 1-106.

2. A novel method for capturing the mitochondrial genome sequence of ancient pigs in a targeted mode comprises the following steps:

1) extracting the genomic DNA of the ancient pig;

2) constructing a whole genome library of the ancient pig:

A. filling the tail end;

B. connecting a joint: connecting the SOLID joint 15 '-TGTAACATCACAGCATCACCGCCATCAGTCT-3' and the joint 25 '-GACTGATGGCGCACTACGACACTACAATGT-3' with the DNA with the ends being filled in;

C. recovering and purifying DNA containing the SOLID linker;

D. performing balanced linear amplification on the amount of the library template by adopting a nick translation method, wherein a forward primer: 5'-TGTAACATCACAGCATCACCGCCATCAGTCT-3' and reverse primer 5'-GACTGATGGCGCACTACGACACTACAATGT-3';

3) performing capture sequencing using the targeted capture probe of claim 1:

A. liquid phase hybridization: adding salmon sperm DNA and human placenta Cot-1DNA into a prepared ancient pig genome library for carrying out a blocking reaction, then hybridizing with a biotinylated RNA probe, and carrying out magnetic bead sorting, elution and purification;

B. and (3) capturing and sequencing: taking DNA captured by hybridization, and carrying out PCR amplification reaction, wherein the primer sequence is as follows: and sequencing the purified and recovered DNA by using the forward primer 5'-CGCTCAGCGGCCGCAGCATCACCGCCATCAGT-3' and the reverse primer 5'-CGCTCAGCGGCCGCGTCGTAGTGCGCCATCAGT-3', and splicing sequencing sequences to obtain a mitochondrial genome sequence.

3. The novel method for targeted capture of mitochondrial genome sequences of ancient pigs according to claim 2, characterized in that the teeth or bones left behind by ancient pigs are ground, surface contaminants are removed and genomic DNA is extracted.

4. Use of the kit of claim 1 for obtaining genomic sequences from ancient porcine mitochondria.

Images