CN108251558A - Real-time fluorescence quantitative RT-PCR kit and its application for chicken astrovirus detection - Google Patents

Abstract

Real time fluorescent quantitative RT PCR kits and its application for chicken astrovirus detection, belong to biotechnology, the kit obtains cDNA by reverse transcription (RT) mRNA samples, in conjunction with real-time fluorescence quantitative PCR detection technique, the mrna expression amount of CAstV in sample can be detected with accurate quantification.The kit can be used for the expression analysis of CAstV in virus purification chicken embryo idiosome, and the CAstV viral genomic nucleic acids level in clinical inspection case that can be used for detects.The invention detects CAstV virus infection levels for clinical sample and provides a kind of quick, accurate, repeatable detection method.

Description

Real-time fluorescent quantitative RT-PCR kit for detection of chicken astrovirus and its application

technical field

The invention belongs to the field of biological technology and relates to the technology of quantitative RT-PCR detection kit.

Background technique

Avian Astroviruses belong to the Picornaviridae family and are non-enveloped single-stranded positive-sense RNA viruses. It was first discovered in the feces of children with diarrhea in 1975. The International Committee on Taxonomy of Viruses (ICTV) classified the family Astroviridae into the genus Mamastrovirus according to the host range of virus infection. and avian Astrovirus (Avastrovirus), of which the avian Astrovirus is divided into three species, namely, avian Astrovirus GI.A type, avian Astrovirus GI.B type and avian Astrovirus GII.A type . Avian Astrovirus GI.A includes Turkey Astrovirus Type 1 (TAstV-1), and Avian Astrovirus GI.B includes Avian Nephritis Virus Type 1 (ANV-1), Avian Nephritis Virus Type 2 (ANV- 2) and Chicken Astrovirus (CAstV). The avian astrovirus GII.A type includes duck astrovirus (DAstV) and turkey astrovirus type 2 (TAstV-2). In the poultry industry, chicken astrovirus and turkey astrovirus infection can cause diarrheal enteritis, slow growth, low productivity and chicken nephritis in chickens, turkeys and guinea fowls, especially for chicks. There have been reports of infection in many countries and regions in Asia, Europe, and America, causing certain economic losses to the poultry industry.

The physical and chemical properties of astrovirus are extremely stable, chemical reagents such as chloroform, various phenolic substances, acids, detergents, ammonia water, most alcohols and esters, and physical methods such as heating and normal temperature cannot make it inactive. Formaldehyde, beta-propiolactone, 90% methanol, and potassium persulfate containing detergents can limit astrovirus infection. The genome length of Astrovirus is 6.5-7.9kb, including 5' untranslated region (UTR), 3' untranslated region, poly (A) tail, and three open reading frames (ORF). The three open reading frames are the reading frame encoded non-envelope protein (ORF1a), viral RNA-dependent RNA polymerase (ORF1b) and capsid protein (ORF2). The replication method of astrovirus is different from that of other enteroviruses. There is a reverse transcription frame shift signal containing serine protease between ORF1 and ORF2, and there is a moving frame structure between ORF1a and ORF1b. ORF1 encodes a protease and RNA The dependent RNA polymerase, ORF2, expresses subgenomic RNA encoding the viral capsid protein, with structures that vary in length between different serotypes.

CAstVs is distributed all over the world, and it is an enterovirus that is easily prevalent in 1-5 week-old poultry. Studies have shown that astrovirus has infected 86% to 100% of chicken flocks and nearly 100% of turkey flocks, and often co-infects with other enteroviruses. Continuous monitoring of enterovirus infection in chicken flocks found that the first positive sample detected was often astrovirus or a mixed infection of astrovirus and other viruses. Astroviruses, together with most common enteroviruses, cause complex poultry enteritis (PEC), poultry enteritis syndrome (PES) and lethal poultry enteritis syndrome (PEMS) in turkeys, developmental disability syndrome in broilers ( RSS), etc. However, CAstVs can also be isolated from clinically healthy poultry, which requires further research on the pathogenicity of Astroviruses.

Electron microscopy is one of the main means of early detection of CAstV, but the process is cumbersome and not suitable for the detection of a large number of samples. Chickens from different locations are infected with many different strains of CAstV. Therefore, diagnostic tests should not only identify astroviruses, but also distinguish between different genotypes. Some groups have developed ELISA kits using recombinant capsid proteins to detect CastV-specific antibodies in poultry feces or intestinal contents.

Before the real-time fluorescent quantitative reverse transcription polymerase chain reaction (Real-time PCR) technology appeared, whether it was direct PCR or competitive PCR, the quantification of PCR templates basically had to go through electrophoresis of PCR products, and then the electrophoresis results were analyzed by computer. Image processing, according to the brightness of the electrophoresis band to determine the amount of the final PCR product, or detect the labeled PCR product by ELISA, and then infer the amount of the starting template, but these methods are actually semi-autonomous. Quantitative level, because even if the PCR conditions are optimized, the instability of electrophoresis and subsequent steps will still affect the analysis of the results, thus affecting the purpose of quantification.

At present, the research on CAstV is still in the initial stage, and various methods for detecting the expression of CAstV are still lacking. With the rapid development of molecular biology technology and its wide application in medical research, it has become possible to detect protein gene expression by real-time fluorescent quantitative reverse transcription polymerase chain reaction (Real-time PCR) technology. Real-time PCR method has high sensitivity and relatively high specificity that cannot be compared with traditional methods such as ELISA, and can be accurately quantified.

Contents of the invention

Aiming at the problems existing in the prior art above, the purpose of the present invention is to propose a real-time fluorescent quantitative reverse transcription polymerase chain reaction detection kit for chicken astrovirus that can conveniently detect the expression of CAstV.

Test kit of the present invention comprises:

1) Upstream primer CAstV F: 5'- TGCAGATCCCGACGTAAAGG -3';

2) Downstream primer CAstV R: 5'- CGGTCCATCCCCTTACCAGA -3';

3) Standard product: the length is 132bp, and the sequence is:

gcagatcccg acgtaaagga ttacttagat agacagatca attgcgtcga ggagtatgcc 60

gctgctgaag aaatacagtt accagaagtc gggcccgact tctttcagaa aatctggtag 120

agggatggac cg;

4) Standard product template: 10 ² , 10 ³ , 10 ⁴ , 10 ⁵ , 10 ⁶ , 10 ⁷ , 10 ⁸ , 10 ⁹ copies/uL of chicken astrovirus gene-positive plasmid; the chicken astrovirus gene-positive plasmid The pGEM-T vector is used as the starting vector, and the poultry chicken Astrovirus gene fragment is inserted at the EcoR I site of the starting vector;

5) Fluorescent dye and sterile deionized water.

This kit is stored at -20°C, and repeated freezing and thawing should be avoided as much as possible.

The invention establishes a method for detecting the expression of CAstV by using Real-time PCR technology, and the detection of tissue and cell samples shows that the method is feasible. Because this method adopts Real-time PCR amplification technology, the detection sensitivity of CAstV expression is greatly improved, so that we can obtain sufficient information in very few samples. The primers and detection results designed by the invention can provide reliable basis for the development of the fluorescent quantitative PCR detection kit.

Another object of the present invention is to propose the application of the above kit.

Each standard template was respectively combined with the upstream and downstream primers in the kit, fluorescent dyes and sterile deionized water to form a reaction system for PCR amplification, wherein the final concentrations of the upstream primers and downstream primers in the system were both 0.5 μmol/L, The final concentration of the fluorescent dye in the system is 0.5 μmol/L, and the reaction program in the PCR instrument is: pre-denaturation at 95°C for 5 minutes, then 15 seconds at 95°C, 1 minute at 60°C, a total of 40 cycles; collection of fluorescence signals and data collection Set at 60°C to obtain a real-time fluorescence quantitative RT-PCR standard curve;

Take the cDNA of poultry tissue and viscera to be tested, and the upstream and downstream primers, fluorescent dyes and sterile deionized water in the kit to form a reaction system for PCR amplification. The final concentrations of the upstream primers and downstream primers in the system are both 0.5 μmol/ L, the final concentration of the fluorescent dye in the system is 0.5 μmol/L, the reaction program in the PCR instrument is: 95°C pre-denaturation for 5 min, then 95°C for 15 s, 60°C for 1 min, a total of 40 cycles; fluorescence signal collection and The collection of data is set at 60°C, and the Ct value of the amplification cycle number of the target gene in the poultry tissue and organ to be tested is obtained; through the real-time fluorescent quantitative RT-PCR standard curve, the chicken astrovirus gene in the poultry tissue to be tested is obtained. copy number.

In this detection project, advanced real-time fluorescent quantitative PCR detection technology was adopted to minimize false positive interference while maintaining high sensitivity. With the emergence of real-time fluorescent quantitative PCR technology, people can truly achieve accurate quantification of PCR templates. This quantification not only maintains the high sensitivity of conventional PCR, but also improves the specificity of detecting genes.

In the present invention, a standard curve is prepared by using a standard product with a known initial copy number, and the copy number of the sample can be calculated from the standard curve as long as the CT value of the test sample is obtained. The greatest feature and advantage of the present invention is that the gene copy number of CAstV in the specimen can be precisely and quantitatively detected through one Realtime PCR reaction.

Description of drawings

Figure 1 is the amplification kinetic curve of the real-time fluorescent quantitative RT-PCR standard product.

Figure 2 is the real-time fluorescent quantitative RT-PCR standard curve.

Detailed ways

The present invention will be further described in conjunction with the accompanying drawings and specific embodiments. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention.

1. Obtain the standard curve for detection of chicken astrovirus by fluorescent quantitative RT-PCR method:

1. Materials:

DNase I was purchased from Fermentas Company. The reverse transcription kit was purchased from Dalian TaKaRa Company. T carrier ligase was purchased from Promega. dNTPs were purchased from Shanghai Sangon Bioengineering Co., Ltd. The total RNA extraction kit was produced by Hangzhou Axygen. SYBR® Premix Ex Taq ^TM Ⅱ is a product of TaKaRa Company. Others are domestic analytical reagents.

2. Design and synthesis of primers:

With chicken astrovirus ORF1b sequence (GenBank accession number JN582328.1) as template, use PrimerExpress ^™ (V3.0, U.S. ABI company) software analysis and design primers, and according to considering the CAstV genome DNA sequence situation at the same time, select the best primers.

The PCR upstream primer sequence for detection is: 5'- TGCAGATCCCGACGTAAAGG -3',

The downstream primer sequence is: 5'-CGGTCCATCCCCTCTACCAGA-3', all synthesized by Nanjing GenScript.

3. Preparation of detection standards:

The chicken astrovirus gene was amplified using freshly prepared cDNA as a template. The reaction system was 50 μL: 1 μL of cDNA template, 1 μL of upstream and downstream primers (10 nM), 4 μL of dNTP, 10× buffer (containing MgCl ₂ ) 5 μL, LA Taq DNA polymerase 0.5 μL, ddw 37.5 μL. Cycle parameters of the PCR reaction: 95°C for 5 min, 95°C for 30 s, 60°C for 30 s, 72°C for 30 s, 30 cycles; 72°C for 10 min. After the reaction, electrophoresis was performed, and the gel concentration was 1% and the sample volume was 5 μL. Gel recovery, load 50 μL electrophoresis, recover the PCR product according to the gel recovery kit, and obtain the target gene fragment of chicken astrovirus, and store it at -20°C for later use.

The chicken Astrovirus target gene fragment and pGEM-T Easy vector (purchased from Promega, USA) were ligated overnight in a water bath at 16°C at a molar ratio of 3:1 according to the instruction manual (10 μL of ligation system: 2 μL of 5×ligation buffer , pGEM-T vector 3 μL, target fragment 3 μL, T4 ligase 1 μL, ddw 1 μL) to obtain the ligation product, which was inserted into the EcoR I site of the pGEM-T Easy vector with the chicken astrovirus target gene fragment.

Take 5 μL of the ligation product and add it to DH5α Escherichia coli competent cells, evenly spread the transformed competent cells on LB-Amp plates (add X-Gal and IPTG), and culture overnight at 37°C. Pick white colonies for culture, extract plasmids according to conventional methods, and use EcoR І single enzyme digestion for identification (enzyme digestion system 10 μL: Buffer 1 μL, EcoR І 0.5 μL, plasmid 3 μL, ddw 5.5 μL), and screen positive plasmids.

Adopt the mode of screening, the DNA sequence band length that screens out the recombined material from the material is 132bp and uses as the chicken astrovirus standard plasmid of fluorescent quantitative PCR:

gcagatcccg acgtaaagga ttacttagat agacagatca attgcgtcga ggagtatgcc 60

gctgctgaag aaatacagtt accagaagtc gggcccgact tctttcagaa aatctggtag 120

agggatggac cg.

The positive clones of the positive recombinant plasmids with the above DNA sequence characteristics were amplified and frozen. At the same time, the DNA concentration of the chicken astrovirus standard plasmid was measured with an ultraviolet spectrophotometer.

4. Preparation of standard product curve:

Dilute the above chicken astrovirus standard plasmids with sterile deionized water to 10 ² , 10 ³ , 10 ⁴ , 10 5 , 10 ⁶ , ^{10 7 ,} 10 ⁸ , and 10 ⁹ copies/μL as standard templates, and carry out Amplification of the standard curve.

The specific steps are as follows: the reaction system of the standard template entering the Real time PCR instrument is 25 μL: the addition of YBR® Premix Ex Taq ^TM Ⅱ Mix is 12.5 μL, the standard template is 3 μL, and the upstream primer and downstream primer are in the system The final concentration in the medium was 0.5 μmol/L, and the rest were sterile deionized water; wherein the upstream primer CAstV F: 5'-TGCAGATCCCGACGTAAAGG-3' (SEQ ID NO. 1), the downstream primer CAstV R: 5'-CGGTCCATCCCCTACCAGA- 3' (SEQ ID NO. 2). The reaction program in the PCR instrument was: pre-denaturation at 95°C for 5 min, followed by 15 s at 95°C and 1 min at 60°C, a total of 40 cycles; the collection of fluorescence signals and data collection was set at 60°C.

At the end of the detection, set and adjust the baseline and threshold according to the noise situation and use random software for analysis to establish a standard curve. The obtained standard amplification kinetic curve is shown in Figure 1, and the detection standard curve obtained by amplification is shown in Figure 2.

It can be seen from Fig. 1 that the amplification kinetic curve of the standard product corresponds to the standard product of gradient dilution one by one, showing a good multiple relationship.

It can be seen from Figure 2 that there is a good linear correlation between the amplification of plasmids with different copy numbers and the Ct value, which can be used for quantitative analysis of target gene fragments.

2. Application:

1. Specimen detection:

After the known CAstV-positive intestinal samples were broken, the allantoic fluid was aseptically processed to inoculate 9-day-old chicken embryos. When the chicken embryos reached 11 days of age, the embryo bodies of the chicken embryos were collected, ground with liquid nitrogen, and total cellular RNA was extracted with the Axgen Total RNA Extraction Kit. Take 1 µg of RNA, and use Oligo(dT) _15-18 as a primer in a total reaction volume of 20 µL for reverse transcription to obtain each cDNA sample to be tested.

Using the upstream and downstream primers and SYBR® Premix Ex Taq ^TM Ⅱ fluorescent dye in the kit, PCR amplification was carried out on a 7500 fluorescent quantitative PCR instrument of ABI Company, and the reaction system was 25 μL: where SYBR® Premix Ex Taq ^TM Ⅱ fluorescent dye The amount added was 12.5 μL, the cDNA sample to be tested was added in an amount of 3 μL, the final concentrations of the upstream primer and downstream primer in the system were both 0.5 μmol/L, and the rest was sterile deionized water. The conditions were pre-denaturation at 95°C for 5min, followed by 15s at 95°C and 1min at 60°C, a total of 40 cycles; the collection of fluorescence signals and data collection was set at 60°C. At the same time, add standard substance to test for standard curve. Fluorescent signal collection and data acquisition were set at 60°C.

The determination results were processed by software and calculated according to the standard curve to calculate the gene expression of chicken astrovirus in the test specimen.

2. Fluorescent quantitative RT-PCR method to detect the expression results of the chicken astrovirus gene in the embryo body of the inoculated chicken embryo:

On the real-time fluorescence quantitative RT-PCR standard curve in Figure 1, the copy number of CAstV in the corresponding sample to be tested can be found by the measured cycle number Ct value.

The test results of embryo body tissue samples of 11-day-old chicks are as follows:

Chicken Embryo Number copy/μL 1-1 2.6530×10 ⁴ 1-2 6.009×10 ³ 2-1 1.9303×10 ⁴ 2-2 4.5833×10 ⁴ 3-1 1.20659×10 ⁵ 3-2 1.58977×10 ⁵

The present invention is described in conjunction with the best embodiment, but after reading the above content of the present invention, those skilled in the art can make various changes or modifications to the present invention, and these equivalent forms also fall within the appended claims of the application within the bounds of the book.

sequence listing

<110> Yangzhou University

<120> Real-time Fluorescent Quantitative RT-PCR Kit for Chicken Astrovirus Detection and Its Application

<141> 2017-12-21

<160> 3

<170> SIPOSequenceListing 1.0

<210> 1

<211> 20

<212>DNA

<213> Astrovirus

<220>

<221> gene

<222> ((1))..(.(20))

<223> Upstream primer of chicken Astrovirus open reading frame ORF1b

<400> 1

tgcagatccc gacgtaaagg 20

<210> 2

<211> 20

<212>DNA

<213> Astrovirus

<220>

<221> gene

Claims (2)

1. for the real-time fluorescent quantitative RT-PCR kit that chicken astrovirus detects, it is characterized in that kit comprises: 1) Upstream primer CAstV F: 5'- TGCAGATCCCGACGTAAAGG -3'; 2) Downstream primer CAstV R: 5'- CGGTCCATCCCCTTACCAGA -3'; 3) Standard product: the length is 132bp, and the sequence is: gcagatcccg acgtaaagga ttacttagat agacagatca attgcgtcga ggagtatgcc 60 gctgctgaag aaatacagtt accagaagtc gggcccgact tctttcagaa aatctggtag 120 agggatggac cg; 4) Standard template: 10 ² , 10 ³ , 10 ⁴ , 10 ⁵ , 10 ⁶ , 10 ⁷ , 10 ⁸ , 10 ⁹ copies/uL of chicken astrovirus gene-positive plasmid; the chicken astrovirus gene-positive plasmid The pGEM-T vector is used as the starting vector, and the poultry chicken Astrovirus gene fragment is inserted at the EcoR I site of the starting vector; 5) Fluorescent dye and sterile deionized water. 2. the application of kit as claimed in claim 1, is characterized in that: Each standard template was respectively combined with the upstream and downstream primers in the kit, fluorescent dyes and sterile deionized water to form a reaction system for PCR amplification, wherein the final concentrations of the upstream primers and downstream primers in the system were both 0.5 μmol/L, The final concentration of the fluorescent dye in the system was 0.5 μmol/L. The reaction program in the PCR instrument was: 95°C pre-denaturation for 5 min, then 95°C for 15 s, 60°C for 1 min, a total of 40 cycles; the collection of fluorescent signals and the analysis of data The collection was set at 60°C, and the real-time fluorescent quantitative RT-PCR standard curve was obtained; Take the cDNA of poultry tissue and viscera to be tested, and the upstream and downstream primers, fluorescent dyes and sterile deionized water in the kit to form a reaction system for PCR amplification. The final concentrations of the upstream primers and downstream primers in the system are both 0.5 μmol/ L, the final concentration of the fluorescent dye in the system is 0.5 μmol/L, the reaction program in the PCR instrument is: 95°C pre-denaturation for 5 min, then 95°C for 15 s, 60°C for 1 min, a total of 40 cycles; fluorescence signal collection and The collection of data is set at 60°C, and the Ct value of the amplification cycle number of the target gene in the poultry tissue and organ to be tested is obtained; through the real-time fluorescent quantitative RT-PCR standard curve, the chicken astrovirus gene in the poultry tissue to be tested is obtained. copy number.