CN108251466B

CN108251466B - Method for synthesizing esomeprazole by enzyme method

Info

Publication number: CN108251466B
Application number: CN201611236175.8A
Authority: CN
Inventors: 张敏; 张敏洁; 朱建荣; 黄悦
Original assignee: Shanghai Jingxin Biological Medical Co ltd; Zhejiang Jingxin Pharmaceutical Co Ltd
Current assignee: Shanghai Jingxin Biological Medical Co ltd; Zhejiang Jingxin Pharmaceutical Co Ltd
Priority date: 2016-12-28
Filing date: 2016-12-28
Publication date: 2021-07-02
Anticipated expiration: 2036-12-28
Also published as: CN108251466A

Abstract

The invention discloses a one-pot method for synthesizing esomeprazole by an enzyme method, which comprises the following steps: reacting 2-mercapto-5-methoxybenzimidazole and 2-chloromethyl-3, 5-dimethyl-4-methoxypyridine hydrochloride in a solvent in the presence of alkali, and adjusting the pH value of the material to 6-9 after the reaction; mixing the material, the monooxygenase, the auxiliary component and the water phase solvent, and reacting with the oxidant to generate the esomeprazole. The method of the invention omits the steps of refining and purifying the omeprazole thioether, simplifies the operation steps, shortens the time of the synthesis route, has high catalytic reaction efficiency, greatly reduces the production cost and has excellent industrial application value.

Description

Method for synthesizing esomeprazole by enzyme method

Technical Field

The invention belongs to the technical field of pharmacy and biological engineering, and particularly relates to a method for synthesizing esomeprazole by an enzyme method.

Background

Esomeprazole (esomeprazole) is the first global isomer proton pump inhibitor (I-PPI) isolated and synthesized by AstraZeneca (AstraZeneca) of sweden, first marketed in the uk at 2000/9, is the S-isomer of omeprazole and is currently the only specific inhibitor of the I-PPI proton pump. The chemical name of the compound is S-5-methoxy-2- ((S) - ((4-methoxy-3, 5-dimethyl-2-pyridyl) methyl) sulfinyl) -1H-benzimidazole, and the chemical structure is shown as the following formula I.

The esomeprazole biological enzyme synthesis has the advantages of high reaction yield, good chiral selectivity of the product and no need of heavy metal chiral ligand. A series of strains which can be used for biological oxidation reaction are screened by US5840552A, the catalytic chiral selectivity is better, and the ee value of the product is more than 99%. CN102884178A developed a monooxygenase with a single reaction convertible substrate concentration of 30g/L in a two-phase system. However, in the current preparation process of synthesizing esomeprazole by an enzymatic method, the purified omeprazole thioether is used as a substrate to carry out catalytic reaction.

The enzyme-catalyzed one-pot reaction has been reported at present, and is a synthesis method which has attracted attention in recent years, and the main advantages are as follows: high catalytic efficiency, simple operation and mild reaction conditions. Omeprazole sulfide (chemical name: 5-methoxy-2- (4-methoxy-3, 5-dimethyl-2-pyridyl) methylthio-1H-benzimidazole)) is generally obtained by condensing 2-mercapto-5-methoxybenzimidazole and 2-chloromethyl-3, 5-dimethyl-4-methoxypyridine hydrochloride, which is generally reacted in a single organic solvent, such as methanol (preparation of omeprazole sulfonylate, wuweiqi, donglie, etc., pharmaceutical and clinical studies, 2010.18.6.585-586), ethyl acetate, dichloromethane or toluene (CN 1705656A). Generally, the solvent has a large toxic effect on enzyme, or the enzymatic catalysis reaction has harsh reaction conditions, and the previous reaction is generally subjected to certain post-treatment purification, so that the one-pot method for synthesizing esomeprazole from the condensation reaction as a starting point is not generally considered based on the reaction conditions; in addition, when toluene is used as a solvent, the amount of the solvent is large, and the one-pot reaction with enzyme catalysis cannot be performed.

Disclosure of Invention

The technical problem solved by the invention is to overcome the defects that the existing preparation process of esomeprazole enzyme method needs to use purified omeprazole thioether as a raw material, has multiple working procedures and is complex to operate, and provide a one-pot method for synthesizing esomeprazole by the enzyme method. The method can simplify the operation steps, improve the reaction efficiency and have excellent industrial application value.

The invention solves the technical problems through the following technical scheme.

The invention provides a method for synthesizing esomeprazole by an enzyme method, which comprises the following steps:

(1) reacting 2-mercapto-5-methoxybenzimidazole and 2-chloromethyl-3, 5-dimethyl-4-methoxypyridine hydrochloride in a solvent in the presence of alkali, and adjusting the pH value of the material to 6-9 after the reaction;

(2) and mixing the material, the monooxygenase, the auxiliary component and the water phase solvent, and reacting with an oxidant to generate esomeprazole.

In the step (1), the amounts and the ratios of the 2-mercapto-5-methoxybenzimidazole (hereinafter referred to as compound a) and 2-chloromethyl-3, 5-dimethyl-4-methoxypyridine hydrochloride (hereinafter referred to as compound B) are conventional in the art, and the reaction formula is as follows:

in the invention, the method for synthesizing esomeprazole by using the enzyme method adopts a one-pot method to prepare the synthetic esomeprazole, namely: after the step (1), post-treatment operations such as solvent removal, filtration, washing, purification and the like are not carried out; pretreatment operations such as solvent removal, filtration, washing and purification are not performed before step (2).

In step (1), the base is a base conventionally used in the art for such reactions, and may be, for example, one or more of sodium hydroxide, potassium hydroxide, sodium methoxide, and triethylamine.

In step (1), the solvent may be a solvent conventionally used in the art, for example, including but not limited to one or more of benzene, toluene, alcohol, ether, halogenated hydrocarbon, ester, and dimethylsulfoxide. The alcohol is preferably selected from methanol, ethanol, propanol, isopropanol and butanol, the halogenated hydrocarbon is preferably selected from dichloromethane, chloroform and carbon tetrachloride, the ether is preferably selected from diethyl ether, methyl tert-butyl ether, tetrahydrofuran and 2-methyl tetrahydrofuran, and the ester is preferably selected from ethyl acetate and isopropyl acetate. The solvent may further comprise water. Preferably, the solvent is a mixed solvent, which includes at least two of the foregoing solvents, such as three solvents. More preferably, the mixed solvent includes at least isopropyl alcohol. In one embodiment of the present invention, the solvent is toluene, isopropanol and water, and the mass ratio of toluene, isopropanol and water is preferably (5-20): (1-3): (1-2), more preferably (5-7): (1-3): (1-2).

In one embodiment of the present invention, the mass ratio of the solvent to the reaction raw material is 2.5:1 or less, preferably 1.1:1 or less, wherein the mass of the reaction raw material is the total mass of the compound a and the compound B. In this case, the amount of solvent used in step (1) is significantly lower than that used in the prior art, and is more economical.

In step (1), the method and conditions of the reaction are conventional methods and conditions for such reactions, and for example, the method and conditions of the reaction in this step in CN1705656A can be referred to. In the present invention, the reaction temperature is preferably 40 to 75 ℃, more preferably 48 to 72 ℃. The reaction time is preferably 1 to 3 hours, more preferably 2 to 3 hours.

In step (1), the method for adjusting the pH value of the material is a conventional method in the field, and is generally adjusted by acid, such as acetic acid, hydrochloric acid and the like. The pH of the material is preferably 7.5 to 8.

In step (2), the mixing method and conditions may be those conventional in the art, and the mixing order is not limited. Usually, the monooxygenase enzyme, the accessory components and the aqueous solvent are added to the mass.

In the step (2), the use form of the monooxygenase is not limited, and the monooxygenase can be one or more of enzyme powder, enzyme liquid and genetically engineered bacteria. The monooxygenase enzyme may be a monooxygenase enzyme conventionally used in the art, preferably cyclohexanone monooxygenase. It is understood that, based on the state of the art and knowledge, genetically engineered cyclohexanone monooxygenases have a better catalytic conversion of omeprazole thioether, preferably genetically engineered non-natural cyclohexanone monooxygenases, such as the "engineered CHMO polypeptides" disclosed in CN 102884178A. The genes of genetically engineered bacteria of cyclohexanone monooxygenase are generally from Lysinibacillus sp, Ustilago sp, Arthrobacter sp, Brevibacterium sp, Acinetobacter sp, Mycobacterium sp, Aspergillus sp, or Cunninghamella sp, as is common in the art. In the present invention, preferably, the amino acid sequence of cyclohexanone monooxygenase is SEQ ID NO.2, SEQ ID NO.4 or SEQ ID NO. 6. More preferably, the nucleotide sequence of the cyclohexanone monooxygenase is SEQ ID NO.1, SEQ ID NO.3 or SEQ ID NO. 5. The amount of monooxygenase to be used can be selected in a manner conventional in the art, depending on the type of addition. For example, in one embodiment of the present invention, the monooxygenase enzyme is used in the form of an enzyme powder, the mass ratio of the enzyme powder to the total solvent being (5-6) g/kg.

In step (2), the accessory ingredient may be an accessory ingredient (or cofactor) conventionally used in the art, and may be a reduced coenzyme in general, such as NADPH and/or NADH disclosed in CN102884178A, or a combination of an oxidized coenzyme, a dehydrogenase and a substrate corresponding to the dehydrogenase. The oxidized coenzyme is preferably NADP⁺And/or NAD⁺. The dehydrogenase is not limited in use form and can be one or more of enzyme powder, enzyme liquid and genetically engineered bacteria. The dehydrogenase may be a dehydrogenase conventionally used in the art, preferably a ketoreductase (also known as alcohol dehydrogenase), more preferably an isopropanol dehydrogenase. The genes of genetically engineered bacteria of the ketoreductase are generally from Lactobacillus sp, yarrowia lipolytica sp or Gluconobacteroxydans, as is common in the art. Preferably, the ketoreductase has the amino acid sequence of SEQ ID No.8, SEQ ID No.10 or SEQ ID No. 12. More preferably, the ketoreductase has the nucleotide sequence of SEQ ID NO.7, SEQ ID NO.9 or SEQ ID NO. 11. In addition, the ketoreductase may also be a commercially available product, such as ES-KRED-104 from Shanghai, Co.Ltd, of biological medicine, or KRED-127 from Suzhou Han enzymes Biotechnology, Inc.

The reduced coenzyme may not need to be regenerated as is common in the art, but additional adjunct components may be employed to effect regeneration of the reduced coenzyme. The additional auxiliary component can be a suitable dehydrogenase, such as glucose dehydrogenase, glucose-phosphate dehydrogenase, formate dehydrogenase, phosphite dehydrogenase and ketoreductase and corresponding substrates, such as glucose, glucose-6-phosphate, formate, phosphite or alcohol, respectively. Among them, the dehydrogenase is preferably the ketoreductase described above.

In some embodiments of the invention, the adjunct component is a reduced coenzyme. In other embodiments of the present invention, theThe adjuvant component is ketoreductase, NADP⁺And secondary alcohols. In other embodiments of the invention, the adjunct components are ketoreductases, NADPH, and secondary alcohols. In other embodiments of the present invention, in step (2), the reaction system is a whole-cell reaction system in which NADPH or NADP is self-contained as a coenzyme⁺Thus, the additional auxiliary components used are ketoreductases and secondary alcohols. In other embodiments of the present invention, in step (2), the reaction system is a whole-cell reaction of cyclohexanone monooxygenase and ketoreductase due to the self-supply of coenzyme NADPH or NADP in whole cells⁺And at the same time, the ketoreductase is carried by itself, so that the additional auxiliary component used is a secondary alcohol. It will be appreciated that when a secondary alcohol, such as isopropanol, is already contained in the solvent in step (1), no additional secondary alcohol need be added in step (2).

In a preferred embodiment of the present invention, the cyclohexanone monooxygenase and the ketoreductase are both used in the form of genetically engineered bacteria. According to the common knowledge in the field, two genetically engineered bacteria respectively expressing cyclohexanone monooxygenase and ketoreductase can be adopted, or the co-expressed genetically engineered bacteria can be directly adopted.

When the auxiliary component contains reduced coenzyme, the mass ratio of the reduced coenzyme to the total solvent is preferably (0.1-1.5) g/kg. When the auxiliary component contains an oxidized coenzyme, the mass ratio of the oxidized coenzyme to the total solvent is preferably (0.08-0.12) g/kg. The dehydrogenase and the corresponding substrate of the dehydrogenase are used only when the oxidized coenzyme can be regenerated into the reduced coenzyme.

In step (2), the aqueous solvent may be an aqueous solvent conventionally used in the field of enzyme catalysis, preferably a phosphate buffer solution and/or a Tris-HCl buffer solution, and the phosphate buffer solution may be a potassium phosphate buffer solution. The pH of the aqueous solvent is preferably 7 to 10, more preferably 8 to 9. In addition, when the cyclohexanone monooxygenase is used in the form of an enzyme solution, the aqueous solvent is a part of the enzyme solution other than cyclohexanone monooxygenase, and may contain the same which is usually added in the preparation of the enzyme solution, according to the common knowledge in the artThe substance may also contain MgCl, for example in Tris-HCl buffer₂. The mass ratio of the aqueous phase solvent to the solvent in the step (1) is preferably (1-5.6): 1.

In the step (2), a phase transfer catalyst may be added before the reaction. The phase transfer catalyst may be a conventionally used phase transfer catalyst, preferably one or more of benzyltriethylammonium chloride (TEBAC), tetrabutylammonium bromide (TBAB), tetrabutylammonium chloride (TBAC), tetrabutylammonium hydrogen sulfate, trioctylmethylammonium chloride, dodecyltrimethylammonium chloride, tetradecyltrimethylammonium chloride, methyltriphenylphosphine bromide, ethyltriphenylphosphine bromide, tetraphenylphosphonium bromide and benzyltriphenylphosphine chloride. The mass ratio of the phase transfer catalyst to the total solvent is preferably (0.5 to 6) g/kg, more preferably (0.9 to 6) g/kg. When a phase transfer catalyst is used, the efficiency of the enzyme-catalyzed reaction can be further improved, and the enzymatic reaction time can be reduced.

In step (2), the oxidizing agent may be an oxidizing agent conventionally used in the art, preferably oxygen. When the oxidant is oxygen, the oxygen can be introduced into the reaction system by continuously introducing oxygen, continuously introducing air, or maintaining the pressure of oxygen, as is common in the art.

In step (2), other methods and conditions for the reaction are conventional in the art. The temperature of the reaction is preferably 10 to 40 ℃, more preferably 18 to 32 ℃, and most preferably 23 to 32 ℃.

As used herein above, "total solvent" means the sum of the solvent in step (1) and the aqueous phase solvent in step (2).

The reaction of step (2) may be followed by a post-treatment step, as is common in the art. The post-treatment steps are all conventional in the art and include, but are not limited to, desolventizing, filtering, washing, and drying.

On the basis of the common knowledge in the field, the above preferred conditions can be combined randomly to obtain the preferred embodiments of the invention.

The reagents and starting materials used in the present invention are commercially available.

The positive progress effects of the invention are as follows:

the method for synthesizing esomeprazole by using the enzymatic method, disclosed by the invention, has the advantages that 2-mercapto-5-methoxybenzimidazole and 2-chloromethyl-3, 5-dimethyl-4-methoxypyridine hydrochloride are used as reaction raw materials, the esomeprazole is prepared by adopting a one-pot method, the steps of refining and purifying omeprazole thioether are omitted, the operation steps are simplified, the time of a synthetic route is shortened, the catalytic reaction efficiency is high, the production cost is greatly reduced, and the method has excellent industrial application value.

Detailed Description

The invention is further illustrated by the following examples, which are not intended to limit the scope of the invention. The experimental methods without specifying specific conditions in the following examples were selected according to the conventional methods and conditions, or according to the commercial instructions.

In the following examples, the conditions of high performance liquid chromatography were as follows:

and (3) purity detection conditions:

shimadzu liquid chromatography, Phenomenex chromatographic column, mobile phase 10mM phosphate (pH7.6), acetonitrile (60:40), flow rate 1mL/min, column temperature 35 deg.C, ultraviolet detection wavelength 300nm, detection time 15 min.

Retention time: product (3.8min), substrate (8.2 min).

Chiral ee value detection conditions:

angilent 1260 liquid chromatography instrument, DAICEL CHIRAL AGP chromatographic column, mobile phase is pH6.0 phosphate buffer solution: acetonitrile (85:15), flow rate is 0.6mL/min, column temperature is 25 deg.C, ultraviolet detection wavelength is 300 nm.

The peak time: esomeprazole (3.726min), isomer impurity (2.649 min).

In the formula: a. the_API: peak area of the product esomeprazole;

A_IMP: peak area of isomer impurity.

Example 1: construction of cyclohexanone monooxygenase gene engineering bacteria

Entrust Shanghai Czeri bioengineering, Inc. to custom synthesize cyclohexanone monooxygenase gene segments SEQ ID NO.1, SEQ ID NO.3 and SEQ ID NO.5, and the corresponding encoded amino acid sequences are SEQ ID NO.2, SEQ ID NO.4 and SEQ ID NO.6 respectively. Then, the gene fragment is used as a template, PCR amplification expansion is carried out (Nde I and BamH I endonuclease fragments are added at two ends of the gene fragment), the gene fragment is inserted into pET28a plasmid by utilizing Nde I and BamH I endonuclease sites, and finally the vector obtained by connection is transferred into escherichia coli BL21(DE3) to construct recombinant escherichia coli genetic engineering strains containing the cyclohexanone monooxygenase gene, which are respectively marked as strain No.1, strain No.2 and strain No. 3.

The primer sequence of the PCR amplification extension design is as follows:

forward primer F1: GGAATTCCATATGAGTACCAAGATGGATTTTGATGC (SEQ ID NO.13)

Reverse primer R1: CGCGGATCCTTACGCATTAGCCTGCTGTTTGG (SEQ ID NO.14)

Example 2: construction of ketoreductase Gene engineering bacteria

Entrust Shanghai Czeri bioengineering, Inc. to custom synthesize ketoreductase gene segments of SEQ ID NO.7, SEQ ID NO.9 and SEQ ID NO.11, and the corresponding encoded amino acid sequences are SEQ ID NO.8, SEQ ID NO.10 and SEQ ID NO.12, respectively. Then, the gene fragment is used as a template, PCR amplification expansion is carried out (Nde I and BamH I endonuclease fragments are added at two ends of the gene fragment), the gene fragment is inserted into pET28a plasmid by utilizing Nde I and BamH I endonuclease sites, and finally the vector obtained by connection is transferred into escherichia coli BL21(DE3) to construct recombinant escherichia coli genetic engineering strains containing the ketoreductase, which are respectively marked as strain No.4, strain No.5 and strain No. 6.

The primer sequence of the PCR amplification extension design of the strain No.4 is as follows:

forward primer F2: GGAATTCCATATGACGGATCGTCTGAAAGG (SEQ ID NO.15)

Reverse primer R2: CGCGGATCCTTACTGGGCGGTATAGCCG (SEQ ID NO.16)

The primer sequence of the PCR amplification extension design of the strain No.5 is as follows:

forward primer F3: GGAATTCCATATGGCTTCCGTTTCCATTCC (SEQ ID NO.17)

Reverse primer R3: CGCGGATCCTCACTTGGTAACGGTGGGGTC (SEQ ID NO.18)

The primer sequence of the PCR amplification extension design of the strain No.6 is as follows:

forward primer F4: GGAATTCCATATGTCGTCACAGGTTCCATC (SEQ ID NO.19)

Reverse primer R4: CGCGGATCCTCAGAATTTCGCCGTATTCG (SEQ ID NO.20)

Example 3: construction of co-expression gene engineering bacteria

The following experiments, such as digestion, ligation, preparation of competent cells, transformation, etc., were carried out with reference to Molecular Cloning-A laboratory Manual (third edition, 2001).

Designing the following primers F5 and R5, and using a gene fragment of the cyclohexanone monooxygenase of SEQ ID NO.1 as a template, and amplifying and expanding the cyclohexanone monooxygenase gene fragment (Nde I and BamH I endonuclease fragments are added at two ends of the fragment) by PCR (polymerase chain reaction); and the gene is inserted into pET-21a plasmid by utilizing Nde I and BamH I endonuclease sites, and the connected vector is transferred into Escherichia coli Trans-T1 to construct and obtain a recombinant plasmid named pETC. Colony PCR verification is carried out by using a primer T7/R3, recombinant plasmids are extracted and sequenced, and the recombinant plasmid pETC with correct results is obtained.

Forward primer F5: GGCCATATGAATAATTTTGTTTAACTTTAAGAAGGAGATATAATGAGTACCAAGATGGATTTTG (SEQ ID NO.21)

Reverse primer R5: CGCGGATCCTTACGCATTAGCCTGCTGTTTGG (SEQ ID NO.22)

Designing primers F6 and R6, and then taking the isopropanol dehydrogenase gene segment of SEQ ID NO.7 as a template, and expanding the isopropanol dehydrogenase gene segment (adding BamH I and Xho I endonuclease segments at two ends of the segment) through PCR amplification; and inserting the gene into a corresponding pETC plasmid by utilizing BamH I and Xho I endonuclease sites, transferring the connected vector into Escherichia coli Trans-T1, and constructing to obtain a recombinant plasmid named pETCK-01. Colony PCR verification is carried out by using a primer F6/T7term, recombinant plasmids are extracted and sequenced, and the recombinant plasmid pETCK-01 with correct results is obtained. The recombinant plasmid obtained by construction is transformed into an expression competent cell of the holotype gold biotechnology limited, Escherichia coli BL21(DE3), and a co-expression genetic engineering strain containing two genes is obtained and is marked as strain No. 7.

Forward primer F6: CGCGGATCCAAGCTTAATAATTTTGTTTAACTTTAAGAAGGAGATATAATGACGGATCGTCTGAAAGGC (SEQ ID NO.23)

Reverse primer R6: CCGCTCGAGTTACTGGGCGGTATAGCCGCC (SEQ ID NO.24)

Example 4: preparation of genetically engineered bacteria

Respectively inoculating the recombinant escherichia coli genetic engineering strains, namely strain No.1, strain No.2, strain No.3, strain No.4, strain No.5, strain No.6 and strain No.7 into a liquid LB test tube culture medium containing corresponding resistance, activating for 12 hours at 37 ℃ by a shaking table, transferring the activated culture into a fermentation culture medium according to the inoculation amount of 0.5-5% (V/V), fermenting and culturing for 1-3 hours at 25-40 ℃, adding isopropyl-beta-D-thiogalactopyranoside (IPTG) with the final concentration of 0.05-2g/L, placing the mixture into a fermentation culture medium for induced expression for 2-24 hours at 15-35 ℃, centrifuging, filtering or ultrafiltering to obtain bacterial sludge, and placing the bacterial sludge into a place for freezing storage at-80 ℃.

Example 5: preparation of enzyme solution

Respectively weighing 10-20g of bacterial sludge of strain # 1, strain # 2, strain # 3, strain # 4, strain # 5, strain # 6 and strain # 7 obtained by fermentation, suspending in 100-200ml of cell disruption buffer (10mmol/L, pH7.4Tris-HCl buffer contains 5mmol/L MgCl₂) In the method, 100-650W power is used for carrying out ultrasonic crushing in an ice water bath for 4-20s at intervals of 4-60s, the whole ultrasonic process is carried out for 20-60min, and the ultrasonic crushing is repeated for three times. Centrifuging at low temperature, collecting supernatant to obtain enzyme solution of corresponding strain, and freezing at-20 deg.C.

Example 6: preparation of enzyme powder

Respectively weighing 10-50ml of enzyme solutions of strain # 1, strain # 2, strain # 3, strain # 4, strain # 5, strain # 6 and strain # 7, putting the enzyme solutions into a drying dish, and pre-freezing the enzyme solutions in a refrigerator at the temperature of-20 ℃ for 24-48 h. And then putting the sample into a freeze dryer for freeze drying, wherein the temperature of a cold trap of the freeze dryer is-50 ℃, the pressure of a drying chamber is 100Pa, freeze drying is carried out for 24h, solid powder of the enzyme is obtained, and the solid powder is refrigerated and stored at 4 ℃.

Example 7: method for synthesizing esomeprazole by enzyme method (one-pot method)

Dissolving 51g of compound B into 70g of toluene and 20g of isopropanol solution, adding a solution consisting of 20.4g of sodium hydroxide and 10g of water, preserving the temperature at 50 ℃ for 5-10min until the solution is clear, adding 41.4g of compound A, preserving the temperature for reacting for 2-3h, and adjusting the pH value to 7.5-8 by using glacial acetic acid.

To the reaction mixture, a mixed solution (50mM, pH9.0) of 75g of Strain # 2, 75g of Strain # 6 and 420g of phosphate buffer solution was added, and 0.5g of tetrabutylammonium bromide (TBAB) and 0.05g of oxidative coenzyme II (NADP) were added⁺) And keeping the temperature of 30 +/-2 ℃ for reaction under the condition of oxygen pressure maintaining, finishing the reaction for 30 hours, and monitoring the reaction conversion rate to be 98.6% by using a high performance liquid chromatography, wherein the ee value is 99%.

Example 8: method for synthesizing esomeprazole by enzyme method (one-pot method)

Dissolving 51g of compound B into 50g of toluene and 30g of isopropanol solution, adding a solution consisting of 20.4g of sodium hydroxide and 20g of water, preserving the temperature at 70 ℃ for 5-10min until the solution is clear, adding 41.4g of compound A, preserving the temperature for 1-2h, and adjusting the pH value to 7.5-8 by using dilute hydrochloric acid.

To the reaction solution was added a mixed solution of 150g of the strain 7# and 240g of a phosphate buffer solution (50mM, pH8.0), 2g of tetrabutylammonium bromide (TBAB) was added, and the mixture was reacted at 25. + -. 2 ℃ with continuous introduction of oxygen for 40 hours, and the conversion of the reaction was 99.4% and the ee value was 99% as monitored by high performance liquid chromatography.

Example 9: method for synthesizing esomeprazole by enzyme method (one-pot method)

And (3) sequentially adding 280g of the enzyme solution of the strain No.3 and 280g of the enzyme solution of the strain No.5 into the reaction solution, adding 0.2g of reducing coenzyme II (NADPH), continuously introducing air, keeping the temperature at 25 +/-2 ℃ for reaction, finishing the reaction for 55h, monitoring the reaction conversion rate by using a high performance liquid chromatography to be 97.5%, and controlling the ee value to be 99%.

Example 10: method for synthesizing esomeprazole by enzyme method (one-pot method)

Dissolving 51g of compound B in 70g of toluene and 20g of isopropanol solution, adding a solution consisting of 20.4g of sodium hydroxide and 10g of water, keeping the temperature at 50 ℃ for 5-10min until the solution is clear, adding 41.4g of compound A, keeping the temperature for reacting for 2-3h, and adjusting the pH value to 7.5-8 by using glacial acetic acid

And (3) sequentially adding 280g of enzyme solution of the strain No.3 and 280g of enzyme solution of the strain No.5 into the reaction solution, adding 0.1g of reducing coenzyme II (NADPH), continuously introducing air, keeping the temperature at 25 +/-2 ℃ for reaction, and after the reaction is finished for 62 hours, monitoring the reaction conversion rate by using a high performance liquid chromatography to be 97.5%, wherein the ee value of the product is 99%.

Example 11: method for synthesizing esomeprazole by enzyme method (one-pot method)

Dissolving 51g of compound B into 70g of toluene and 10g of isopropanol solution, adding a solution consisting of 20.4g of sodium hydroxide and 10g of water, preserving the temperature at 50 ℃ for 5-10min until the solution is clear, adding 41.4g of compound A, preserving the temperature for reacting for 2-3h, and adjusting the pH value to 7.5-8 by using dilute phosphoric acid.

To the above reaction solution, 3g of enzyme powder of Strain No.2, 3g of enzyme powder of Strain No.4 and 450g of Tris-HCl buffer solution (20mM, pH7.5) were added in this order, and 1g of TBAB and 0.05g of NADP were added⁺And continuously introducing oxygen, keeping the temperature at 25 +/-2 ℃ for reaction, finishing the reaction for 36 hours, and monitoring the reaction conversion rate to be 98.5% by using a high performance liquid chromatography, wherein the ee value is 99%.

Example 12: method for synthesizing esomeprazole by enzyme method (one-pot method)

Dissolving 51g of the compound B into 200g of toluene, adding a solution consisting of 20.4g of sodium hydroxide and 10g of water, preserving the temperature at 50 ℃ for 5-10min until the solution is clear, adding 41.4g of the compound A, preserving the temperature, reacting for 2-3h, and adjusting the pH value to 7.5-8 by using hydrochloric acid.

And (3) sequentially adding 280g of the enzyme solution of the strain No.1, 280g of the enzyme solution of the strain No.5, 20g of isopropanol and 0.1g of reducing coenzyme II (NADPH) into the reaction solution, continuously introducing air, keeping the temperature at 25 +/-2 ℃ for reaction, finishing the reaction for 60 hours, monitoring the reaction conversion rate by using a high performance liquid chromatography to be 98.6%, and controlling the ee value of a product to be 99%.

Example 13: method for synthesizing esomeprazole by enzyme method (one-pot method)

And (3) sequentially adding 280g of the enzyme solution of the strain No.1, 280g of the enzyme solution of the strain No.5, 20g of isopropanol and 1g of reducing coenzyme II (NADPH) into the reaction solution, continuously introducing air, keeping the temperature at 25 +/-2 ℃ for reaction, finishing the reaction for 55h, monitoring the reaction conversion rate by using a high performance liquid chromatography to be 98.1%, and controlling the ee value of a product to be 99%.

Example 14: method for synthesizing esomeprazole by enzyme method (one-pot method)

Dissolving 51g of compound B in 200g of toluene and 20g of isopropanol solution, adding a solution consisting of 20.4g of sodium hydroxide and 20g of water, keeping the temperature at 55 ℃ for 5-10min until the solution is clear, adding 41.4g of compound A, keeping the temperature for reacting for 2-3h, and adjusting the pH value to 7.5-8 by using glacial acetic acid

To the reaction solution, a mixed solution of 150g of bacterial sludge of the strain 7# and 240g of a phosphate buffer solution (50mM, pH8.0) was added, 2g of tetrabutylammonium bromide (TBAB) was added, and the mixture was allowed to keep warm at 25. + -. 2 ℃ with continuous introduction of air to react for 40 hours, and the reaction conversion was 98.9% and the ee value of the product was 99% as monitored by high performance liquid chromatography.

Example 15: method for synthesizing esomeprazole by enzyme method (one-pot method)

To the above reaction solution, 3g of enzyme powder of Strain # 2, 3g of KRED-127 enzyme powder (origin: Han enzyme Biotechnology Co., Ltd., Suzhou) and 450g of Tris-HCl buffer solution (20mM, pH7.5) were added in this order, and 1g of TBAB and 0.05g of NADP were added⁺And continuously introducing oxygen, keeping the temperature at 20 +/-2 ℃ for reaction, finishing the reaction for 48 hours, and monitoring the reaction conversion rate to be 98.7% by using a high performance liquid chromatography, wherein the ee value is 99%.

Example 16: method for synthesizing esomeprazole by enzyme method (one-pot method)

Dissolving 51g of compound B into 70g of dichloromethane and 10g of isopropanol solution, adding a solution consisting of 20.4g of sodium hydroxide and 10g of water, preserving the temperature at 45 ℃ for 5-10min until the solution is clear, adding 41.4g of compound A, preserving the temperature for reacting for 2-3h, and adjusting the pH value to 7.5-8 by using dilute phosphoric acid.

To the above reaction solution, 3g of enzyme powder of Strain # 2, 2g of enzyme powder of Strain # 4 and 450g of Tris-HCl buffer solution (20mM, pH7.5) were added in this order, and 1g of TBAB and 0.05g of NADP were added⁺And continuously introducing oxygen, keeping the temperature at 20 +/-2 ℃ for reaction, finishing the reaction for 48 hours, and monitoring the reaction conversion rate to be 80.7% by using a high performance liquid chromatography, wherein the ee value is 99%.

Example 17: method for synthesizing esomeprazole by enzyme method (one-pot method)

Dissolving 51g of compound B in 200g of toluene, adding a solution consisting of 20.4g of sodium hydroxide and 20g of water, keeping the temperature at 55 ℃ for 5-10min until the solution is clear, adding 41.4g of compound A, keeping the temperature for reacting for 2-3h, and adjusting the pH value to 7.5-8 by using glacial acetic acid

To the reaction solution, 20g of an isopropyl alcohol solution, 240g of a phosphate buffer solution (50mM,

pH8.0), 2g of tetrabutylammonium bromide (TBAB), 0.05g of NADP⁺3g of enzyme powder of Strain No.2 and 3g

ES-KRED-104 enzyme powder (from Shanghai, biomedicine, Shanghai, Ltd., Shangke) is reacted at 25 + -2 deg.C under oxygen pressure maintaining, the reaction is completed for 38h, the conversion rate of the reaction is monitored by high performance liquid chromatography to be 98.5%, and the ee value of the product is 99%.

Example 18: method for synthesizing esomeprazole by enzyme method (one-pot method)

Dissolving 51g of the compound B into 200g of ethyl acetate, adding a solution consisting of 20.4g of sodium hydroxide and 10g of water, preserving the temperature at 50 ℃ for 5-10min until the solution is clear, adding 41.4g of the compound A, preserving the temperature, reacting for 2-3h, and adjusting the pH value to 7.5-8 by using phosphoric acid.

To the reaction solution, a mixed solution of 20g of isopropyl alcohol, 75g of Strain 2#, 75g of Strain 6#, and 420g of phosphate buffer solution (50mM, pH9.0) was added, and 0.5g of tetrabutylammonium bromide (TBAB) and 0.05g of oxidizing agent were addedCoenzyme II (NADP)⁺) And keeping the temperature of 30 +/-2 ℃ for reaction under the condition of oxygen pressure maintaining, finishing the reaction for 36 hours, and monitoring the reaction conversion rate to be 76.6% by using a high performance liquid chromatography, wherein the ee value is 99%.

SEQUENCE LISTING

<110> Zhejiang Jing New pharmaceutical products, Shanghai Jing New biological medicine, Inc

<120> method for synthesizing esomeprazole by enzyme method

<130> 142

<160> 24

<170> PatentIn version 3.5

<210> 1

<211> 1632

<212> DNA

<213> Artificial sequence

<400> 1

atgagtacca agatggattt tgatgcaatt gtgatcggtg ccggctttgg cggcctgtat 60

gccgttaaaa aactgcgcga tgaactggaa ctgaaagtta aagcctttga taaagcaacg 120

gatgtgggcg ggacctggta ttggaatcgc tatccgggcg cactgacgga tacggaaacc 180

catctgtatt gctattcttg ggataaagaa atgctacaga gtttagaaat caaaaagaaa 240

tatgtgcagg gcccagatgt tcgcaaatac ttacagcagg ttgcagaaaa acatgatctg 300

aaaaaatctt atcagtttaa taccgccgtg acgagtgctc attataacga ggcggatgcc 360

ctgtgggaag tgacaaccga atatggcgat aaatataccg cacgctttct gattaccgcc 420

gtgggtctgc tgtctgcacc taattggcct aatatcaaag gcatcaatca gtttaaaggt 480

gaactgcatc atacgtcacg ctggccggat gatgtgagca tcgaaggcaa gagagtgggt 540

gtgatcggta cgggtagtac gggcgttcag gttattacag cagttgctcc attagccaaa 600

catctgaccg tgtttcagcg tagtccacag tatagtgttc cgatcggcaa tgatccactg 660

agcgaagaag atgttaagaa gattaaagat aattatgata aaatctggga tggtgtgaaa 720

aatagcgcct tagcctatgg tgtgaatgag tctacagttc cagccatgag cgtgagtgca 780

gaagaacgta aagccgtgtt tgaaaaggca tggcagacgg gtggcgggat gcgctttatg 840

tttgaaacct ttggggacat aattaccaat atggaagcta atatcgaagc acagaatttt 900

atcaaaggca aaattgcccg catcgttaaa gatcctgcca ttgcacagaa actgatgcct 960

caggatctgt atgcttgtcg cccgctgtgc gattcaggct attataatac ctttaatcgc 1020

gaaaatgttc gtctggaaga tgttaaagct aatccgatcg tggaaatcac cgaaaatggc 1080

gttaaactgg aaaatggcga ttttgtggaa ttagatatgc tgatttgcgc gaccggcttt 1140

gatgcgggcg atggctctta caagcgcatc gacatacagg ggaaaaatgg cttagccatc 1200

aaagattatt ggaaagaagg tcctagtagc tatatgggcg ttgcggttaa caactatccg 1260

aatatgttta tggtttttgg tccgaatggt ccactggcca atactcctcc tatcatcgaa 1320

tctcaggttg agtggatttc agtgtttatc cagtataccg ttgaaaacaa tgttgaatct 1380

atcgaagccg ataaagaagc ggaagaacag tggacccaga cctgcgccaa tattgccgaa 1440

aaaaccctgt ttcctaaagc caaatgtcgc atctttggtg ccaatattcc gggcaagaaa 1500

aacacggtgt atctgtacct cggcggtctg aaagaatatc gtagcgtttt agctaattgc 1560

aaaaatcatg cgtatgtggg ctttgatatt cagttacagc gctcagatac caaacagcag 1620

gctaatgcgt aa 1632

<210> 2

<211> 543

<212> PRT

<213> Artificial sequence

<400> 2

Met Ser Thr Lys Met Asp Phe Asp Ala Ile Val Ile Gly Ala Gly Phe

1 5 10 15

Gly Gly Leu Tyr Ala Val Lys Lys Leu Arg Asp Glu Leu Glu Leu Lys

20 25 30

Val Lys Ala Phe Asp Lys Ala Thr Asp Val Gly Gly Thr Trp Tyr Trp

35 40 45

Asn Arg Tyr Pro Gly Ala Leu Thr Asp Thr Glu Thr His Leu Tyr Cys

50 55 60

Tyr Ser Trp Asp Lys Glu Met Leu Gln Ser Leu Glu Ile Lys Lys Lys

65 70 75 80

Tyr Val Gln Gly Pro Asp Val Arg Lys Tyr Leu Gln Gln Val Ala Glu

85 90 95

Lys His Asp Leu Lys Lys Ser Tyr Gln Phe Asn Thr Ala Val Thr Ser

100 105 110

Ala His Tyr Asn Glu Ala Asp Ala Leu Trp Glu Val Thr Thr Glu Tyr

115 120 125

Gly Asp Lys Tyr Thr Ala Arg Phe Leu Ile Thr Ala Val Gly Leu Leu

130 135 140

Ser Ala Pro Asn Trp Pro Asn Ile Lys Gly Ile Asn Gln Phe Lys Gly

145 150 155 160

Glu Leu His His Thr Ser Arg Trp Pro Asp Asp Val Ser Ile Glu Gly

165 170 175

Lys Arg Val Gly Val Ile Gly Thr Gly Ser Thr Gly Val Gln Val Ile

180 185 190

Thr Ala Val Ala Pro Leu Ala Lys His Leu Thr Val Phe Gln Arg Ser

195 200 205

Pro Gln Tyr Ser Val Pro Ile Gly Asn Asp Pro Leu Ser Glu Glu Asp

210 215 220

Val Lys Lys Ile Lys Asp Asn Tyr Asp Lys Ile Trp Asp Gly Val Lys

225 230 235 240

Asn Ser Ala Leu Ala Tyr Gly Val Asn Glu Ser Thr Val Pro Ala Met

245 250 255

Ser Val Ser Ala Glu Glu Arg Lys Ala Val Phe Glu Lys Ala Trp Gln

260 265 270

Thr Gly Gly Gly Met Arg Phe Met Phe Glu Thr Phe Gly Asp Ile Ile

275 280 285

Thr Asn Met Glu Ala Asn Ile Glu Ala Gln Asn Phe Ile Lys Gly Lys

290 295 300

Ile Ala Arg Ile Val Lys Asp Pro Ala Ile Ala Gln Lys Leu Met Pro

305 310 315 320

Gln Asp Leu Tyr Ala Cys Arg Pro Leu Cys Asp Ser Gly Tyr Tyr Asn

325 330 335

Thr Phe Asn Arg Glu Asn Val Arg Leu Glu Asp Val Lys Ala Asn Pro

340 345 350

Ile Val Glu Ile Thr Glu Asn Gly Val Lys Leu Glu Asn Gly Asp Phe

355 360 365

Val Glu Leu Asp Met Leu Ile Cys Ala Thr Gly Phe Asp Ala Gly Asp

370 375 380

Gly Ser Tyr Lys Arg Ile Asp Ile Gln Gly Lys Asn Gly Leu Ala Ile

385 390 395 400

Lys Asp Tyr Trp Lys Glu Gly Pro Ser Ser Tyr Met Gly Val Ala Val

405 410 415

Asn Asn Tyr Pro Asn Met Phe Met Val Phe Gly Pro Asn Gly Pro Leu

420 425 430

Ala Asn Thr Pro Pro Ile Ile Glu Ser Gln Val Glu Trp Ile Ser Val

435 440 445

Phe Ile Gln Tyr Thr Val Glu Asn Asn Val Glu Ser Ile Glu Ala Asp

450 455 460

Lys Glu Ala Glu Glu Gln Trp Thr Gln Thr Cys Ala Asn Ile Ala Glu

465 470 475 480

Lys Thr Leu Phe Pro Lys Ala Lys Cys Arg Ile Phe Gly Ala Asn Ile

485 490 495

Pro Gly Lys Lys Asn Thr Val Tyr Leu Tyr Leu Gly Gly Leu Lys Glu

500 505 510

Tyr Arg Ser Val Leu Ala Asn Cys Lys Asn His Ala Tyr Val Gly Phe

515 520 525

Asp Ile Gln Leu Gln Arg Ser Asp Thr Lys Gln Gln Ala Asn Ala

530 535 540

<210> 3

<211> 1632

<212> DNA

<213> Artificial sequence

<400> 3

atgagtacca agatggattt tgatgcaatt gtgatcggtg ccggctttgg cggcctgtat 60

gccgttaaaa aactgcgcga tgaactggaa ctgaaagtta aagcctttga taaagcaacg 120

gatgtgggcg ggacctggta ttggaatcgc tatccgggcg cactgacgga tacggaaacc 180

catctgtatt gctattcttg ggataaagaa atgctacaga gtttagaaat caaaaagaaa 240

tatgtgcagg gcccagatgt tcgcaaatac ttacagcagg ttgcagaaaa acatgatctg 300

aaaaaatctt atcagtttaa taccgccgtg acgagtgctc attataacga ggcggatgcc 360

ctgtgggaag tgacaaccga atatggcgat aaatataccg cacgctttct gattaccgcc 420

gtgggtctgc tgtctgcacc taattggcct aatatcaaag gcatcaatca gtttaaaggt 480

gaactgcatc atacgtcacg ctggccggat gatgtgagca tcgaaggcaa gagagtgggt 540

gtgatcggta cgggtagtac gggcgttcag gttattacag cagttgctcc attagccaaa 600

catctgaccg tgtttcagcg tagtccacag tatagtgttc cgatcggcaa tgatccactg 660

agcgaagaag atgttaagaa gattaaagat aattatgata aaatctggga tggtgtgaaa 720

aatagcgcct tagcctatgg tgtgaatgag tctacagttc cagccatgag cgtgagtgca 780

gaagaacgta aagccgtgtt tgaaaaggca tggcagacgg gtggcgggat gcgctttatg 840

tttgaaacct ttggggacat aattaccaat atggaagcta atatcgaagc acagaatttt 900

atcaaaggca aaattgcccg catcgttaaa gatcctgcca ttgcacagaa actgatgcct 960

caggatctgt atgcttgtcg cccgctgtgc gattcaggct attataatac ctttaatcgc 1020

gaaaatgttc gtctggaaga tgttaaagct aatccgatcg tggaaatcac cgaaaatggc 1080

gttaaactgg aaaatggcga ttttgtggaa ttagatatgc tgatttgcgc gaccggcttt 1140

gatgcgggcg atggcaacta caagcgcatc gacatacagg ggaaaaatgg cttagccatc 1200

aaagattatt ggaaagaagg tcctagtagc tatatgggcg ttgcggttaa caactatccg 1260

aatatgttta tggtttttgg tccgaatggt ccactggcca attctcctcc tatcatcgaa 1320

tctcaggttg agtggatttc agtgtttatc cagtataccg ttgaaaacaa tgttgaatct 1380

atcgaagccg ataaagaagc ggaagaacag tggacccaga cctgcgccaa tattgccgaa 1440

aaaaccctgt ttcctaaagc caaatgtcgc atctttggtg ccaatattcc gggcaagaaa 1500

aacacggtgt atctgtacct cggcggtctg aaagaatatc gtagcgtttt agctaattgc 1560

aaaaatcatg cgtatgtggg ctttgatatt cagttacagc gctcagatac caaacagcag 1620

gctaatgcgt aa 1632

<210> 4

<211> 543

<212> PRT

<213> Artificial sequence

<400> 4

Met Ser Thr Lys Met Asp Phe Asp Ala Ile Val Ile Gly Ala Gly Phe

1 5 10 15

Gly Gly Leu Tyr Ala Val Lys Lys Leu Arg Asp Glu Leu Glu Leu Lys

20 25 30

Val Lys Ala Phe Asp Lys Ala Thr Asp Val Gly Gly Thr Trp Tyr Trp

35 40 45

Asn Arg Tyr Pro Gly Ala Leu Thr Asp Thr Glu Thr His Leu Tyr Cys

50 55 60

Tyr Ser Trp Asp Lys Glu Met Leu Gln Ser Leu Glu Ile Lys Lys Lys

65 70 75 80

Tyr Val Gln Gly Pro Asp Val Arg Lys Tyr Leu Gln Gln Val Ala Glu

85 90 95

Lys His Asp Leu Lys Lys Ser Tyr Gln Phe Asn Thr Ala Val Thr Ser

100 105 110

Ala His Tyr Asn Glu Ala Asp Ala Leu Trp Glu Val Thr Thr Glu Tyr

115 120 125

Gly Asp Lys Tyr Thr Ala Arg Phe Leu Ile Thr Ala Val Gly Leu Leu

130 135 140

Ser Ala Pro Asn Trp Pro Asn Ile Lys Gly Ile Asn Gln Phe Lys Gly

145 150 155 160

Glu Leu His His Thr Ser Arg Trp Pro Asp Asp Val Ser Ile Glu Gly

165 170 175

Lys Arg Val Gly Val Ile Gly Thr Gly Ser Thr Gly Val Gln Val Ile

180 185 190

Thr Ala Val Ala Pro Leu Ala Lys His Leu Thr Val Phe Gln Arg Ser

195 200 205

Pro Gln Tyr Ser Val Pro Ile Gly Asn Asp Pro Leu Ser Glu Glu Asp

210 215 220

Val Lys Lys Ile Lys Asp Asn Tyr Asp Lys Ile Trp Asp Gly Val Lys

225 230 235 240

Asn Ser Ala Leu Ala Tyr Gly Val Asn Glu Ser Thr Val Pro Ala Met

245 250 255

Ser Val Ser Ala Glu Glu Arg Lys Ala Val Phe Glu Lys Ala Trp Gln

260 265 270

Thr Gly Gly Gly Met Arg Phe Met Phe Glu Thr Phe Gly Asp Ile Ile

275 280 285

Thr Asn Met Glu Ala Asn Ile Glu Ala Gln Asn Phe Ile Lys Gly Lys

290 295 300

Ile Ala Arg Ile Val Lys Asp Pro Ala Ile Ala Gln Lys Leu Met Pro

305 310 315 320

Gln Asp Leu Tyr Ala Cys Arg Pro Leu Cys Asp Ser Gly Tyr Tyr Asn

325 330 335

Thr Phe Asn Arg Glu Asn Val Arg Leu Glu Asp Val Lys Ala Asn Pro

340 345 350

Ile Val Glu Ile Thr Glu Asn Gly Val Lys Leu Glu Asn Gly Asp Phe

355 360 365

Val Glu Leu Asp Met Leu Ile Cys Ala Thr Gly Phe Asp Ala Gly Asp

370 375 380

Gly Asn Tyr Lys Arg Ile Asp Ile Gln Gly Lys Asn Gly Leu Ala Ile

385 390 395 400

Lys Asp Tyr Trp Lys Glu Gly Pro Ser Ser Tyr Met Gly Val Ala Val

405 410 415

Asn Asn Tyr Pro Asn Met Phe Met Val Phe Gly Pro Asn Gly Pro Leu

420 425 430

Ala Asn Ser Pro Pro Ile Ile Glu Ser Gln Val Glu Trp Ile Ser Val

435 440 445

Phe Ile Gln Tyr Thr Val Glu Asn Asn Val Glu Ser Ile Glu Ala Asp

450 455 460

Lys Glu Ala Glu Glu Gln Trp Thr Gln Thr Cys Ala Asn Ile Ala Glu

465 470 475 480

Lys Thr Leu Phe Pro Lys Ala Lys Cys Arg Ile Phe Gly Ala Asn Ile

485 490 495

Pro Gly Lys Lys Asn Thr Val Tyr Leu Tyr Leu Gly Gly Leu Lys Glu

500 505 510

Tyr Arg Ser Val Leu Ala Asn Cys Lys Asn His Ala Tyr Val Gly Phe

515 520 525

Asp Ile Gln Leu Gln Arg Ser Asp Thr Lys Gln Gln Ala Asn Ala

530 535 540

<210> 5

<211> 1632

<212> DNA

<213> Artificial sequence

<400> 5

atgagtacca agatggattt tgatgcaatt gtgatcggtg ccggctttgg cggcctgtat 60

gccgttaaaa aactgcgcga tgaactggaa ctgaaagtta aagcctttga taaagcaacg 120

gatgtgggcg ggacctggta ttggaatcgc tatccgggcg cactgacgga tacggaaacc 180

catctgtatt gctattcttg ggataaagaa atgctacaga gtttagaaat caaaaagaaa 240

tatgtgcagg gcccagatgt tcgcaaatac ttacagcagg ttgcagaaaa acatgatctg 300

aaaaaatctt atcagtttaa taccgccgtg acgagtgctc attataacga ggcggatgcc 360

ctgtgggaag tgacaaccga atatggcgat aaatataccg cacgctttct gattaccgcc 420

gtgggtctgc tgtctgcacc taattggcct aatatcaaag gcatcaatca gtttaaaggt 480

gaactgcatc atacgtcacg ctggccggat gatgtgagca tcgaaggcaa gagagtgggt 540

gtgatcggta cgggtagtac gggcgttcag gttattacag cagttgctcc attagccaaa 600

catctgaccg tgtttcagcg tagtccacag tatagtgttc cgatcggcaa tgatccactg 660

agcgaagaag atgttaagaa gattaaagat aattatgata aaatctggga tggtgtgaaa 720

aatagcgcct tagcctatgg tgtgaatgag tctacagttc cagccatgag cgtgagtgca 780

gaagaacgta aagccgtgtt tgaaaaggca tggcagacgg gtggcgggat gcgctttatg 840

tttgaaacct ttggggacat aattaccaat atggaagcta atatcgaagc acagaatttt 900

atcaaaggca aaattgcccg catcgttaaa gatcctgcca ttgcacagaa actgatgcct 960

caggatctgt atgcttgtcg cccgctgtgc gattcaggct attataatac ctttaatcgc 1020

gaaaatgttc gtctggaaga tgttaaagct aatccgatcg tggaaatcac cgaaaatggc 1080

gttaaactgg aaaatggcga ttttgtggaa ttagatatgc tgatttgcgc gaccggcttt 1140

gatgcgggcg atggcaacta caagcgcatc gacatacagg ggaaaaatgg cttagccatc 1200

aaagattatt ggaaagaagg tcctagtagc tatatgggcg ttgcggttaa caactatccg 1260

aatatgttta tggtttttgg tccgaatggt ccactggcca atactcctcc tatcatcgaa 1320

tctcaggttg agtggatttc agtgtttatc cagtataccg ttgaaaacaa tgttgaatct 1380

atcgaagccg ataaagaagc ggaagaacag tggacccaga cctgcgccaa tattgccgaa 1440

aaaaccctgt ttcctaaagc caaatgtcgc atctttggtg ccaatattcc gggcaagaaa 1500

aacacggtgt atctgtacct cggcggtctg aaagaatatc gtagcgtttt agctaattgc 1560

aaaaatcatg cgtatgtggg ctttgatatt cagttacagc gctcagatac caaacagcag 1620

gctaatgcgt aa 1632

<210> 6

<211> 543

<212> PRT

<213> Artificial sequence

<400> 6

Met Ser Thr Lys Met Asp Phe Asp Ala Ile Val Ile Gly Ala Gly Phe

1 5 10 15

Gly Gly Leu Tyr Ala Val Lys Lys Leu Arg Asp Glu Leu Glu Leu Lys

20 25 30

Val Lys Ala Phe Asp Lys Ala Thr Asp Val Gly Gly Thr Trp Tyr Trp

35 40 45

Asn Arg Tyr Pro Gly Ala Leu Thr Asp Thr Glu Thr His Leu Tyr Cys

50 55 60

Tyr Ser Trp Asp Lys Glu Met Leu Gln Ser Leu Glu Ile Lys Lys Lys

65 70 75 80

Tyr Val Gln Gly Pro Asp Val Arg Lys Tyr Leu Gln Gln Val Ala Glu

85 90 95

Lys His Asp Leu Lys Lys Ser Tyr Gln Phe Asn Thr Ala Val Thr Ser

100 105 110

Ala His Tyr Asn Glu Ala Asp Ala Leu Trp Glu Val Thr Thr Glu Tyr

115 120 125

Gly Asp Lys Tyr Thr Ala Arg Phe Leu Ile Thr Ala Val Gly Leu Leu

130 135 140

Ser Ala Pro Asn Trp Pro Asn Ile Lys Gly Ile Asn Gln Phe Lys Gly

145 150 155 160

Glu Leu His His Thr Ser Arg Trp Pro Asp Asp Val Ser Ile Glu Gly

165 170 175

Lys Arg Val Gly Val Ile Gly Thr Gly Ser Thr Gly Val Gln Val Ile

180 185 190

Thr Ala Val Ala Pro Leu Ala Lys His Leu Thr Val Phe Gln Arg Ser

195 200 205

Pro Gln Tyr Ser Val Pro Ile Gly Asn Asp Pro Leu Ser Glu Glu Asp

210 215 220

Val Lys Lys Ile Lys Asp Asn Tyr Asp Lys Ile Trp Asp Gly Val Lys

225 230 235 240

Asn Ser Ala Leu Ala Tyr Gly Val Asn Glu Ser Thr Val Pro Ala Met

245 250 255

Ser Val Ser Ala Glu Glu Arg Lys Ala Val Phe Glu Lys Ala Trp Gln

260 265 270

Thr Gly Gly Gly Met Arg Phe Met Phe Glu Thr Phe Gly Asp Ile Ile

275 280 285

Thr Asn Met Glu Ala Asn Ile Glu Ala Gln Asn Phe Ile Lys Gly Lys

290 295 300

Ile Ala Arg Ile Val Lys Asp Pro Ala Ile Ala Gln Lys Leu Met Pro

305 310 315 320

Gln Asp Leu Tyr Ala Cys Arg Pro Leu Cys Asp Ser Gly Tyr Tyr Asn

325 330 335

Thr Phe Asn Arg Glu Asn Val Arg Leu Glu Asp Val Lys Ala Asn Pro

340 345 350

Ile Val Glu Ile Thr Glu Asn Gly Val Lys Leu Glu Asn Gly Asp Phe

355 360 365

Val Glu Leu Asp Met Leu Ile Cys Ala Thr Gly Phe Asp Ala Gly Asp

370 375 380

Gly Asn Tyr Lys Arg Ile Asp Ile Gln Gly Lys Asn Gly Leu Ala Ile

385 390 395 400

Lys Asp Tyr Trp Lys Glu Gly Pro Ser Ser Tyr Met Gly Val Ala Val

405 410 415

Asn Asn Tyr Pro Asn Met Phe Met Val Phe Gly Pro Asn Gly Pro Leu

420 425 430

Ala Asn Thr Pro Pro Ile Ile Glu Ser Gln Val Glu Trp Ile Ser Val

435 440 445

Phe Ile Gln Tyr Thr Val Glu Asn Asn Val Glu Ser Ile Glu Ala Asp

450 455 460

Lys Glu Ala Glu Glu Gln Trp Thr Gln Thr Cys Ala Asn Ile Ala Glu

465 470 475 480

Lys Thr Leu Phe Pro Lys Ala Lys Cys Arg Ile Phe Gly Ala Asn Ile

485 490 495

Pro Gly Lys Lys Asn Thr Val Tyr Leu Tyr Leu Gly Gly Leu Lys Glu

500 505 510

Tyr Arg Ser Val Leu Ala Asn Cys Lys Asn His Ala Tyr Val Gly Phe

515 520 525

Asp Ile Gln Leu Gln Arg Ser Asp Thr Lys Gln Gln Ala Asn Ala

530 535 540

<210> 7

<211> 759

<212> DNA

<213> Artificial sequence

<400> 7

atgacggatc gtctgaaagg caaagttgcc atcgtgaccg gtggcacgct gggcatcggc 60

ctggccattg ccgataaatt tgtggaagaa ggcgccaaag tggttattac aggtcgtcat 120

gcagatgtgg gcgaaaaagc cgccaaatct atcggcggca ccgatgttat tcgctttgtg 180

cagcatgatg cgtcagatga agcgggttgg acgaaactgt ttgatacaac ggaagaagcc 240

tttggtccag tgacaacggt tgtgaataac gccggtatct ttgtgtacaa gtcagtggaa 300

gatacgacga cagaagaatg gcgcaaactg ctgagtgtta acctggatgg cgtgtttttc 360

ggtacacgtt taggtatcca gcgcatgaaa aataagggct taggtgcgag tatcatcaat 420

atgtcctcaa tcgaaggctt agtgggcgat cctacgggtg gtgcttataa tgcctctaaa 480

ggtgcagttc gcattatgtc taaatcagct gcactggatt gcgctctgaa agattatgat 540

gttcgcgtta ataccgttca tccgggctat atcaaaacac cattagttga tgatctggaa 600

ggtgccgaag aaatgatgtc tcagcgtacc aaaaccccta tgggtcatat cggtgaacct 660

aatgatattg cttggatctg cgtgtatctg gcgtcagatg aatctaaatt tgcaacaggc 720

gcggaatttg tggttgatgg cggctatacc gcccagtaa 759

<210> 8

<211> 252

<212> PRT

<213> Artificial sequence

<400> 8

Met Thr Asp Arg Leu Lys Gly Lys Val Ala Ile Val Thr Gly Gly Thr

1 5 10 15

Leu Gly Ile Gly Leu Ala Ile Ala Asp Lys Phe Val Glu Glu Gly Ala

20 25 30

Lys Val Val Ile Thr Gly Arg His Ala Asp Val Gly Glu Lys Ala Ala

35 40 45

Lys Ser Ile Gly Gly Thr Asp Val Ile Arg Phe Val Gln His Asp Ala

50 55 60

Ser Asp Glu Ala Gly Trp Thr Lys Leu Phe Asp Thr Thr Glu Glu Ala

65 70 75 80

Phe Gly Pro Val Thr Thr Val Val Asn Asn Ala Gly Ile Phe Val Tyr

85 90 95

Lys Ser Val Glu Asp Thr Thr Thr Glu Glu Trp Arg Lys Leu Leu Ser

100 105 110

Val Asn Leu Asp Gly Val Phe Phe Gly Thr Arg Leu Gly Ile Gln Arg

115 120 125

Met Lys Asn Lys Gly Leu Gly Ala Ser Ile Ile Asn Met Ser Ser Ile

130 135 140

Glu Gly Leu Val Gly Asp Pro Thr Gly Gly Ala Tyr Asn Ala Ser Lys

145 150 155 160

Gly Ala Val Arg Ile Met Ser Lys Ser Ala Ala Leu Asp Cys Ala Leu

165 170 175

Lys Asp Tyr Asp Val Arg Val Asn Thr Val His Pro Gly Tyr Ile Lys

180 185 190

Thr Pro Leu Val Asp Asp Leu Glu Gly Ala Glu Glu Met Met Ser Gln

195 200 205

Arg Thr Lys Thr Pro Met Gly His Ile Gly Glu Pro Asn Asp Ile Ala

210 215 220

Trp Ile Cys Val Tyr Leu Ala Ser Asp Glu Ser Lys Phe Ala Thr Gly

225 230 235 240

Ala Glu Phe Val Val Asp Gly Gly Tyr Thr Ala Gln

245 250

<210> 9

<211> 858

<212> DNA

<213> Artificial sequence

<400> 9

atggcttccg tttccattcc tcttcgagcg ctgtcaagcg gttataacat ccctgccatt 60

ggtcttggcg tgtaccagag tgcagacgcc gaaaccattg tctacgaggc cctcaaaaag 120

ggttacagac tggtggacac tgcccaggag tatggcaatg aagctgccac ttgtcggggt 180

atttccaagt tcctgaagga gactggaact aaccgacgag aggtctttta caccaccaag 240

ctggacgacg ccactggagg atatgagggc accatgcagc tggctgaggc tcgcctagct 300

gaggctcgaa agggcggtat tgattacatt gatctgcttc tgatccatgc tcctttctcc 360

aagtctccct acaccgagac ccgactggct gcttggaagg ctcttaccga gctggttgac 420

ggaggagcca ttcgaagcat tggagtgtcc aactacggag ttaagcatct gaaggagttc 480

tgggacgctg atgtcaagta caagcctgtt ctgaaccagg ttgagtcttc tccctggaac 540

gtgcgacaag atatccacga cttttgcaag tctcacaatg tcattgtcga acaatactct 600

cctctgtgtc gaggcaatcg atttaaggag cccggtgttc tcaagctggc tgacaagtac 660

aagaagactc ctgcccagat tctcattcga tggagtctgg ataagggaat gcttcccatt 720

cccaagaccg acaacgtgga ccgtctgagt cctaacctcg acgtctttga tttcaatctg 780

actccccaag aggtcgagga ccttcaggat ctcaactcgt atacttgtta cgagtgggac 840

cccaccgtta ccaagtga 858

<210> 10

<211> 285

<212> PRT

<213> Artificial sequence

<400> 10

Met Ala Ser Val Ser Ile Pro Leu Arg Ala Leu Ser Ser Gly Tyr Asn

1 5 10 15

Ile Pro Ala Ile Gly Leu Gly Val Tyr Gln Ser Ala Asp Ala Glu Thr

20 25 30

Ile Val Tyr Glu Ala Leu Lys Lys Gly Tyr Arg Leu Val Asp Thr Ala

35 40 45

Gln Glu Tyr Gly Asn Glu Ala Ala Thr Cys Arg Gly Ile Ser Lys Phe

50 55 60

Leu Lys Glu Thr Gly Thr Asn Arg Arg Glu Val Phe Tyr Thr Thr Lys

65 70 75 80

Leu Asp Asp Ala Thr Gly Gly Tyr Glu Gly Thr Met Gln Leu Ala Glu

85 90 95

Ala Arg Leu Ala Glu Ala Arg Lys Gly Gly Ile Asp Tyr Ile Asp Leu

100 105 110

Leu Leu Ile His Ala Pro Phe Ser Lys Ser Pro Tyr Thr Glu Thr Arg

115 120 125

Leu Ala Ala Trp Lys Ala Leu Thr Glu Leu Val Asp Gly Gly Ala Ile

130 135 140

Arg Ser Ile Gly Val Ser Asn Tyr Gly Val Lys His Leu Lys Glu Phe

145 150 155 160

Trp Asp Ala Asp Val Lys Tyr Lys Pro Val Leu Asn Gln Val Glu Ser

165 170 175

Ser Pro Trp Asn Val Arg Gln Asp Ile His Asp Phe Cys Lys Ser His

180 185 190

Asn Val Ile Val Glu Gln Tyr Ser Pro Leu Cys Arg Gly Asn Arg Phe

195 200 205

Lys Glu Pro Gly Val Leu Lys Leu Ala Asp Lys Tyr Lys Lys Thr Pro

210 215 220

Ala Gln Ile Leu Ile Arg Trp Ser Leu Asp Lys Gly Met Leu Pro Ile

225 230 235 240

Pro Lys Thr Asp Asn Val Asp Arg Leu Ser Pro Asn Leu Asp Val Phe

245 250 255

Asp Phe Asn Leu Thr Pro Gln Glu Val Glu Asp Leu Gln Asp Leu Asn

260 265 270

Ser Tyr Thr Cys Tyr Glu Trp Asp Pro Thr Val Thr Lys

275 280 285

<210> 11

<211> 840

<212> DNA

<213> Artificial sequence

<400> 11

atgtcgtcac aggttccatc cgccgaggcc cagaccgtga tttcctttca tgacggtcac 60

accatgcccc agatcgggct gggcgtgtgg gaaacgccgc cggatgagac ggccgaggtc 120

gtgaaggaag ccgtgaagct cggttaccgg tctgtcgata cggcgcgtct gtacaagaac 180

gaggaaggtg tcggcaaagg tctggaagac catccggaaa tcttcctgac gaccaagctc 240

tggaatgacg agcagggcta tgacagcacc ctgcgggcgt atgaagaaag cgcgcgcctg 300

ctgcgtcgtc cggtgctgga cctgtatctg atccactggc cgatgccggc tcaggggcag 360

tatgtcgaga cgtggaaggc actcgtcgag ctgaagaaat ccggtcgtgt gaagtccatc 420

ggcgtgtcca atttcgagtc ggagcatctg gagcggatca tggatgccac gggtgtcgtg 480

ccggtcgtca accagatcga gctgcatccc gatttccagc agcgcgccct gcgggaattc 540

cacgagaagc acaacatccg caccgagtcc tggcgcccgc tgggcaaggg gcgcgtcctg 600

agcgatgagc ggatcgggaa gatcgctgaa aagcacagcc ggactccggc gcaggtcgtg 660

atccgctggc atcttcagaa tggactgatc gtcattccga aatcggtcaa tcccaagcgt 720

ctggctgaaa atctggatgt gttcggcttc gtgctggatg cggatgacat gcaggccatc 780

gaacagatgg accgcaagga tggccggatg ggcgctgatc cgaatacggc gaaattctga 840

<210> 12

<211> 279

<212> PRT

<213> Artificial sequence

<400> 12

Met Ser Ser Gln Val Pro Ser Ala Glu Ala Gln Thr Val Ile Ser Phe

1 5 10 15

His Asp Gly His Thr Met Pro Gln Ile Gly Leu Gly Val Trp Glu Thr

20 25 30

Pro Pro Asp Glu Thr Ala Glu Val Val Lys Glu Ala Val Lys Leu Gly

35 40 45

Tyr Arg Ser Val Asp Thr Ala Arg Leu Tyr Lys Asn Glu Glu Gly Val

50 55 60

Gly Lys Gly Leu Glu Asp His Pro Glu Ile Phe Leu Thr Thr Lys Leu

65 70 75 80

Trp Asn Asp Glu Gln Gly Tyr Asp Ser Thr Leu Arg Ala Tyr Glu Glu

85 90 95

Ser Ala Arg Leu Leu Arg Arg Pro Val Leu Asp Leu Tyr Leu Ile His

100 105 110

Trp Pro Met Pro Ala Gln Gly Gln Tyr Val Glu Thr Trp Lys Ala Leu

115 120 125

Val Glu Leu Lys Lys Ser Gly Arg Val Lys Ser Ile Gly Val Ser Asn

130 135 140

Phe Glu Ser Glu His Leu Glu Arg Ile Met Asp Ala Thr Gly Val Val

145 150 155 160

Pro Val Val Asn Gln Ile Glu Leu His Pro Asp Phe Gln Gln Arg Ala

165 170 175

Leu Arg Glu Phe His Glu Lys His Asn Ile Arg Thr Glu Ser Trp Arg

180 185 190

Pro Leu Gly Lys Gly Arg Val Leu Ser Asp Glu Arg Ile Gly Lys Ile

195 200 205

Ala Glu Lys His Ser Arg Thr Pro Ala Gln Val Val Ile Arg Trp His

210 215 220

Leu Gln Asn Gly Leu Ile Val Ile Pro Lys Ser Val Asn Pro Lys Arg

225 230 235 240

Leu Ala Glu Asn Leu Asp Val Phe Gly Phe Val Leu Asp Ala Asp Asp

245 250 255

Met Gln Ala Ile Glu Gln Met Asp Arg Lys Asp Gly Arg Met Gly Ala

260 265 270

Asp Pro Asn Thr Ala Lys Phe

275

<210> 13

<211> 36

<212> DNA

<213> Artificial sequence

<400> 13

ggaattccat atgagtacca agatggattt tgatgc 36

<210> 14

<211> 32

<212> DNA

<213> Artificial sequence

<400> 14

cgcggatcct tacgcattag cctgctgttt gg 32

<210> 15

<211> 30

<212> DNA

<213> Artificial sequence

<400> 15

ggaattccat atgacggatc gtctgaaagg 30

<210> 16

<211> 28

<212> DNA

<213> Artificial sequence

<400> 16

cgcggatcct tactgggcgg tatagccg 28

<210> 17

<211> 30

<212> DNA

<213> Artificial sequence

<400> 17

ggaattccat atggcttccg tttccattcc 30

<210> 18

<211> 30

<212> DNA

<213> Artificial sequence

<400> 18

cgcggatcct cacttggtaa cggtggggtc 30

<210> 19

<211> 30

<212> DNA

<213> Artificial sequence

<400> 19

ggaattccat atgtcgtcac aggttccatc 30

<210> 20

<211> 29

<212> DNA

<213> Artificial sequence

<400> 20

cgcggatcct cagaatttcg ccgtattcg 29

<210> 21

<211> 64

<212> DNA

<213> Artificial sequence

<400> 21

ggccatatga ataattttgt ttaactttaa gaaggagata taatgagtac caagatggat 60

tttg 64

<210> 22

<211> 32

<212> DNA

<213> Artificial sequence

<400> 22

cgcggatcct tacgcattag cctgctgttt gg 32

<210> 23

<211> 67

<212> DNA

<213> Artificial sequence

<400> 23

gcggatccaa cttaataatt ttgtttaact ttaagaagga gatataatga cggatcgtct 60

gaaaggc 67

<210> 24

<211> 30

<212> DNA

<213> Artificial sequence

<400> 24

ccgctcgagt tactgggcgg tatagccgcc 30

Claims

1. A method for synthesizing esomeprazole by an enzymatic method is characterized by comprising the following specific operation steps:

(1) reacting 2-mercapto-5-methoxybenzimidazole and 2-chloromethyl-3, 5-dimethyl-4-methoxypyridine hydrochloride in the presence of a base in a solvent, wherein the solvent further comprises water, and adjusting the pH value of the material to 6-9 after the reaction;

(2) mixing the material, the monooxygenase, the auxiliary component and the water phase solvent, and reacting with an oxidant to generate esomeprazole;

in the step (1), the mass ratio of the solvent to the reaction raw materials is below 2.5: 1; the reaction temperature is 40-75 ℃; the reaction time is 1-3 h;

in the step (2), the monooxygenase is cyclohexanone monooxygenase; the amino acid sequence of the cyclohexanone monooxygenase is SEQ ID NO.2, SEQ ID NO.4 or SEQ ID NO. 6; the auxiliary component at least comprises reduced coenzyme; or, the accessory component comprises at least an oxidized coenzyme, a dehydrogenase and a dehydrogenase-corresponding substrate; the reduced coenzyme is NADPH and/or NADH; the oxidized coenzyme is NADP + and/or NAD +; the dehydrogenase is a ketoreductase; the amino acid sequence of the ketoreductase is SEQ ID NO.8, SEQ ID NO.10 or SEQ ID NO. 12; alternatively, the ketoreductase is ES-KRED-104 or KRED-127; the mass ratio of the reduced coenzyme to the total solvent is 0.1-1.5 g/kg; the mass ratio of the oxidized coenzyme to the total solvent is 0.08-0.12 g/kg; the water phase solvent is phosphate buffer solution or Tris-HCl buffer solution; the oxidant is oxygen.

2. The method of claim 1, wherein in step 1, the solvent comprises one or more of benzene, toluene, an alcohol, an ether, a halogenated hydrocarbon, an ester, and dimethyl sulfoxide; the alcohol is selected from the group consisting of methanol, ethanol, propanol, isopropanol, and butanol, the halogenated hydrocarbon is selected from the group consisting of dichloromethane, chloroform, and carbon tetrachloride, the ether is selected from the group consisting of diethyl ether, methyl tert-butyl ether, tetrahydrofuran, and 2-methyl tetrahydrofuran, and the ester is selected from the group consisting of ethyl acetate and isopropyl acetate.

3. The method according to claim 2, wherein the solvent is toluene, isopropanol and water, and the mass ratio of toluene, isopropanol and water is (5-20): (1-3): (1-2).

4. The method according to claim 3, wherein the mass ratio of toluene, isopropanol and water is (5-7): (1-3): (1-2).

5. The method of claim 1, wherein the mass ratio of the solvent to the reaction starting materials is 1.1:1 or less.

6. The method of claim 1, wherein in step (1), the temperature of the reaction is 48-72 ℃;

and/or, in the step (1), the reaction time is 2-3 h;

and/or, in the step (1), the pH value of the material is 7.5-8.

7. The method of claim 1, wherein in step (2), the nucleotide sequence of cyclohexanone monooxygenase is SEQ ID No.1, SEQ ID No.3, or SEQ ID No. 5.

8. The method of claim 1, wherein in step (2) the ketoreductase has the nucleotide sequence of SEQ ID No.7, SEQ ID No.9 or SEQ ID No. 11.

9. The method of claim 1, wherein in step (2), the aqueous phase solvent has a pH of 7 to 10;

and/or the mass ratio of the aqueous phase solvent to the solvent in the step (1) is (1-5.6): 1.

10. The method of claim 9, wherein in step (2), the aqueous phase solvent has a pH of 8 to 9.

11. The method of claim 1, wherein in step (2), a phase transfer catalyst is added, wherein the phase transfer catalyst is tetrabutylammonium bromide; the mass ratio of the phase transfer catalyst to the total solvent is (0.5-6) g/kg;

and/or, in the step (2), the temperature of the reaction is 18-32 ℃.

12. The method of claim 11, wherein in step (2), the mass ratio of the phase transfer catalyst to the total solvent is (0.9 to 6) g/kg.

13. The method of claim 11, wherein in step (2), the temperature of the reaction is 23-32 ℃.