CN108251376B

CN108251376B - Artificial antigen presenting cell, construction method thereof and application thereof in chimeric antigen receptor T cell amplification

Info

Publication number: CN108251376B
Application number: CN201711390193.6A
Authority: CN
Inventors: 王文举; 侯宗柳; 肖本山; 刘师节; 孟明耀; 唐维伟; 高慧; 赵旖旖; 解燕华; 李琳; 杨利蓉
Original assignee: Individual
Current assignee: Yanan Hospital of Kunming City
Priority date: 2017-12-21
Filing date: 2017-12-21
Publication date: 2021-08-13
Anticipated expiration: 2037-12-21
Also published as: CN108251376A

Abstract

The invention relates to an artificial antigen presenting cell, a construction method thereof and application thereof in chimeric antigen receptor T cell amplification, belonging to the technical field of medical treatment. The invention uses K562 cells as a vector, stably expresses CD137L, CD86, CD64, and membrane-fixed interleukin 15 and CD19 on the surface of a cell membrane through lentivirus transfection, constructs novel artificial antigen-presenting CD137L CD86 CD64 mIL-15CD 19-K562 cells, uses the cells as expanded feeder cells, and directly expands CD19 CAR-T cells from peripheral blood lymphocytes. Flow cytometric sorting indicated that the established aAPC surface molecular signature was constructed. The constructed aAPC amplified CD19 CAR-T cell has good proliferation, high purity, strong cytotoxicity and obvious tumor cell killing effect.

Description

Artificial antigen presenting cell, construction method thereof and application thereof in chimeric antigen receptor T cell amplification

Technical Field

The invention belongs to the technical field of medical treatment, and particularly relates to an artificial antigen presenting cell, a construction method thereof and application thereof in chimeric antigen receptor T cell amplification.

Background

T lymphocyte is natural enemy of tumor cell, plays a main role in tumor immune response, and has extremely strong killing effect on tumor cell. However, due to an immune escape mechanism formed by the tumor cells for a long time, the tumor cells can successfully avoid the attack of T cells, and the tumor can be rapidly proliferated. The scFv for recognizing tumor-associated antigen and an intracellular signal domain, namely an immunoreceptor tyrosine activation motif, are subjected to in vitro gene recombination to generate a recombinant plasmid, the recombinant plasmid is transfected into T cells of a patient in vitro through a transfection technology to enable the T cells of the patient to express tumor antigen receptors, and the transfected T cells are subjected to purification and large-scale amplification and are called chimeric antigen receptor T cell (CAR-T cell) therapy. In recent years, CAR-modified T cell technology has shown good antitumor effects in the treatment of malignant tumors such as leukemia, lymphoma, melanoma, brain glioma, and the like.

Although chimeric antigen receptor T cell (CAR-T cell) therapy has good anti-tumor effect and huge application prospect, the cytotoxic T lymphocyte recombined in vitro is only a small population and is difficult to meet huge clinical requirements. To solve this problem, it is necessary to ensure the effective supply of recombinant cytotoxic T lymphocytes in quantity, and therefore, the search for various effective methods for in vitro expansion of cytotoxic T lymphocytes (Exvivo expansion) has become an important trend in the development of chimeric antigen receptor T cell therapy.

The in vitro expansion of cytotoxic T lymphocytes by using artificial antigen presenting cells (aAPC) as feeder cells (feeder cells) has become an important method for the expansion of cytotoxic T lymphocytes. In the past, researchers used mIL21 and CD137L transformed k562 cells to expand T cells, and this method can obtain T cells with higher cytotoxicity, but the cell proliferation is limited, and the cells can not proliferate after 2 weeks. Therefore, how to overcome the defects of the prior art is a problem which needs to be solved in the medical technical field at present.

Disclosure of Invention

The invention aims to overcome the defects of the prior art and provides an artificial antigen presenting cell, a construction method thereof and application thereof in chimeric antigen receptor T cell amplification. The surface of the antigen presenting cell constructed by the method carries 5 surface molecules of CD137L, C D86, CD64, mIL-15 and CD19, so that the T cell specifically expressed by the CD19 is effectively obtained by in vitro amplification, the T cell can be well proliferated in the later period, and the antigen presenting cell has a strong tumor killing effect, and provides a new methodology and material basis for biological treatment.

In order to achieve the purpose, the technical scheme adopted by the invention is as follows:

an artificial antigen presenting cell, wherein the artificial antigen presenting cell is CD137L CD86 CD64 mIL-15CD19-aAPC, and the cell membrane surface stably expresses CD137L, CD86, CD64, membrane fixed interleukin 15 and CD 19.

Further, preferably, the artificial antigen presenting cell is a CD137L CD86 CD64 mIL-15CD 19-K562 cell.

The invention also provides a construction method of the artificial antigen presenting cell, which comprises the following steps:

(1) respectively constructing lentivirus expression vectors containing CD137L, CD86, CD64, mIL-15 and CD 19;

(2) transfecting a lentivirus expression vector containing CD137L into corresponding cells, selecting single cells for cloning, and performing flow cell sorting to obtain cells CD137L-aAPC stably expressed by CD 137L;

(3) introducing CD86 by transfecting a lentivirus expression vector containing CD86 on the basis of the CD137L-aAPC obtained in the step (2), selecting single cell cloning, carrying out flow cell sorting, and establishing CD137L CD 86-aAPC;

(4) introducing CD64 by transfecting a lentivirus expression vector containing CD64 on the basis of the CD137L CD86-aAPC obtained in the step (3), selecting single cell clone, carrying out flow cell sorting, and establishing CD137L CD86 CD 64-aAPC;

(5) introducing mIL-15 by transfecting a lentivirus expression vector containing mIL-15 on the basis of the CD137L CD86 CD64-aAPC obtained in the step (4), selecting single cell cloning, carrying out flow cell sorting, and establishing CD137L CD86 CD64 mIL-15-aAPC;

(6) introducing CD19 by transfecting an expression vector containing CD19 lentivirus on the basis of CD137L CD86 CD64 mIL-15-aAPC obtained in the step (5), picking single cell clone, sorting by flow cytometry, and establishing CD137L CD86 CD64 mIL-15CD 19-aAPC.

Further, it is preferable that the corresponding cells described in the step (2) are K562 cells, but not limited thereto.

The invention also provides application of the artificial antigen presenting cell in CD19-CAR T cell expansion.

In addition, the invention provides a method for expanding CD19-CAR T cells, which utilizes the artificial antigen presenting cells to expand, and comprises the following steps:

(1) preparing human peripheral blood mononuclear lymphocytes with a cell concentration of 10⁶cells/ml；

(2) According to 1 × 10⁶cells/ml human peripheral blood mononuclear lymphocyte cell seed in culture plate, placed at 37 deg.C, 5% CO₂Incubating for 2h in an incubator to obtain cell suspension; wherein the culture medium in the culture plate is RPMI 1640 culture medium containing 10% fetal bovine serum by volume percentage concentration;

(3) adding PB-19CAR-puro into a lonza nuclear transfection reagent preheated to 37 ℃ until the final concentration is 0.1ug/ul and Super PiggyBac transfection reagent is 0.05ug/ul, uniformly mixing, and then adding the cell suspension obtained by incubation in the step (2) into the mixture according to the volume ratio of 1:1 to obtain a mixed solution;

(4) performing electric transformation on the mixed solution obtained in the step (3) by using a U-014 program of a lonza electric transducer, adding RPMI 1640 culture medium containing 10% fetal calf serum by volume percentage, which is preheated to 37 ℃, into the mixed solution according to the volume ratio of 2:1, transferring the cells into a culture plate, and incubating the cells in an incubator at 37 ℃ for 2 hours;

(5) transferring the cells into a centrifuge tube after the incubation is finished, centrifuging, discarding supernatant, and then re-suspending the cells to 10% by volume by using RPMI 1640 culture medium containing 10% fetal calf serum⁶Placing cell suspension in a culture plate, and placing in an incubator at 37 ℃ overnight to obtain the electro-transformed CAR-T cells;

(6) the following day CD137L CD86 CD64 mIL-15CD19-aAPC cells were irradiated with 100 Gy; adding the irradiated CD137L CD86 CD64 mIL-15CD19-aAPC cells into the electro-transformed CAR-T cells obtained in the step (5) in a number ratio of 1:2, and then adding IL-21 to a final concentration of 30ng/ml and IL-2 to a final concentration of 300 IU/ml; repeatedly stimulating CD19 CAR-T cells by CD137L CD86 CD64 mIL-15CD19-aAPC at the 7 th day, 14 th day and 28 th day of culture at the ratio of cell number of 1:2, and simultaneously adding 30ng/ml of IL-21 and 300IU/ml of IL-2; culture was continued for 28 days to obtain sufficient amounts of CD19-CAR-T cells.

Further, it is preferable that the medium used in the step (2) is a preheated medium, and the preheating temperature is 37 ℃.

Further, it is preferable that the centrifugation parameter in the step (5) is 140g and the centrifugation time is 8 min.

The CAR-T cells stimulated by the feeder cells have the advantages of good proliferation, high purity, strong cytotoxicity and obvious tumor cell killing effect. The method comprises the following steps: after being stimulated by artificial antigen presenting cells of stably expressing CD137L, CD86, CD64, membrane fixed interleukin 15(mIL-15) and CD19 on cell membranes, the CD19 CAR-T cells obtained by directly amplifying the cells from peripheral lymphocytes have good cell proliferation, high purity, strong cytotoxicity and obvious tumor cell killing effect.

The obtained CD19-CAR T cells were expanded and co-cultured with K562 cells, Raji cells (lymphoma cell line), and cytotoxicity was detected using EuTDA cytotoxicity kit (cat # AD 0116).

Compared with the prior art, the invention has the beneficial effects that:

the invention establishes a high-efficiency and high-cytotoxicity CAR-T lymphocyte in-vitro amplification method by using cellsThe membrane surface stably expresses CD137L, CD86, CD64, mIL-15 and CD19, and a novel artificial antigen presenting cell CD137L CD86 CD64 mIL-15CD19-aAPC is constructed, such as CD137L CD86 CD64 mIL-15CD 19-K562 cell, so that the cell is used as an expanded feeder cell to directly expand specific CD19 CAR-T cells. Flow cytometry analysis, cytotoxicity test and the like show that the amplified specific T lymphocyte has high purity and strong cytotoxicity and has obvious tumor cell killing effect. The CD19 CAR-T cell expansion method provided by the invention is simple and easy to operate; the amplification efficiency is good and can be increased by 10⁴The magnitude order is increased, and the cell state is good; the amplification duration is long, the amplification period can reach 28 days, and the tumor cell killing effect is obvious (FIG. 28 shows that CD19 CAR-T cells have obvious killing effect on human erythroleukemia cell lines, and FIG. 29 shows that CD19 CAR-T cells have obvious killing effect on lymphoma cells).

Drawings

FIG. 1 shows the expression of CD137L in CD137L CD86 CD64 mIL-15CD 19-K562 artificial antigen presenting cells. The control pattern of the second CD137L is seen to express and express higher amount.

FIG. 2 shows the expression of the CD137L isotype control in CD137L CD86 CD64 mIL-15CD 19-K562 artificial antigen presenting cells.

FIG. 3 shows the expression of CD86 in CD137L CD86 CD64 mIL-15CD 19-K562 artificial antigen presenting cells. The control chart shows that the tetrad CD86 isotype control expresses and expresses in higher quantity.

FIG. 4 shows the expression of the CD86 isotype control in CD137L CD86 CD64 mIL-15CD 19-K562 artificial antigen presenting cells.

FIG. 5 shows the expression of CD64 in CD137L CD86 CD64 mIL-15CD 19-K562 artificial antigen presenting cells. The hexacd 64 isotype control was seen to express and expressed in higher amounts compared to the figure.

FIG. 6 shows the expression of the CD64 isotype control in CD137L CD86 CD64 mIL-15CD 19-K562 artificial antigen presenting cells.

FIG. 7 shows mIL-15 expression in CD137L CD86 CD64 mIL-15CD 19-K562 artificial antigen presenting cells. The eight mIL-15 isotype control can be seen to express and express a higher amount.

FIG. 8 is the expression of mIL-15 isotype control in CD137L CD86 CD64 mIL-15CD 19-K562 artificial antigen presenting cells.

FIG. 9 shows the expression of CD19 in CD137L CD86 CD64 mIL-15CD 19-K562 artificial antigen presenting cells. The cross CD19 isotype control can be seen to express and express a higher amount.

FIG. 10 shows the expression of the CD19 isotype control in CD137L CD86 CD64 mIL-15CD 19-K562 artificial antigen presenting cells.

FIG. 11 is the cell proliferation status at day 1 after stimulation of CD19 CAR-T cells by CD137L CD86 CD64 mIL-15CD 19-K562 artificial antigen presenting cells.

Figure 12 is the cell proliferation status at day 1 after CD19 CAR-T cells without aAPC stimulation.

FIG. 13 is the cell proliferation status at day 7 after stimulation of CD19 CAR-T cells by CD137L CD86 CD64 mIL-15CD 19-K562 artificial antigen presenting cells.

FIG. 14 is the day 7 cell proliferation status of CD19 CAR-T cells without aAPC stimulation.

FIG. 15 shows the cell proliferation status of CAR-T cells at day 14, stimulated by CD137L CD86 CD64 mIL-15CD 19-K562 artificial antigen presenting cells.

FIG. 16 is the cell proliferation status of CD19 CAR-T cells at day 14 without aAPC stimulation.

FIG. 17 is the CD137L CD86 CD64 mIL-15CD 19-K562 artificial antigen presenting cell stimulated CAR-T cell proliferation status at day 28.

FIG. 18 is the cell proliferation status of CD19 CAR-T cells at day 28 without aAPC stimulation.

FIG. 19 is the cell number of CD 19-specific CAR-T cells expanded by CD137L CD86 CD64 mIL-15CD 19-K562 artificial antigen presenting cells (W represents the number of expansion weeks).

FIG. 20 is the expression of CD19-CAR 28 days after CD19 CAR-T cell expansion co-cultured with the addition of aAPCs.

FIG. 21 shows the expression of CD19-CAR 28 days after the cells were expanded by the CD19 CAR-T control group co-cultured with the addition of feeder cells.

FIG. 22 is the expression of CD19-CAR 28 days after expansion of CD19 CAR-T cells without added aAPC.

FIG. 23 shows the expression of CD62L, CD45RO after 28 days of expansion of CD19 CAR-T cells with added aAPC.

FIG. 24 shows isotype control expression levels of CD62L, CD45RO after 28 days of CD19 CAR-T cell expansion with added aAPC.

FIG. 25 shows the expression levels of CD62L and CD45RO after 28 days of expansion of CD19 CAR-T cells added to feeder cells.

FIG. 26 shows isotype control expression levels of CD62L and CD45RO after 28 days of CD19 CAR-T cell expansion with feeder cells.

FIG. 27 shows the expression levels of CD62L, CD45RO after 28 days of expansion of CD19 CAR-T cells without added aAPC.

FIG. 28 shows the EuTDA release assay of human erythroleukemia cell line (K562) cells co-cultured with CD19-CAR T cells after feeder stimulation (round), CD19-CAR T cells after 14 days stimulation (square), and CD19-CAR T cells after 21 days stimulation (triangle) at 1:16, 1:4, and 1:1, respectively.

FIG. 29 shows the EuTDA release assay of lymphoma cells (Raji) co-cultured with CD19-CAR T cells (red) after feeder stimulation, CD19-CAR T cells (green) after 14 days stimulation, and CD19-CAR T cells (triangle) after 21 days stimulation, respectively, at 1:16, 1:4, and 1: 1.

Detailed Description

The following will explain in detail the specific embodiments of the preparation method of CD137L CD86 CD64 mIL-15CD 19-K562 and the CD19 CAR-T cell expansion method provided by the present invention with reference to the attached drawings. The following description is only exemplary of the present invention, and is not intended to limit the present invention in any way, and those skilled in the art may modify the present invention by applying the teachings set forth above in a manner equivalent to the above-described modifications. Without departing from the scope of the invention, any simple modifications or equivalent changes made to the above examples in accordance with the technical essence of the invention, such as replacing K562 cells with other types of cells 721.221 cells, etc., achieving expression of CD86, CD64, mIL-15, CD19 on the cell membrane surface in other ways, modifying the amplification conditions and procedures, stimulating different CAR-T cells with artificial antigen-presenting cells constructed with different surface molecules, etc., should also be considered as the scope of the invention.

It will be appreciated by those skilled in the art that the following examples are illustrative of the invention only and should not be taken as limiting the scope of the invention. The examples do not specify particular techniques or conditions, and are performed according to the techniques or conditions described in the literature in the art or according to the product specifications. The materials or equipment used are not indicated by manufacturers, and all are conventional products available by purchase.

The percentage numbers represent volume percentages unless otherwise indicated herein.

Example 1 construction of an Artificial antigen presenting cell CD137L CD86 CD64 mIL-15CD 19-K562

1. Obtaining the target sequence fragment by PCR method

1) From a plasmid cloning template (stored by Shanghai Jima pharmaceutical technology Co., Ltd.) containing the CD137L gene, the CD137L gene is obtained by Polymerase Chain Reaction (PCR) method, and the CD86, CD64 and mIL-15 genes are obtained by whole gene synthesis method.

2) Designing primers, adding NotI and BamHI flanking homologous sequences on LV6 vector to the upstream and downstream primers of the target gene respectively, and using the primers for subcloning the vector, wherein the primer sequences of CD137L, CD86, CD64 and mIL-15 genes are respectively as follows: the primer sequences of the CD137L gene are shown in Table 1.

TABLE 1

NM_003811.3 CEF	agggttccaagcttaagcggccgcgccaccatggaatacgcctctgacgcttca	SEQ ID NO.1
			NM_003811.3 CER	atcagtagagagtgtcggatccttattccgacctcggtgaaggga	SEQ ID NO.2

The primer sequences of the CD64 gene are shown in Table 2.

TABLE 2

The primer sequences of the CD86 gene are shown in Table 3.

TABLE 3

The primer sequences of the m-IL15 gene are shown in Table 4.

TABLE 4

m-IL15-1	agggttccaagcttaagcggccgcgccaccatggccttaccagtgaccg	SEQ ID NO.83
			m-IL15-2	tggagcagcaaggccagcggcaggagcaaggcggtcactggtaaggccat	SEQ ID NO.84
m-IL15-3	ctggccttgctgctccacgccgccaggccgaactgggtgaatgtaataag	SEQ ID NO.85
			m-IL15-4	ttgaataagatcttcaatttttttcaaatcacttattacattcacccagttcgg	SEQ ID NO.86
m-IL15-5	tgatttgaaaaaaattgaagatcttattcaatctatgcatattgatgctactttatatacg	SEQ ID NO.87
			m-IL15-6	actggggtgaacatcactttccgtatataaagtagcatcaatatgcataga	SEQ ID NO.88
m-IL15-7	gaaagtgatgttcaccccagttgcaaagtaacagcaatgaagtgctttct	SEQ ID NO.89
			m-IL15-8	tcaagtgaaataacttgtaactccaagagaaagcacttcattgctgttac	SEQ ID NO.90
m-IL15-9	ttggagttacaagttatttcacttgagtccggagatgcaagtattcatga	SEQ ID NO.91
			m-IL15-10	tgctaggatgatcagattttctactgtatcatgaatacttgcatctccgg	SEQ ID NO.92
m-IL15-11	agtagaaaatctgatcatcctagcaaacaacagtttgtcttctaatggga	SEQ ID NO.93
			m-IL15-12	ttctttgcatccagattctgttacattcccattagaagacaaactgttgt	SEQ ID NO.94
m-IL15-13	gtaacagaatctggatgcaaagaatgtgaggaactggaggaaaaaaatat	SEQ ID NO.95
			m-IL15-14	tatgtacaaaactctgcaaaaattctttaatatttttttcctccagttcctcac	SEQ ID NO.96
m-IL15-15	taaagaatttttgcagagttttgtacatattgtccaaatgttcatcaacacttc	SEQ ID NO.97
			m-IL15-16	tggtcgcggcgctggcgtcgtggtagaagtgttgatgaacatttggacaa	SEQ ID NO.98
m-IL15-17	cagcgccgcgaccaccaacaccggcgcccaccatcgcgtcgcagcccctg	SEQ ID NO.99
			m-IL15-18	cccgccgctggccggcacgcctctgggcgcagggacaggggctgcgacgc	SEQ ID NO.100
m-IL15-19	cggccagcggcggggggcgcagtgcacacgagggggctggacttcgcctg	SEQ ID NO.101
			m-IL15-20	gtcccggccaagggcgcccagatgtagatatcacaggcgaagtccagccc	SEQ ID NO.102
m-IL15-21	gcccttggccgggacttgtggggtccttctcctgtcactggttatcacct	SEQ ID NO.103
			m-IL15-22	atcagtagagagtgtcggatccttaggtgataaccagtgacagga	SEQ ID NO.104

The primer sequences of the CD19 gene are shown in Table 5.

TABLE 5

NM-001178098.1-1	atgccacctcctcgcctcctcttcttcctcctcttcctcaccc	SEQ ID NO.105
			NM-001178098.1-2	agaggttcctcgggcctgacttccatgggggtgaggaagagga	SEQ ID NO.106
NM-001178098.1-3	gcccgaggaacctctagtggtgaaggtggaagagggagataac	SEQ ID NO.107
			NM-001178098.1-4	aggtccccttgaggcactgcagcacagcgttatctccctcttc	SEQ ID NO.108
NM-001178098.1-5	gcctcaaggggacctcagatggccccactcagcagctgacctg	SEQ ID NO.109
			NM-001178098.1-6	gaagggtttaagcggggactcccgagaccaggtcagctgctga	SEQ ID NO.110
NM-001178098.1-7	ccgcttaaacccttcttaaaactcagcctggggctgccaggcc	SEQ ID NO.111
			NM-001178098.1-8	atggccaggggcctcatgaggattcccaggcctggcagcccca	SEQ ID NO.112
NM-001178098.1-9	gaggcccctggccatctggcttttcatcttcaacgtctctcaa	SEQ ID NO.113
			NM-001178098.1-10	gctggcacaggtagaagccccccatctgttgagagacgttgaa	SEQ ID NO.114
NM-001178098.1-11	tctacctgtgccagccggggcccccctctgagaaggcctggca	SEQ ID NO.115
			NM-001178098.1-12	gccctccacattgactgtccagccaggctgccaggccttctca	SEQ ID NO.116
NM-001178098.1-13	gtcaatgtggagggcagcggggagctgttccggtggaatgttt	SEQ ID NO.117
			NM-001178098.1-14	aggccacagcccaggccacctaggtccgaaacattccaccgga	SEQ ID NO.118
NM-001178098.1-15	cctgggctgtggcctgaagaacaggtcctcagagggccccagc	SEQ ID NO.119
			NM-001178098.1-16	tggggctcatgagcttcccggaaggggagctggggccctctga	SEQ ID NO.120
NM-001178098.1-17	agctcatgagccccaagctgtatgtgtgggccaaagaccgccc	SEQ ID NO.121
			NM-001178098.1-18	acacggaggctctccctcccagatctcagggcggtctttggcc	SEQ ID NO.122
NM-001178098.1-19	ggagagcctccgtgtctcccaccgagggacagcctgaaccaga	SEQ ID NO.123

3) The above oligo was synthesized by Shanghai Jima pharmaceutical technology, Inc.

4) Dissolving the primers into 50 mu M, taking the primers with the same volume to a 1.5ml centrifuge tube respectively, and fully and uniformly mixing to prepare the primers mix.

5) A first PCR run was performed using the formulated oligo mix, the PCR system is shown in Table 5.

TABLE 5

The cycling conditions are shown in table 6.

TABLE 6

6) A second PCR reaction was performed using a Forward primer and Reverse primer, the template being the product of the first PCR reaction.

The PCR system is shown in Table 7.

TABLE 7

First round PCR product	1μl
			10 Xpfu Buffer (Mg addition)²⁺)	5μl
dNTP	1μl
		Forward primer (odd numbered mantissa is singular number mark)	1μl
reverse primer (mantissa of label is double number label)	1μl
		ddH₂O	41μl
Pfu DNA polymerase	0.3μl

The reaction conditions were the same as in the first run.

7) After the PCR reaction, the CD137L, CD86, CD64 and mIL-15 or CD19 gene fragments were recovered by Agarose electrophoresis and gel cutting.

8) After obtaining the first gene fragment, the same method is used to obtain the next gene fragment, and finally 5 genes comprising CD137L, CD86, CD64, mIL-15 and CD19 are obtained.

2. Cloning the target gene into the vector LV6

1) The double digestion was carried out with NotI and BamHI dicer to LV6 for 2h at 37 ℃ in the reaction system shown in Table 8.

TABLE 8

10×Buffer	5μl
		DNA	15μl
NotI	1μl
		BamHI	1μl
ddH₂O	28μl

2) Agarose electrophoresis, and recovery of the vector using a DNA gel recovery kit.

3) By using

The amplified fragment was cloned into linearized LV6 vector using the Entry One Step Cloning Kit, and the reaction system is shown in Table 9 below.

TABLE 9

5×CE Entry Buffer	4μl
		LV6	1μl
Objective gene	2μl
		Exnase Entry	2μl
ddH₂O	11μl

Gently blowing and beating by using a pipettor, and uniformly mixing the components. The reaction mixture was left at 37 ℃ for 30 minutes. After 30 minutes the EP tube was rapidly placed on ice water and cooled for 5 minutes to obtain recombinant ligation product. After each recombinant plasmid was obtained, the next plasmid was recombined in the same manner until a recombinant plasmid containing 5 genes of CD137L, CD86, CD64, mIL-15 and CD19 was finally obtained.

3. Preparation of competent cells:

1) single colonies of positive transformed DH 5. alpha. were picked from fresh plates cultured at 37 ℃ for 16 hours and transferred to a 1L flask containing 100ml LB medium. Shake culture at 37 ℃ for 3 h.

2) The bacteria were transferred aseptically to a sterile, single-use, ice-chilled (0 ℃ pre-chilled) 50ml polypropylene tube and cooled on ice for 10 minutes to cool the culture to 0 ℃.

3) Centrifuging at 4 deg.C for 10min at 4000rpm, and discarding the upper layer liquid.

4) The tube was inverted for 1 minute to allow the remaining small volume of broth to drain as far as possible.

5) 10ml of 0.1mol/L CaCl precooled with ice (precooled to 0 ℃)₂Resuspend the cell pellet in polypropylene tube, place on ice after resuspension is uniform.

6) Centrifuging at 4 deg.C for 10min at 4000rpm, and discarding the upper layer liquid.

7) The collected bacterial pellets were centrifuged again at 4000rpm at 4 ℃ for 10min, and after the centrifugation was completed, the supernatant liquid was discarded.

8) 4ml of 0.1mol/L CaCl precooled with ice (precooled to 0 ℃ C.)₂(containing 20% by volume of glycerol) resuspend each cell to obtain competent cells.

9) Cells were divided into small aliquots (100. mu.l/piece) and stored at-80 ℃.

4. Transformation of competent cells after ligation of target Gene and vector

1) The competent cells (containing 100. mu.l of the competent cells prepared in the above step) were removed from-80 ℃ and thawed on ice, after the competent cells had thawed, 10. mu.l of the recombinant ligation product was added, gently mixed with a pipette tip, and placed on ice for 30 min.

2) The EP tube is placed on a suspension rack placed in a water bath kettle preheated to 42 ℃ and placed for 90 seconds.

3) And (4) rapidly transferring the EP pipe into an ice bath, and rapidly cooling the EP pipe for 3 min.

4) Adding 800 μ l LB culture medium into each EP tube, transferring the EP tube to a shaker at 37 deg.C, rotating at 250 rpm, and incubating for 45min to recover 100 μ l transformed bacteria in the EP tube to obtain bacteria recovering culture.

5) 200. mu.l of the bacterial recovery culture was applied evenly to LB plates containing 50. mu.g/ml Ampicillin.

6) After the liquid on the plate was absorbed, the plate was inverted and incubated at 37 ℃ for 16 hours in an incubator.

7) After 16 hours, recombinant colonies were able to grow on the plates. Single recombinant colonies were picked from the plates, plasmids were mini-extracted and identified to pick out positive clones.

8) 4 individual, filled colonies were picked from the cultured plates and placed in tubes containing 5ml (50. mu.g/ml Ampi cullin) LB medium.

9) The test tubes were incubated in a shaker at 37 ℃ and 250 rpm for 16 hours.

10) And extracting plasmids from the cultured bacterial liquid by using a plasmid miniprep kit (DP 104-02) (the plasmid extraction steps are detailed in the specification of the plasmid miniprep kit).

11) The extracted plasmid was identified by double digestion, and the reaction system of each tube is shown in table 10 below.

Watch 10

10×Buffer	1μl
		Plasmids	1μl
NotI	0.5μl
		BamHI	0.5μl
ddH₂O	7μl

12) Carrying out enzyme digestion at 37 ℃ for 1 hour, carrying out electrophoresis, and obtaining a clone corresponding to the band obtained by enzyme digestion in a region corresponding to the size of the target band, namely a positive clone. (the band position is the length of the corresponding nucleotide of the target gene)

5. And (4) sequencing and verifying the recombinant plasmid and extracting in a large quantity.

1) 200 mul of bacterial liquid corresponding to the positive clone was sequenced and the remaining bacterial liquid was preserved with glycerol.

2) And (3) after the sequencing result shows that the target gene is consistent with the target gene, inoculating the preserved glycerol bacterial liquid into an LB culture medium, and extracting a large amount of plasmids to obtain a sufficient amount of recombinant plasmids.

3) The slow virus packaging plasmid (P Helper) is prepared by using an Axygen plasmid mass extraction kit (AP-MN-P-500).

4) At this point, the vector construction experiment was completed.

6. Recombinant lentivirus packaging carrying a gene of interest

And (3) transfecting 293T cells with the amplified recombinant plasmid, and packaging the recombinant lentivirus. The experimental procedure is described in this section by taking the CD137L recombinant plasmid as an example, and the packaging of the remaining four recombinant plasmids is the same and will not be repeated here.

1)293T cells were cultured in a 10cm dish to 80-90% confluency at a concentration of 5000 cells/cm²15cm petri dishes were inoculated.

2) The culture medium was decanted and the cells were washed twice with 1ml of D-Hank's solution.

3) Adding 1ml of Trypsin-EDTA solution, mixing uniformly, and standing at 37 ℃ for 2-3 minutes.

4) Trypsin-EDTA solution was carefully aspirated, 2ml of DMEM medium containing 10% FBS was added, and the cells were blown up to form a single cell suspension.

5) Inoculating the single cell suspension into another 15cm culture dish, adding 18ml DMEM culture solution containing 10% FBS, mixing well, and 5% CO at 37 deg.C₂The culture was carried out overnight.

6) Adding 1.5ml of serum-free DMEM into one sterile 5ml centrifuge tube, adding the recombinant plasmid CD137L and the packaging plasmid according to the mass ratio of 1:1, uniformly mixing, adding 1.5ml of serum-free DMEM into the other sterile 5ml centrifuge tube, adding 300 mu l of RNAi-mate, uniformly mixing, standing at room temperature for 5 minutes, mixing the two tubes, and standing at room temperature for 20-25 minutes to obtain a transfection mixture.

7) The culture solution in the 15cm dish of step 5) was removed, and 8ml of serum-free DMEM medium was added.

8) The transfection mixture was added dropwise to a 15cm petri dish, the dish was gently shaken back and forth to mix the complex, 5% CO at 37 deg.C₂Incubate in incubator for 4-6 hours.

9) The cell culture supernatant was aspirated off, and 18ml of DMEM medium containing 10% FBS was added. The culture was continued at 37 ℃ for 72 hours in 5% CO2 to obtain a large amount of recombinant plasmid-containing lentiviral vectors.

10)10) similarly, packaging the remaining four recombinant plasmids according to the operation steps to finally obtain the recombinant plasmid containing 5 target genes.

7. Recombinant lentivirus Collection

1) Take the Petri dish from the step of part 6, part 9) for 72 hours, and aspirate the supernatant from the Petri dish into a 50ml centrifuge tube, and centrifuge at 4000rpm for 4min at 4 ℃.

2) After centrifugation, the tube supernatant was poured into a 50ml syringe and filtered through a 0.45um filter membrane.

3) The filtrate was ultracentrifuged in a centrifuge at 4 ℃ and 20000rpm for 2 h.

4) And collecting supernatant after ultracentrifugation and subpackaging the supernatant into an EP tube to obtain the purified lentivirus expression vector containing the target gene. Subpackaging, labeling, and storing in a refrigerator at-80 deg.C.

8. Slow virus expression vector infection carrier cell K562 containing target gene

1) The lentiviral expression vector containing the target gene and polybrene were taken out from a refrigerator at-80 ℃ and placed on ice to be melted.

2) The K562 cells were transferred from the culture flask into a 50ml centrifuge tube and centrifuged at 800rpm for 5 minutes.

3) After centrifugation, the culture supernatant is discarded, and 1640 complete culture medium is added to blow and beat the resuspended cells.

4) Viable cells were counted using a cell counting plate.

5) Diluting the cell suspension to a cell density of 1X 10⁵Cells per ml.

6) 1ml of cells were plated in 24-well plates to ensure 1X 10 in 1ml of cell suspension⁵And (4) cells.

7) 100ul of 1X 10 aspirates were performed based on the MOI value of 100 for the reference cell transfection⁸Tu/ml lentiviral expression vectors were added to 24-well plates.

8) 8ug of polybrene was added to each well to increase transfection efficiency.

9) Centrifugation was carried out at a centrifugal force of 3000g for 2 hours at 25 ℃.

10) Adding 5% CO at 37 deg.C₂Culturing in an incubator.

11) Cell morphology was observed after 8 to 12 hours, and if the cell status was not significantly different from that of the uninfected cells, indicating that the lentivirus had no significant toxic effect on the cells, the culture was continued and the medium was replaced with fresh medium 24 hours after infection.

9. Immune magnetic bead sorting immune molecule expression positive cell

1) Taking K562 cells 1X 10 after infection of lentivirus in step 8) and step 11) for 72 hours⁷And (4) cells.

2) The cells were centrifuged at 1000rpm for 5 minutes and the supernatant was discarded.

3) Fresh 1640 complete medium was added again to resuspend the cells and the cell concentration was counted.

4) Get 10⁷The cells were centrifuged at 1000rpm for 5 minutes in a 15ml centrifuge tube and the supernatant discarded.

5) The cells were resuspended with 100ul magnetic bead sorting buffer and transferred to a 1.5ml EP tube.

6) 10ul of a flow antibody of the PE-labeled immune molecule was added and mixed well and incubated at 4 ℃ for 10 minutes in the dark.

7) After the incubation was complete, 1ml of magnetic bead sorting buffer was added to the EP tube.

8) The mixture was centrifuged at 300g for 10 minutes, the supernatant was discarded, and 1ml of magnetic bead sorting buffer was added again to wash it once.

9) The supernatant was discarded and the cells were resuspended using 80ul magnetic bead sorting buffer.

10) 20ul of Anti-PE immunomagnetic beads were added to the EP tube and mixed well, and incubated at 4 ℃ for 15 minutes in the dark.

11) After the incubation was complete, 1ml of magnetic bead sorting buffer was added to the EP tube.

12) The mixture was centrifuged at 300g for 10 minutes, the supernatant was discarded, and 1ml of magnetic bead sorting buffer was added again to wash it once.

13) Collection 10⁶The cells were resuspended using a buffer for sorting 500ul of magnetic beads to obtain a cell suspension.

14) The MS cell separation column was mounted on a magnetic frame and 500ul of magnetic bead sorting buffer was added to run off under gravity.

15) The cell suspension is added into an MS cell separation column to separate the cells which are not magnetically labeled.

16) The MS cell separation column was washed three times with 500ul of magnetic bead sorting buffer.

17) And taking the MS cell separation column out of the magnetic frame, placing the MS cell separation column on a 1.5ml EP tube, quickly adding 1ml magnetic bead sorting buffer to the MS cell separation column, immediately pushing a piston, and collecting and counting the magnetically labeled cells.

18) The collected magnetically labeled cells are collected, centrifuged at 300g to discard 1ml of magnetic beads for sorting buffer and the appropriate culture flask is selected for further cell culture.

10. Picking monoclonal cells

1) 1X 10 sorted cells cultured in section 9 and 18⁵And (4) respectively. 10ml of fresh 1640 complete medium was added for resuspension.

2) Centrifuge at 1000rpm for 5 minutes and discard the supernatant.

3) 10ml of fresh 1640 complete medium was added again to resuspend the cells and the cell concentration was counted.

4) According to the cell concentration, 200 cells were taken out by a limiting dilution method by 1640 complete culture into a 50ml centrifuge tube.

5) And adding 20ml of fresh 1640 complete culture medium into the centrifuge tube, and blowing and beating the cells uniformly to obtain a cell mixed solution.

6) The cell mixture was added to a 96-well plate at 100ul per well.

7) The wells looking for single cells were observed in an inverted microscope and labeled.

8) After 72 hours, the labeled wells were supplemented with 100ul of fresh 1640.

9) After 7 days, the cell population was transferred from the 96-well plate to a 24-well plate, and the cells were further expanded to establish a monoclonal cell line.

11. Flow cytometry detection of K562 cell surface immune molecule expression

1) The established monoclonal cell line was expanded to 1X 10⁷Taking 1 × 10 cells⁷And (4) collecting the single clone cells into a centrifuge tube.

2) Centrifuge at 1000rpm for 5 minutes and discard the supernatant.

3) PBS was added to resuspend the cells and count the cell concentration.

4) Get 10⁶The individual cells were transferred to a 1.5ml EP tube, centrifuged and the supernatant discarded.

5) Centrifugation and discarding of 95% ethanol, 100ul of 1% BSA in PBS was added to resuspend the cells.

6) Add 20ul of flow antibody and mix well, incubate 30 minutes at 4 ℃ in the dark.

7) After incubation, cells were washed 2 times with 1ml PBS containing 1% BSA.

8) The cells were mixed well with 500ul of sheath fluid and ready for loading.

The stable expression of the surface-constructed molecules can be seen in FIGS. 1-10.

Thus, we obtained K562 cells stably expressing CD137L by assay. With K562 cells stably expressing CD137L, CD86, CD64, mIL-15 and CD19 were similarly stably expressed using the methods of section 8-section 10. This is not repeated (it can be seen from FIGS. 1 to 10 that 5 constructed molecules are expressed in K562 cells and the expression level is higher).

12. Irradiation technology for treating artificial antigen presenting cell

1) K562 cells stably expressing CD137L, CD86, CD64, mIL-15, and CD19 were expanded and collected into centrifuge tubes.

2) Centrifuge at 1000rpm for 5 minutes and discard the supernatant.

3) PBS was added to resuspend the cells and count the cell concentration.

4) Adjusting cell concentrationDegree to 10⁶And/ml, transferring the cell suspension with the adjusted concentration into a 15ml centrifuge tube, ensuring that 10ml of cell suspension is contained in each tube, and sealing by using a sealing film.

5) The cell suspension was sent to an irradiation center (Yunnan Huayuan nuclear radiation technology Co., Ltd.) for irradiation at an irradiation dose of 100 Gy.

After irradiation, the cells are frozen by using a cell freezing medium in a conventional way and stored by using liquid nitrogen.

13. CD19 CAR-T cell expansion method

1) Preparing human peripheral blood mononuclear lymphocytes with a cell concentration of 10⁶cells/ml。

2) According to 1 × 10⁶cells/ml human peripheral blood mononuclear lymphocyte cell seed in culture plate, placed at 37 deg.C, 5% CO₂Incubating for 2h in an incubator to obtain cell suspension; wherein the culture medium in the culture plate is RPMI 1640 culture medium containing 10% BI fetal bovine serum by volume percentage concentration;

3) adding PB-19CAR-puro into a lonza nuclear transfection reagent preheated to 37 ℃ until the final concentration is 0.1ug/ul and S uper PiggyBac transfection reagent is 0.05ug/ul, uniformly mixing, and then adding the cell suspension obtained by incubation in the step (2) into the mixture according to the volume ratio of 1:1 to obtain a mixed solution;

4) electrically converting the mixed solution obtained in the step 3) by using a U-014 program of a lonza electric converter, adding an RPMI 1640 culture medium containing 10% fetal calf serum by volume percentage, which is preheated to 37 ℃, into the mixed solution according to the volume ratio of 2:1, and then transferring the cells into a culture plate to incubate for 2 hours in a 37 ℃ incubator;

5) transferring the cells into a centrifuge tube after the incubation is finished, centrifuging, discarding supernatant, and then re-suspending the cells to 10% by volume by using RPMI 1640 culture medium containing 10% fetal calf serum⁶Placing cell suspension in a culture plate, and placing in an incubator at 37 ℃ overnight to obtain the electro-transferred CAR-T cells;

6) the following day CD137L CD86 CD64 mIL-15CD19-aAPC cells were irradiated with 100 Gy; adding the irradiated CD137L CD86 CD64 mIL-15CD19-aAPC cells into the electrotransfer CAR-T cells obtained in the step 5) in a number ratio of 1:2, and then adding IL-21 to a final concentration of 30ng/ml and IL-2 to a final concentration of 300 IU/ml; repeatedly stimulating CD19 CAR-T cells by CD137L CD86 CD64 mIL-15CD19-aAPC at the culture days 7, 14 and 28 again at the ratio of the number of cells of 1:2, and simultaneously adding 30ng/ml of IL-21 and 300I U/ml of IL-2; culturing was continued for 28 days to obtain sufficient amounts of CD19-CAR-T cells (fig. 11-fig. 19 show that CD19 CAR-T cells stimulated by CD137L CD86 CD64 mIL-15CD19-aAPC were in good cell proliferation and in log-scale growth on

days

1, 7, 14, 28 compared to unstimulated CD19 CAR-T cells).

7) By constructing a novel artificial antigen presenting cell which is used as an expanded feeder cell, CD19 CAR-T lymphocyte is specifically expanded after the CD19 CAR is electrically converted from the monocyte lymphocyte through CD137L CD86 CD64 mIL-15CD 19-aAPC. The expanded CD19 CAR-T cells are high in purity and strong in cytotoxicity and have obvious tumor cell killing effect through flow cytometry analysis (FIGS. 20-27 show that surface molecules of CD19 CAR-T lymphocytes specifically stimulated by CD137L CD86 CD64 mIL-15CD19-aA PC are stably expressed at all stages of proliferation), cytotoxicity tests and the like (FIG. 28-29 show that the CD19 CAR-T cells specifically stimulated by CD137L CD86 CD64 mIL-15CD19-aAPC have strong tumor cell killing effect).

The foregoing shows and describes the general principles, essential features, and advantages of the invention. It will be understood by those skilled in the art that the present invention is not limited to the embodiments described above, which are described in the specification and illustrated only to illustrate the principle of the present invention, but that various changes and modifications may be made therein without departing from the spirit and scope of the present invention, which fall within the scope of the invention as claimed. The scope of the invention is defined by the appended claims and equivalents thereof.

Claims

1. A CD19-CAR T cell expansion method is characterized in that an artificial antigen presenting cell is adopted for expansion, and the construction method of the artificial antigen presenting cell comprises the following steps:

(6) introducing CD19 by transfecting an expression vector containing CD19 lentivirus on the basis of CD137L CD86 CD64 mIL-15-aAPC obtained in the step (5), selecting single cell clone, carrying out flow cell sorting, and establishing CD137L CD86 CD64 mIL-15CD 19-aAPC;

the CD19-CAR T cell expansion method comprises the following steps:

(3) adding PB-19CAR-puro into a lonza nuclear transfection reagent preheated to 37 ℃ until the final concentration is 0.1 mu g/mu l and Super PiggyBac transfection reagent until the final concentration is 0.05 mu g/mu l, uniformly mixing, and then adding the cell suspension obtained by incubation in the step (2) into the mixture according to the volume ratio of 1:1 to obtain a mixed solution;

2. The CD19-CAR T cell expansion method of claim 1, wherein in step (2) of the CD19-CAR T cell expansion method the corresponding cell is a K562 cell.

3. The method of expanding CD19-CAR T cells of claim 1, wherein the artificial antigen presenting cells are CD137L CD86 CD64 mIL-15CD19-aAPC, whose cell membrane surface stably expresses CD137L, CD86, CD64, membrane-fixed interleukin 15 and CD 19.

4. The method of expanding CD19-CAR T cells of claim 1, wherein the artificial antigen presenting cells are CD137L CD86 CD64 mIL-15CD 19-K562 cells.

5. The CD19-CAR T cell expansion method of claim 1, wherein in step (2) of the CD19-CAR T cell expansion method, the medium used is a pre-warmed medium at a temperature of 37 ℃.

6. The CD19-CAR T-cell expansion method of claim 1, wherein in step (5) of the CD19-CAR T-cell expansion method, the centrifugation parameter is 140g and the centrifugation time is 8 min.