CN108220467B - Molecular marker and application thereof - Google Patents
Molecular marker and application thereof Download PDFInfo
- Publication number
- CN108220467B CN108220467B CN201710417637.4A CN201710417637A CN108220467B CN 108220467 B CN108220467 B CN 108220467B CN 201710417637 A CN201710417637 A CN 201710417637A CN 108220467 B CN108220467 B CN 108220467B
- Authority
- CN
- China
- Prior art keywords
- rice
- cadmium
- molecular marker
- detected
- character
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Botany (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a molecular marker and application thereof. Wherein the molecular marker is represented by SEQ ID NO: 3, and an insertion/deletion length polymorphism. The molecular marker disclosed by the invention is closely related to the cadmium-repellent character of rice, and can be effectively used for gene positioning of the cadmium-repellent character of rice, detection of the cadmium-repellent character of rice and molecular marker-assisted breeding of rice.
Description
PRIORITY INFORMATION
The present application claims priority and benefit of a patent application having patent application number CN201611177123.8 filed from the chinese intellectual property office in 2016, 12, 19, and is incorporated herein by reference in its entirety.
Technical Field
The invention relates to the field of molecular biology, in particular to a molecular marker and application thereof.
Background
Cadmium (Cd) is considered one of the most toxic environmental pollutants. Cd in the soil is derived from natural conditions such as mineral weathering, iron-manganese coprecipitation, atmospheric dry-wet precipitation and the like on one hand, and derived from artificial factors such as application of chemical fertilizers, pesticides and soil conditioners, sewage irrigation and the like on the other hand[1]. According to incomplete statistics, the heavy metal Cd and Pb pollution area of farmland in China reaches 2 million hectares, while the Cd content of agricultural products produced in China per year exceeds standard by 14.6 hundred million kg, and the agricultural products show an increasing trend[2]. The migration and distribution between soil, crops and food are one of the main ways of affecting human health by soil heavy metals[3-5]. Rice is the main food crop in China, and over 60 percent of people in China use rice as staple food. Therefore, the safety of rice production is related to the large environment of the whole grain safety in China.
For many years, experts at home and abroad mainly carry out a great deal of research on the characteristics of heavy metal enrichment of different organs of rice, the difference of Cd enrichment capacity of different rice varieties and the like. Morishita et al[6]Researches show that the Cd content in japonica rice, indica rice, depressed rice and hybrid rice is 2-73 mug/kg-1The absorption and accumulation of Cd by indica rice and hybrid rice are obviously superior to those of other two types. When the concentration of Cd in the soil is 100 mg-kg-1The concentration variation range of different varieties of stems and leaves of rice is 24-140 mg.kg-1The accumulated amount is 1-14 mg/pot-1[7]. Foreign scholars begin to use Cd to enrich rice varieties for Cd based on the fact that part of rice varieties have strong absorption and accumulation capacities on CdAnd (5) restoring polluted farmland. Mow war etc[8]The absorption rule of different organs of the rice on the heavy metals Cd and Pb in the soil is considered to be that the root is larger than the stem leaf and the seed. Gong Wei cluster and the like[9]Research shows that the absorption of foreign Cd and the enrichment of Cd in grains by hybrid rice are affected by soil type and are greater than variety genotype.
Meanwhile, in the research of rice cadmium enrichment capacity by researchers, it is found that part of rice varieties grow in cadmium-polluted soil, cadmium enrichment indexes in grains of the rice varieties are within a safe range, namely, the part of the rice varieties can still produce safe rice even in the cadmium-polluted soil, and the character is defined as a cadmium-resistant character which is controlled by genes. The research on the aspects is very little at home and abroad, if genes related to the cadmium-repellent character can be positioned and DNA molecular markers closely linked with the genes are developed, the molecular marker-assisted breeding technology can be utilized to guide the rice breeding work, the breeding level and the breeding efficiency of the cadmium-repellent rice are greatly improved, and the method has great significance on the rice grain safety aspect. However, at the present stage, genes related to cadmium rejection and DNA molecular markers closely linked with the genes still need to be mined.
Reference documents:
1.Alloway B J,Steinnes E.Anthropogenic additions of cadmium to soils.Cadmium in Soils and Plant,1999,85:97-123.
2. zhao Ching, Zhou jin, Yanghao, Jiangsu province environmental quality and agricultural safety problem research, soil, 2002,34 (1): 18.
3. liu hong Lian, Li Yan Hui, Li Lianqing, etc. distribution and risk evaluation of heavy metals in farmland soil and agricultural products in certain areas of Taihu lake region, agricultural and environmental bulletin, 2006,6 (5): 60-63
4.USEPA.Part-503Standards for the use or disposal of sewagesludge.Federal Register,1993,58:9387-9404.
5.Chang A C,Page A L.Cadmium uptake for Swiss chard grown on composted sewage sludge-treated field plots:Plateau or time bomb.J Environ Qual,1997,26(1):11-19.
6.Morishita T,Fumoto N,Yoshiawa T,Kagawa K.Varietal differences in cadmium levels of rice grains oh Japonia,Indica and Hybird varieties produced in the same plot of a field.Soil Science,1987,33(4):629-637.
7. Li Kun Right, Liu Jian nations, Lu Xiao Long, Yang Jian Chang, Zhang Zuguijian, Zhu Qing Sen, the difference of cadmium absorption and distribution of different varieties of rice, journal of agricultural environmental science 2003,22(5): 529-.
Li K Q,Liu J G,Lu X L,Yang J C,Zhang Z J,Zhu Q S.Genotype difference in accumulation and distribution of cadmiurn in rice plant.Journal of Agro-Environment Science,2003,22(5):529-532.(in Chinese)
8. Morse, eucrypti. enrichment and distribution of heavy metals Cu, Pb, Zn, Cr, Cb in rice plants. environmental chemistry, 2002,21 (2): 110-116.
9. Comparison of absorption and distribution of Cd in 2 different kinds of soil by 2 kinds of hybrid rice, agricultural environmental science, 2008,27 (5): 1895-1900.
Disclosure of Invention
The present invention is directed to solving at least one of the problems of the prior art. Therefore, the invention aims to provide a molecular marker which is related to the cadmium rejection character of rice and can be effectively used for rice breeding.
According to a first aspect of the invention, the invention provides a molecular marker related to the cadmium rejection character of rice. According to an embodiment of the invention, the molecular marker is represented by SEQ ID NO: 3, and an insertion/deletion length polymorphism. According to an embodiment of the invention, SEQ ID NO: 3 (215 bp): ATCCACAGTAACATGGCTTCTACGTGGCGAGTATAGCCGCTAACTAAGTAGAAGAATTGTTCGTGACCTAACTGAACCGCTCGGTAACAGTCTAACAGAATTACTTCATTGTCCCCCCTAAAAGAAAACCTAAGGCCTTGTTTAGATCCCAAAAAATTTTGGTCAAAAACATTACATCAAATGTTTGGACACATATATGGGACATTAAATGTGGAAAAAAAAACAATTGCACAGTTTACATGTAGATTACAAGA (SEQ ID NO: 3).
According to an embodiment of the invention, the polypeptide having the sequence of SEQ ID NO: 3 and individuals homozygous at the molecular marker locus show the cadmium-repellent character; deletion of SEQ ID NO: 3 and individuals homozygous at the molecular marker locus show no cadmium-repellent character; has the sequence shown in SEQ ID NO: 3 and individuals heterozygous at the molecular marker locus show the cadmium-repellent character.
The inventor finds that the cadmium rejection character of the rice genome DNA can be effectively determined by detecting whether the rice genome DNA has the molecular marker. Specifically, as described above, the rice seeds which do not have the molecular marker and are homozygous at the molecular marker locus do not have the cadmium-repellent trait, the rice seeds which have the molecular marker and are homozygous at the molecular marker locus have the cadmium-repellent trait, and the rice seeds which have the molecular marker and are heterozygous at the molecular marker locus have the cadmium-repellent trait, so that when the rice to be detected does not have the molecular marker, it can be determined that the seeds do not have the cadmium-repellent trait, and when the rice to be detected has the molecular marker, it can be determined that the seeds have the cadmium-repellent trait (homozygous or heterozygous at the molecular marker locus). Further, when the specific primer aiming at the molecular marker is adopted to carry out PCR amplification and gel electrophoresis detection on the genomic DNA of the rice to be detected, the cadmium-repellent property of the rice to be detected can be effectively determined through the number and the length of a target strip, and particularly, when the target strip is one and the length of the target strip is about 750bp, the cadmium-repellent property of the rice to be detected can be determined; when the target strip is one strip and the length of the target strip is about 500bp, determining that the rice to be detected does not have the cadmium-repellent character; and when the number of the target bands is two and the lengths of the target bands are respectively 500bp and 750bp, determining that the rice to be detected has the cadmium-repellent property. Therefore, the inventor determines that the molecular marker disclosed by the invention is closely related to the cadmium-repellent character of rice, and can be effectively used for gene positioning of the cadmium-repellent character of rice, detection of the cadmium-repellent character of rice and molecular marker-assisted breeding of rice. Furthermore, according to the demand for the cadmium-resistant character in actual breeding, the rice breeding material can be selected at an early stage, the breeding efficiency and accuracy are further effectively improved, the genetic level of a rice breeding population is improved, and therefore good rice varieties can be bred accurately and efficiently. For example, the specific primer of the molecular marker is used for amplifying the rice plant to be detected, performing gel electrophoresis, and selecting the rice with one target strip of the amplified product and the length of about 750bp, so that the rice plant with the cadmium-repellent character can be easily screened and obtained, and can be directly applied to molecular breeding practice.
In addition, according to some embodiments of the invention, the molecular marker of the invention is used for rice molecular marker assisted breeding, and has the advantages of early screening, time saving, low cost and high accuracy.
According to a second aspect of the invention, there is also provided a primer pair for detecting the aforementioned molecular marker of the invention. According to an embodiment of the invention, the primer pair has the sequence of SEQ ID NO: 1-2. Specifically, the sequences of the primer pairs of the present invention are as follows:
5’-GCCGAATAACCTGAAATGCT-3’(SEQ ID NO：1)；
5’-GCTCTGTCTCCGAAGATAAT-3’(SEQ ID NO：2)。
according to the embodiment of the invention, the primer pair is utilized to carry out PCR amplification on the genomic DNA of the rice to be detected, the length of an amplified fragment is detected, and when the amplified fragment is about 750bp in length, the rice to be detected has the nucleotide sequence shown in SEQ ID NO: 3, showing the property of cadmium rejection; when the length of the amplified fragment is about 500bp, the rice to be detected lacks SEQ ID NO: 3, which shows that the nucleotide sequence has no cadmium rejection character; when the amplified fragment is 500bp and 750bp, the molecular marker locus of the rice to be detected is heterozygous, and the rice to be detected has the cadmium-repellent property.
According to an embodiment of the invention, the length of the amplified fragments is detected by gel electrophoresis, preferably agarose gel electrophoresis.
The inventor surprisingly finds that the primer pair of the invention can effectively perform PCR amplification on the segment of the molecular marker related to the cadmium-repellent character of the rice to be detected, and further can effectively realize detection of the molecular marker through sequencing or electrophoresis so as to determine whether the rice to be detected has the molecular marker. For example, in the electrophoresis detection, the cadmium-repellent character of the rice to be detected can be effectively determined according to the number and the length of the target bands of the amplification product. Specifically, when the primer pair is used for carrying out PCR amplification and gel electrophoresis detection on the genomic DNA of the rice to be detected, when a target strip is one and the length of the target strip is about 500bp, the rice to be detected can be determined not to have the cadmium-repellent property; when the target strip is one strip and the length of the target strip is about 750bp, determining that the rice to be detected has the cadmium-repellent property; and when the number of the target bands is two and the lengths of the target bands are respectively 500bp and 750bp, determining that the rice to be detected has the cadmium-repellent property. The sequence deleted from the amplification product of about 500bp compared with the amplification product of about 750bp is the molecular marker of the present invention (herein, the molecular marker is sometimes referred to as "R011820"), so the molecular marker sequence of the present invention is located in the amplification product of 750 bp. Therefore, the primer pair for detecting the molecular marker of the invention can be effectively used for molecular marker assisted breeding of rice, and further can assist in early breeding of rice fine varieties in a short time, at low cost and with high accuracy.
It is noted that, as is well known to those skilled in the art, in the case of the above-mentioned SEQ ID NO: 1 and SEQ ID NO: 2, 1-10 bases can be added to the 5 'end or the 3' end of the sequence respectively, and the types of the added bases can be determined according to the sequence of the rice genome DNA and the sequence shown in SEQ ID NO: 1 and SEQ ID NO: 2 and the base type of the matching region is determined according to the base pairing rule, and the primer pair obtained thereby is matched with the primer pair shown in SEQ ID NO: 2 and SEQ ID NO: 2 (the DNA sequence between the upstream and downstream primers is identical). Thus, in SEQ ID NO: 1 and SEQ ID NO: 2, and primer pairs which are added with 1-10 bases at the 5 'end or the 3' end respectively and can amplify to obtain basically the same DNA fragments are included in the primer pairs.
According to a third aspect of the invention, there is also provided a kit for detecting the molecular marker hereinbefore described. According to an embodiment of the invention, the kit comprises: the primer pair for detecting the molecular marker of the present invention is described above. Namely, the kit of the present invention comprises a nucleic acid sequence having the sequence shown in SEQ ID NO: 1-2. According to the embodiment of the invention, the primer pair contained in the kit can be used for effectively detecting the molecular marker related to the cadmium-repellent character of the rice to be detected, determining whether the rice to be detected has the molecular marker, and further effectively determining the cadmium-repellent character of the rice to be detected. Specifically, for example, when the primer pair is used for performing PCR amplification and gel electrophoresis detection on the genomic DNA of the rice to be detected, when a target strip is one and the length of the target strip is about 500bp, the rice to be detected can be determined not to have the cadmium-repellent character; when the target strip is one strip and the length of the target strip is about 750bp, determining that the rice to be detected has the cadmium-repellent property; and when the number of the target bands is two and the lengths of the target bands are about 500bp and 750bp respectively, determining that the rice to be detected has the cadmium-repellent property. Therefore, the kit for detecting the molecular marker of the invention can be effectively used for molecular marker-assisted breeding of rice, and further can assist in early-stage breeding of rice fine varieties in a short time, at low cost and with high accuracy.
According to a fourth aspect of the invention, there is also provided a method of detecting a molecular marker as hereinbefore described. According to the embodiment of the invention, the primer pair or the kit is used for carrying out PCR amplification on the rice genome DNA to be detected and judging whether the molecular marker exists in an amplification product. Therefore, the detection of the molecular marker related to the cadmium-repellent character of the rice to be detected can be effectively realized, whether the rice to be detected has the molecular marker or not is determined, and the cadmium-repellent character of the rice to be detected can be further effectively determined.
According to the fifth aspect of the invention, the invention also provides the application of the molecular marker, the primer pair or the kit in the gene positioning of the cadmium-repellent character of rice, the detection of the cadmium-repellent character of rice or the auxiliary breeding of rice. Based on the close linkage of the molecular marker and the cadmium-repellent character, the molecular marker is combined with other molecular markers closely linked with the cadmium-repellent character, so that the positioning of genes related to the cadmium-repellent character of the rice can be realized, namely the molecular marker can be effectively used for positioning the genes related to the cadmium-repellent character of the rice; as described above, the molecular marker is closely linked with the cadmium-repellent character based on the invention, the detection of the molecular marker is carried out on the rice to be detected, even the primer pair or the kit containing the primer pair is directly used for detecting whether the rice to be detected has the molecular marker, the cadmium-repellent character of the rice to be detected can be effectively determined, the detection of the cadmium-repellent character of the rice is realized, furthermore, the early selection of rice breeding materials can be carried out according to the requirement on the cadmium-repellent character in the actual rice breeding, the breeding efficiency and accuracy are further effectively improved, the genetic level of a rice breeding population is improved, and therefore, excellent rice varieties can be accurately and efficiently selected. For example, when rice with a cadmium-repellent trait is required for breeding, the rice seed with the molecular marker, that is, the rice seed with the cadmium-repellent trait, can be easily screened out as a breeding material by detecting whether the rice seed to be tested has the molecular marker.
According to the sixth aspect of the invention, the invention also provides a method for positioning the gene of the cadmium-repellent character of rice. According to an embodiment of the invention, the method comprises the step of using the molecular marker as described above. Based on the tight linkage of the molecular marker and the cadmium-repellent character, the molecular marker is combined with other molecular markers which are tightly linked with the cadmium-repellent character, so that the positioning of genes related to the cadmium-repellent character of the rice can be realized, namely the molecular marker can be effectively used for positioning the genes of the cadmium-repellent character of the rice. Specifically, for example, in the process of positioning genes related to the cadmium-repellent character of rice, based on the close linkage with the cadmium-repellent character of the invention, the positioning of the genes related to the cadmium-repellent character can be realized by using the position information of the molecular marker of the invention and combining the position information of a plurality of other molecular markers closely linked with the cadmium-repellent character.
According to the seventh aspect of the invention, the invention also provides a method for detecting the cadmium rejection character of rice. According to the embodiment of the invention, the method carries out the detection of the molecular marker on the rice to be detected so as to determine the cadmium-repellent character of the rice to be detected. Specifically, the reagent for detecting the molecular marker related to the cadmium repellency trait of rice, such as the primer pair or the kit containing the primer pair, can be used for performing PCR amplification and gel electrophoresis on the genomic DNA of the rice to be detected, so that the cadmium repellency trait of the rice to be detected can be effectively determined according to the number and the length of the target bands of the amplification product. When the primer pair or the kit is used for carrying out PCR amplification and gel electrophoresis detection on a rice plant to be detected, as described above, when a target strip is one and the length of the target strip is about 500bp, the rice to be detected can be determined not to have the cadmium-repellent property; when the target strip is one strip and the length of the target strip is about 750bp, determining that the rice to be detected has the cadmium-repellent property; and when the number of the target bands is two and the lengths of the target bands are about 500bp and 750bp respectively, determining that the rice to be detected has the cadmium-repellent property. Therefore, the method for detecting the cadmium-repellent character of the rice can quickly, efficiently and accurately detect the cadmium-repellent character of the rice, and further can be effectively used for molecular marker-assisted breeding of the rice, so that the method can assist in early-stage breeding of good rice varieties in a short time, at low cost and with high accuracy.
In addition, the method for detecting the cadmium rejection character of the rice according to the embodiment of the invention can also have the following additional technical characteristics:
according to an embodiment of the present invention, the method for detecting the cadmium rejection trait of rice further comprises: carrying out PCR amplification on the rice genome DNA to be detected by utilizing the primer pair or the kit; detecting the length of the amplified fragment; determining the cadmium rejection character of the rice to be detected based on the length of the amplified fragment, wherein when the length of the amplified fragment is about 750bp, the rice to be detected has the cadmium rejection character; when the length of the amplified fragment is about 500bp, the rice to be detected has no cadmium-repellent character; when the amplified fragment is 500bp and 750bp, the molecular marker locus of the rice to be detected is heterozygous, and has the cadmium-repellent property. Therefore, whether the rice to be detected has the molecular marker can be efficiently and accurately detected, and the cadmium-repellent property of the rice to be detected can be effectively determined based on the detection result.
According to the embodiment of the present invention, the method for extracting and obtaining the genomic DNA of the rice to be tested is not particularly limited, and any known method or kit for extracting genomic DNA may be used. According to some embodiments of the present invention, the genomic DNA of the rice to be tested is extracted by the cetyltrimethylammonium bromide method (CTAB method). Therefore, the genomic DNA with good quality and high purity can be effectively obtained, and the subsequent steps can be conveniently carried out.
According to an embodiment of the invention, the length of the amplified fragments is detected by gel electrophoresis, preferably agarose gel electrophoresis. Therefore, the method is convenient and quick.
The inventor finds that the method for detecting the cadmium-repellent character of the rice can be effectively used for molecular marker-assisted breeding of the rice, so that the method can assist in early-stage breeding of good rice varieties in a short time, at low cost and with high accuracy.
According to the eighth aspect of the invention, the invention also provides a rice auxiliary breeding method. According to an embodiment of the invention, the method comprises the step of detecting the molecular marker as described above. As described above, the molecular marker of the invention is closely linked with the cadmium-repellent trait, so that the detection of whether the rice to be detected has the molecular marker can effectively determine the cadmium-repellent trait of the rice to be detected, and further, the early selection of rice breeding materials can be performed according to the requirement on the cadmium-repellent trait in actual rice breeding. For example, when the breeding needs the rice with the cadmium-repellent character, the rice seed with the molecular marker, namely the cadmium-repellent character can be easily screened out to be used as a breeding material by detecting whether the rice seed to be detected has the molecular marker, so that the breeding efficiency and accuracy can be effectively improved, the genetic level of a rice breeding population is improved, and a good rice variety can be accurately and efficiently bred.
According to an embodiment of the present invention, the detection is performed using the aforementioned primer set or kit,
according to an embodiment of the invention, the method comprises detecting the molecular marker by the method for detecting the cadmium-repellent character of the rice, so as to determine the cadmium-repellent character of the rice to be detected. Therefore, by using the rice auxiliary breeding method, the cadmium-resistant property of the rice can be effectively determined, and further, the rice excellent variety can be bred in a short time, at low cost and with high accuracy.
It should be noted that the molecular marker related to the cadmium-repellent trait of rice and the application thereof have the following advantages:
(1) the molecular marker related to the cadmium-repellent character of the rice provided by the invention is not limited by the growth stage of the rice, can be used for early breeding of the rice, and can remarkably promote the breeding process of the rice;
(2) detecting that the rice is shown as SEQ ID NO: 3, the method for marking the molecular marker related to the cadmium rejection character of the rice is accurate and reliable and is convenient to operate;
(3) the rice is shown as SEQ ID NO: 3, the detection of the molecular marker related to the cadmium rejection character of the rice provides scientific basis for the marker-assisted selection of the growth character of the rice.
According to some embodiments of the invention, from another aspect:
the invention provides a molecular marker R011820 closely linked with a rice cadmium rejection character gene.
The invention provides a primer pair for amplifying a molecular marker closely linked with a rice cadmium rejection character gene, wherein a primer 1 of the primer pair contains a nucleotide sequence shown in SEQ ID NO: 1, primer 2 contains a sequence shown in SEQ ID NO: 2; preferably, primer 1 is SEQ ID NO: 1, and primer 2 is SEQ ID NO: 2.
The invention also provides another molecular marker closely linked with the gene with the cadmium-repellent character of the rice, which is obtained by taking the rice genome DNA with the cadmium-repellent character of the primer pair as a template and carrying out PCR amplification.
The invention provides a method for positioning a rice cadmium rejection character gene, which comprises the step of using any one of the molecular markers or the primer pair.
The detection method of the molecular marker provided by the invention comprises the following steps: designing a primer according to the nucleotide sequence of the molecular marker, amplifying by taking the detected rice genome DNA as a template, and judging whether the molecular marker exists in an amplification product.
Further, the primer in the detection method is the primer set.
The invention also provides the application of the molecular marker or the primer pair in rice auxiliary breeding or rice cadmium rejection character gene positioning or detection.
The invention provides a rice auxiliary breeding method, which comprises the step of detecting the molecular marker or detecting by using the primer pair.
The invention provides a method for screening the molecular marker, which comprises the following steps:
(1) obtaining homozygotic male parent and female parent genomes;
(2) obtaining male parent and female parent genome sequences through sequencing respectively;
(3) comparing the male parent genome sequence and the female parent genome sequence to obtain a differential locus;
(4) constructing a genetic population and collecting phenotypic data;
(5) genotyping the individuals in the population;
(6) positioning the rice cadmium rejection character gene on a genome by combining genotype and phenotype data;
(7) candidate molecular markers are selected at a segment near the target gene.
In addition, the invention has the following beneficial effects:
the invention provides a molecular marker closely linked with genes related to the cadmium-repellent character of rice and an amplification primer thereof, which belong to the technical field of genetic engineering, and relate a genome DNA sequence with the genes related to the cadmium-repellent character of rice, thereby being more beneficial to the establishment of a rice molecular marker-assisted breeding system; the molecular marker can be simply, conveniently, quickly and high-flux applied to the rice cadmium-repellent character improvement breeding practice, so that the breeding period of a new rice variety is shortened, and the breeding process is accelerated.
Additional aspects and advantages of the invention will be set forth in part in the description which follows and, in part, will be obvious from the description, or may be learned by practice of the invention.
Drawings
The above and/or additional aspects and advantages of the present invention will become apparent and readily appreciated from the following description of the embodiments, taken in conjunction with the accompanying drawings of which:
FIG. 1 shows the use of a polypeptide having the sequence of SEQ ID NO: 1-2, and performing electrophoresis detection on an amplification product obtained by performing PCR amplification on the parent and the DNA hybridized with the F1 generation by using the primer pair of the nucleotide sequence shown in the figure;
FIG. 2 shows the use of a polypeptide having the sequence of SEQ ID NO: 1-2, and carrying out electrophoresis detection on a partial amplification product obtained by carrying out PCR amplification on DNA of an F2 generation rice plant by using the primer of the nucleotide sequence shown in the specification.
Detailed Description
The following describes embodiments of the present invention in detail. The following examples are illustrative only and are not to be construed as limiting the invention. The examples do not specify particular techniques or conditions, and are carried out according to techniques or conditions described in literature in the art (for example, refer to molecular cloning, a laboratory Manual, third edition, scientific Press, written by J. SammBruke et al, Huang Petang et al) or according to product instructions. The reagents or apparatus used are not indicated by the manufacturer, but are conventional products available commercially, for example from Illumina.
Example 1: construction of rice F2 generation segregation population and collection of F2 generation grain cadmium content phenotype data
The male parent is an indica type conventional rice variety 9311, the rice is planted in cadmium-polluted soil with a cadmium soil background value of 4.3mg/kg, the cadmium content in the seeds exceeds 0.8mg/kg and is far greater than the national standard 0.2mg/kg, and the rice is a high cadmium accumulation variety of the seeds and does not have the property of cadmium rejection.
The female parent is indica type photo-thermo sensitive sterile line T91S, which belongs to indica type dual-purpose genic sterile line. The cadmium-free corn is planted in cadmium-polluted soil with a background value of 4.3mg/kg of cadmium soil, the cadmium content in grains is 0.024mg/kg, which is lower than the national standard of 0.2mg/kg, and the seeds are varieties with low cadmium accumulation and have the property of cadmium rejection.
The male parent and the female parent are hybridized to obtain F1, F1 generation selfs generate F2 generation group, and 209 single plants are obtained in total. Planting the F2 colony in cadmium-contaminated soil with a cadmium soil background value of 4.3mg/kg, and determining the cadmium content of each individual grain in the F2 generation after fructification to obtain phenotypic data.
From the phenotypic identification results, the segregation ratio was calculated, statistical analysis of data was performed using Microsoft Excel 2003 software, and chi-square test was performed on the results using SPSS 17.0.
And (3) character investigation results: among 209F 2 progeny, 152 individual seeds had cadmium content below 0.1mg/kg, below the national standard of 0.2mg/mg, and had cadmium-rejecting traits; in addition, the cadmium content in 57 individual seeds is higher than 0.8mg/kg and far higher than the national standard, and the seeds do not have the property of cadmium rejection.
χ2 0.05＝0.1026
Chi-square test shows that the separation ratio of the cadmium rejection character is about 3:1, and the separation rule of a pair of genes of Mendelian is met. Thus, the cadmium rejection trait is a dominant monogenic controlled quality trait.
Example 2: extraction of genomic DNA
The genomic DNAs of the parents, the F1 generation and the F2 generation individuals in example 1 were extracted by the modified CTAB method, which was as follows:
1) sampling: about 1g of young and tender leaves are taken and placed in a 2ml centrifuge tube.
2) Freezing and drying a sample: the well-prepared sample, namely the grinding bead, is put into a vacuum freeze-drying machine after a tube cover is opened, and is continuously frozen and dried for more than 12 hours at the temperature of minus 50 ℃ (generally frozen and dried overnight).
3) Grinding a sample: and (3) placing the frozen and dried sample in a high-throughput mechanical grinding instrument, starting a program for grinding, and crushing the sample. The mechanical grindometer program was run for 5 minutes at a throughput of 96 samples/5 minutes.
4) After the sample is fully ground, CTAB extracting solution preheated for 1h at 65 ℃ is added into a tube and mixed evenly, water bath at 65 ℃ is carried out for 40 minutes, and the mixture is inverted and mixed evenly once every 5 minutes.
5) Taking out the water-bath sample from the water bath pot, cooling to room temperature, adding chloroform (chloroform/isoamylol are mixed according to a ratio of 24: 1) with the same volume as CTAB, and gently mixing for 10 minutes until the lower layer liquid turns into dark green. (this step is to be performed in a ventilated kitchen)
6) After mixing, the centrifugal tube is transferred into a high-speed centrifuge for centrifugation at 12000rpm for 15 minutes. The supernatant of the sample after centrifugation was clear.
7) An appropriate amount of the supernatant was taken in a 1.5ml centrifuge tube, and an equal volume of isopropanol was added thereto, and gently mixed (at this time, a flocculent precipitate was observed), and then the sample was placed in a freezer at-20 ℃ for 30 minutes to precipitate DNA.
8) After the sample was frozen for 30 minutes, it was transferred to a high-speed centrifuge and centrifuged at 12000rmp for 10 minutes.
9) The clear solution is discarded, the DNA precipitate is washed with 75% ethanol for 2 times, the ethanol is poured out after washing, and the DNA precipitate is placed in a ventilation kitchen and dried in the air after opening the tube.
10) After the ethanol was completely evaporated, 50. mu.l of TE buffer (plus RNase) was added to dissolve the DNA and stored at-20 ℃.
Example 3: gene mapping and molecular marker development
(1) Genetic map construction
Genotyping data for the F2 population was obtained by genotyping individuals of the F2 population based on the genotyping technique of RAD-seq for the genomic DNA of the F2 individuals obtained in example 2.
Genetic linkage mapping was performed using MapMaker 3.0 software (structural genetic maps with MAPMAKER/EXP 3.0, S Lincoln, M Daly, E Lander-Cambridge, MA: Whitehead Institute,1992, which is incorporated herein by reference in its entirety) to generate genetic linkage maps.
(2) Gene mapping
QTL mapping was performed by WinQTLCart 2.5 software based on phenotypic data of the F2 population obtained in example 1, in combination with the population genotype and genetic linkage map.
Because the parent and the female parent have obvious difference on the cadmium-rejecting character (the male parent does not have the cadmium-rejecting character, and the female parent has the cadmium-rejecting character), the F2 individual is subjected to character analysis, and the cadmium-rejecting character gene is positioned on a genetic map according to the linkage relation between the characters and the marker.
Specifically, for the F2 population obtained in example 1, the individual phenotype of the F2 population, similar to the paternal trait is denoted as a, similar to the maternal trait is denoted as b, and the trait is sandwiched between the male parent and the female parent is denoted as h. And obtaining phenotype data of all individuals, and comparing the phenotype data of the individuals with the genotype data obtained before, so as to position the rice cadmium rejection gene on a genetic linkage map. The results show that one of the rice cadmium rejection genes is located within the interval of chromosome 1 from 19333766 to 20725218 and is about 1.4M in length.
(3) Molecular marker development
Performing whole genome re-sequencing (RAD-seq) on the genomic DNAs of the female parent and the male parent obtained in the example 2, then comparing and sequencing reads by using SOAP software according to the sequencing result of the RAD-seq, and then searching for a molecular marker with larger difference of the two genome fragments by using SOAPsv, so as to be convenient for distinguishing and identifying by using gel electrophoresis.
As a result, the marker R011820 (the nucleic acid sequence shown in SEQ ID NO: 3) near the region where the cadmium-rejecting trait gene is located was selected as a candidate.
The nucleotide sequence of R011820 is as follows (215 bp): GGCCTGTTTGGCACAGCTCTAGCTCCAGCTCCACCCCTCCTGGAGCTGGAGCTCAGCCAAACAGTTTCAGCTCCACTAATACTGGGAGTGGAGTTGGGTGGAGCTCTCTCACAAAATTACTAGAGTTGTGGAGCTGGGTTTAGGCAGCTCCACAACTCCACTCTAGACTCAACTCCTGGAGTAATATTTAGGAGTTGGAGCTGTACCAAACAGGC (SEQ ID NO: 3).
Example 4: molecular marker cadmium rejection character correlation verification
A primer is designed aiming at the molecular marker R011820 which is determined in the embodiment 3 and closely linked with the rice cadmium rejection trait gene, so as to verify the molecular marker R011820 (the nucleic acid sequence shown in SEQ ID NO: 3), and the specific steps are as follows:
designing primers aiming at the molecular markers, wherein the sequences of the primers are as follows:
R011820-F：GCCGAATAACCTGAAATGCT(SEQ ID NO：1)；
R011820-R：GCTCTGTCTCCGAAGATAAT(SEQ ID NO：2)。
the polymorphism and amplification stability of the marker are verified by PCR amplification and agarose gel electrophoresis detection using the above primers.
Specifically, the genomic DNA of the male parent, female parent, F1 generation, or F2 generation extracted in example 2 was used as a template to perform PCR amplification using the above-mentioned amplification primers,
the PCR reaction system is as follows:
| sterile water | 20.2 |
| 10 × Buffer (containing Mg)2+) | 2.5μl |
| dNTPs(25mM) | 0.15μl |
| Taq enzyme (5U/. mu.l) | 0.15μl |
| Forward primer | 0.5μl |
| Reverse primer | 0.5μl |
| Form panel | 1.0μl |
| Total volume | 25μl |
The PCR reaction procedure was as follows:
pre-denaturation at 94 ℃ for 5 min; denaturation at 94 ℃ for 30 seconds, annealing at 60 ℃ for 30 seconds, extension at 72 ℃ for 40 seconds, and running for 35 cycles; final extension at 72 ℃ for 3 min. The PCR amplification product can be stored at 4 ℃.
Subsequently, a portion of each PCR amplification product was detected by agarose gel electrophoresis, and the results are shown in FIGS. 1 and 2. As shown in FIG. 1, the amplified fragments of about 500bp in size are obtained from the male parent, about 750bp in size are obtained from the female parent, and both fragments are obtained from the hybridization F1 generation. FIG. 2 shows the results of electrophoresis detection of the amplification products of part of F2 generation individuals, in which the individuals without the cadmium-repellent property (cadmium content in seeds greater than 0.8mg/kg) all amplified a 500bp band, part of the individuals with the cadmium-repellent property (cadmium content in seeds less than 0.1mg/kg) amplified a 750bp band, and the other part of the individuals with the cadmium-repellent property (cadmium content in seeds less than 0.1mg/kg) contained two amplified fragments. Thus, the molecular marker R011820 (the nucleic acid sequence shown by SEQ ID NO: 3) is proved to have polymorphism between parents, and the molecular marker is closely related to the cadmium rejection character of rice.
Then, each amplification product is sequenced by a 3730 sequencer, and as a result, the amplification band size of the homozygous single plant without the cadmium-repellent property in the male parent and the F2 generation is about 500bp, and compared with the amplification band size of the homozygous single plant without the cadmium-repellent property in the female parent and the F2 generation, 750bp lacks some sequences, namely a nucleic acid sequence shown in a molecular marker R011820(SEQ ID NO: 3). The molecular marker primer can be directly applied to molecular breeding practice of cadmium-repellent rice, and is used for carrying out directional improvement on male parent indica type conventional rice 9311 without cadmium-repellent characters.
In the description herein, references to the description of the term "one embodiment," "some embodiments," "an example," "a specific example," or "some examples," etc., mean that a particular feature, structure, material, or characteristic described in connection with the embodiment or example is included in at least one embodiment or example of the invention. In this specification, the schematic representations of the terms used above do not necessarily refer to the same embodiment or example. Furthermore, the particular features, structures, materials, or characteristics described may be combined in any suitable manner in any one or more embodiments or examples.
While embodiments of the invention have been shown and described, it will be understood by those of ordinary skill in the art that: various changes, modifications, substitutions and alterations can be made to the embodiments without departing from the principles and spirit of the invention, the scope of which is defined by the claims and their equivalents.
SEQUENCE LISTING
<110> Shenzhen Hua Dagene institute
Shenzhen Huada Sansheng Garden Technology Co.,Ltd.
SHENZHEN HUADA AGRICULTURAL APPLICATION Research Institute
<120> molecular marker and application thereof
<130> PIDC1168374
<150> CN201611177123.8
<151> 2016-12-19
<160> 3
<170> PatentIn version 3.3
<210> 1
<211> 20
<212> DNA
<213> Artificial
<220>
<223> primer
<400> 1
<210> 2
<211> 20
<212> DNA
<213> Artificial
<220>
<223> primer
<400> 2
gctctgtctc cgaagataat 20
<210> 3
<211> 215
<212> DNA
<213> Artificial
<220>
<223> molecular marker R011820
<400> 3
ggcctgtttg gcacagctct agctccagct ccacccctcc tggagctgga gctcagccaa 60
acagtttcag ctccactaat actgggagtg gagttgggtg gagctctctc acaaaattac 120
tagagttgtg gagctgggtt taggcagctc cacaactcca ctctagactc aactcctgga 180
gtaatattta ggagttggag ctgtaccaaa caggc 215
Claims (12)
1, SEQ ID NO: 3 as a molecular marker related to the cadmium-repellent character of rice.
2. Use according to claim 1, having the sequence of SEQ ID NO: 3 and individuals homozygous at the molecular marker locus show the cadmium-repellent character; deletion of SEQ ID NO: 3 and individuals homozygous at the molecular marker locus show no cadmium-repellent character; has the sequence shown in SEQ ID NO: 3 and individuals heterozygous at the molecular marker locus show the cadmium-repellent character.
3. A primer pair for detecting a molecular marker, wherein the nucleotide sequence of the molecular marker is SEQ ID NO: 3, and is characterized in that the primer pair is SEQ ID NO: 1-2.
4. The primer pair according to claim 3,
and carrying out PCR amplification on the genomic DNA of the rice to be detected by using the primer pair, and detecting the length of an amplified fragment, wherein when the amplified fragment is 750bp in length, the rice to be detected has the nucleotide sequence shown in SEQ ID NO: 3, showing the property of cadmium rejection; when the length of the amplified fragment is 500bp, the rice to be detected lacks SEQ ID NO: 3, which shows that the nucleotide sequence has no cadmium rejection character; when the amplified fragment is 500bp and 750bp, the molecular marker locus of the rice to be detected is heterozygous, and the rice to be detected has the cadmium-repellent property.
5. The primer set according to claim 4, wherein the length of the amplified fragment is detected by agarose gel electrophoresis.
6. A kit for detecting a molecular marker having a nucleotide sequence of SEQ ID NO: 3, characterized by comprising:
the primer set according to claim 3 or 4.
7. A method of detecting a molecular marker having a nucleotide sequence of SEQ ID NO: 3, the method is characterized in that the primer pair of claim 3 or 4 or the kit of claim 6 is used for carrying out PCR amplification on the genomic DNA of the rice to be detected and judging whether the molecular marker exists in an amplification product.
8. The molecular marker of claim 1 or 2, the primer pair of claim 3 or 4, or the kit of claim 6, for use in gene mapping of rice cadmium rejection traits, detection of rice cadmium rejection traits, or rice assisted breeding.
9. A method for positioning a gene of a rice cadmium rejection character is characterized by comprising the step of using a molecular marker, wherein the nucleotide sequence of the molecular marker is SEQ ID NO: 3.
the method comprises the following steps: based on the close linkage of the molecular marker and the cadmium-repellent character, the positioning of the genes related to the cadmium-repellent character is realized by using the position information of the molecular marker and combining the position information of a plurality of other molecular markers closely linked with the cadmium-repellent character.
10. A method for detecting the cadmium-repellent character of rice is characterized in that,
detecting a molecular marker of rice to be detected, wherein the nucleotide sequence of the molecular marker is SEQ ID NO: 3, so as to determine the cadmium rejection character of the rice to be detected;
wherein the method is carried out by the following steps:
performing PCR amplification on the rice genomic DNA to be detected by using the primer pair of claim 3 or 4 or the kit of claim 6;
detecting the length of the amplified fragment; and
determining the cadmium rejection character of the rice to be detected based on the length of the amplified fragment,
when the length of the amplified fragment is 750bp, the rice to be detected has a cadmium-repellent character; when the length of the amplified fragment is 500bp, the rice to be detected does not have the cadmium-repellent character; when the amplified fragment is 500bp and 750bp, the molecular marker locus of the rice to be detected is heterozygous, and has the cadmium-repellent property.
11. The method of claim 10, wherein the length of the amplified fragment is detected by agarose gel electrophoresis.
12. The rice auxiliary breeding method is characterized by comprising the following steps of detecting that the nucleotide sequence is SEQ ID NO: 3, and the molecular marker is as follows:
performing PCR amplification on the rice genomic DNA to be detected by using the primer pair of claim 3 or 4 or the kit of claim 6;
detecting the length of the amplified fragment; and
determining the cadmium rejection character of the rice to be detected based on the length of the amplified fragment,
when the length of the amplified fragment is 750bp, the rice to be detected has a cadmium-repellent character; when the length of the amplified fragment is 500bp, the rice to be detected does not have the cadmium-repellent character; when the amplified fragment is 500bp and 750bp, the molecular marker locus of the rice to be detected is heterozygous, and has the cadmium-repellent property.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2016111771238 | 2016-12-19 | ||
| CN201611177123 | 2016-12-19 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108220467A CN108220467A (en) | 2018-06-29 |
| CN108220467B true CN108220467B (en) | 2021-10-29 |
Family
ID=62658142
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710417637.4A Active CN108220467B (en) | 2016-12-19 | 2017-06-05 | Molecular marker and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108220467B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110643729B (en) * | 2019-09-04 | 2020-09-18 | 广东省农业科学院茶叶研究所 | SNP molecular marker locus linked with content of gallocatechin gallate of tea tree and application thereof |
| CN113584200B (en) * | 2020-04-30 | 2023-09-26 | 深圳华大生命科学研究院 | Molecular marker related to cold non-retrogradation character of rice and application thereof |
| CN113584199B (en) * | 2020-04-30 | 2023-09-26 | 深圳华大生命科学研究院 | Molecular marker related to cold non-retrogradation character of rice and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102295692A (en) * | 2011-08-26 | 2011-12-28 | 中国科学院华南植物园 | Rice metal-tolerant protein OsMPT1 as well as encoding gene and RNA (Ribonucleic Acid) interference segment thereof |
| CN104762302A (en) * | 2015-04-08 | 2015-07-08 | 安徽省农业科学院水稻研究所 | Cadmium (Cd) strongly-induced promoter CdS2 and application thereof |
-
2017
- 2017-06-05 CN CN201710417637.4A patent/CN108220467B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102295692A (en) * | 2011-08-26 | 2011-12-28 | 中国科学院华南植物园 | Rice metal-tolerant protein OsMPT1 as well as encoding gene and RNA (Ribonucleic Acid) interference segment thereof |
| CN104762302A (en) * | 2015-04-08 | 2015-07-08 | 安徽省农业科学院水稻研究所 | Cadmium (Cd) strongly-induced promoter CdS2 and application thereof |
Non-Patent Citations (5)
| Title |
|---|
| Chun-Hong Qiu 等.Isolation and characterization of three cadmium-inducible promoters from Oryza sativa.《Journal of Biotechnology》.2015,第216卷第11-19页. * |
| Sasaki,T. 等.AP002542.2 Oryza sativa Japonica Group genomic DNA, chromosome 6, PAC clone:P0679C08.《GenBank》.2008,第2页. * |
| 王凯 等.水稻镉吸收与转运机理研究进展.《作物研究》.2014,第28卷(第8期),第926-930页. * |
| 肖清铁 等.水稻根系响应镉胁迫的蛋白质差异表达.《生态学报》.2015,第35卷(第24期),第8276-8283页. * |
| 郑天清 等.水稻功能基因组育种数据库(RFGB): 3K 水稻SNP 与 InDel 子数据库.《科学通报》.2015,第60卷(第4期),第367-371页. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108220467A (en) | 2018-06-29 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN111334603B (en) | Specific InDel molecular marker primer for detecting OsNRAMP5 gene of rice and application thereof | |
| CN111466291B (en) | Breeding method of low cadmium accumulation rice | |
| CN112981001B (en) | Molecular marker BnC04Y2255 for identifying dwarf cabbage type rape and application thereof | |
| CN111763755B (en) | SNP molecular marker of rice cadmium absorption related gene OsNRAMP5 and application thereof | |
| CN108220467B (en) | Molecular marker and application thereof | |
| US20230323479A1 (en) | Molecular marker of cadmium accumulation in rice and use thereof in improving cadmium accumulation in rice grains | |
| CN110499389B (en) | Codominant marker primer closely linked with tobacco anti-spotted wilt site RTSW, identification method and application thereof | |
| CN106498068B (en) | Co-dominant SSR marker closely linked with tobacco TMV resistance gene N and application thereof | |
| CN101487056B (en) | Method for assistantly screening anti-stripe rust wheat, and special primer therefor | |
| CN110512025A (en) | A kind of molecular labeling and its application with powdery mildew resistance gene in wheat PmJM23 close linkage | |
| CN108456740B (en) | Rice blast resistance site 'Pi-jx', Indel marker primer and breeding application thereof | |
| Young-Goo et al. | Use of the bulked genomic DNA-based RAPD methodology to assess the genetic diversity among abandoned Korean tea plantations | |
| CN110551843B (en) | Codominant marking primer capable of distinguishing tobacco spot wilt-resistant locus RTSW homozygous heterozygous genotype, distinguishing method and application thereof | |
| CN110468229B (en) | Coseparation molecular marker Hxjy-1 of rice broad-spectrum high-resistance bacterial leaf blight gene Xa45(t) | |
| CN110499390B (en) | Molecular marker primer for tobacco anti-spotted wilt RTSW gene auxiliary selection, auxiliary selection method and application thereof | |
| CN109468330B (en) | Barley yellow mosaic disease resistance gene eIF4EHOR3298And identification method and application thereof | |
| CN114752702B (en) | Molecular marker BnCa-2C2 closely linked with rape calcium content trait QTL and application thereof | |
| CN110358861A (en) | R13I14 is marked with rice wide spectrum high resistance to hoja blanca gene Xa45 (t) compact linkage molecule | |
| CN108220287B (en) | Molecular marker and application thereof | |
| CN113564161B (en) | Molecular marker closely linked with bacterial wilt resistance of cultivated peanut and application thereof | |
| CN112746123B (en) | Molecular marker closely linked with wheat root rot vermicular spore black embryo disease resistance QTL and application thereof | |
| CN112011637B (en) | Molecular marker closely linked with wheat powdery mildew resistance gene Pm68 and application thereof | |
| CN110499388B (en) | Codominant marker primer group for identifying RTSW allele type of tobacco anti-spotted wilt locus, identification method and application thereof | |
| CN110358862B (en) | Molecular marker Hxjy-14 closely linked with rice broad-spectrum high-resistance bacterial blight gene Xa45(t) | |
| CN110106270B (en) | Molecular marker coseparated from melon yellow seed coat and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |