CN108220312A - For the carrier for analyzing promoter activity and the Assay of promoter activity method counted based on RNA - Google Patents
For the carrier for analyzing promoter activity and the Assay of promoter activity method counted based on RNA Download PDFInfo
- Publication number
- CN108220312A CN108220312A CN201711382250.6A CN201711382250A CN108220312A CN 108220312 A CN108220312 A CN 108220312A CN 201711382250 A CN201711382250 A CN 201711382250A CN 108220312 A CN108220312 A CN 108220312A
- Authority
- CN
- China
- Prior art keywords
- dna
- dnab
- dnaa
- promoter
- sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
Abstract
The invention discloses a kind of Assay of promoter activity method for analyzing the carrier of promoter activity and being counted based on RNA, this method by same carrier with different two promoters Pa and Pb；Two height similar DNA sequence dna DNAa and DNAb are respectively driven, RNAa and RNAb is obtained after vivo transcription, by calculating the quantity ratio of DNAa PCR product DNA and DNAb PCR products DNA, determines activity relationships of the Pa to Pb promoters.The method have the characteristics that precisely quantitative, strong antijamming capability, it is quick, do not limited by acceptor material and species.
Description
Technical field
The present invention relates to biotechnology, in particular to a kind of for analyzing the carrier of promoter activity and be based on
The Assay of promoter activity method that RNA is counted.
Background technology
With genome sequencing technology, the fast development of molecular biology, bioinformatics, there is a large amount of gene to be tested
Sequence and clone, in functional gene research, it is main component part that gene promoter, which is researched and analysed, thus to the work of promoter
Journal of Sex Research is most important.The method of conventional plant Assay of promoter activity is that stable transgenic line is obtained by transgenic technology
Using Gus as reporter gene, by dyeing, the intensity of promoter, such technology experiment period are judged according to the dyeing depth for system
Long (4-6 months) can not accomplish fine quantitative, heavy workload, is of high cost.
At present to zooblast promoter activity verification method mostly using double luciferase reporter systems, which uses two
Carrier drives renilla luciferase on one carrier with standard promoter, with the promoter to be measured driving light of firefly on another carrier
Luciferase can utilize sea pansy fluorescein and firefly luciferin send out red and yellow green after the two expression of enzymes respectively
Fluorescence, by comparing the intensity of two kinds of fluorescence, judge the intensity of promoter, such technical result is unstable, inaccurate, simultaneously
It can not use because effectively cannot absorb fluorescein due to for single celled tissue can not be obtained, thus seldom be applied in plant.
This system is the system of two carriers, it is impossible to ensure that the ratio into two kinds of carriers of cell is stringent 1：1, this is the first
The reason of generation system error；Secondly, two different fluorescein luminescence systems, luminous efficiency is inconsistent, with different tests
The reason of substrate, the concentration of respective substrate is bad to be determined, this is second of generation system error；Finally, this system is not direct
The quantity of the assessment RNA directly related with promoter activity, but protein active is assessed in protein level, it is turned over from RNA to albumen
Because codon translation efficiency can generate the difference of essence during translating, this can bring most fatal system to the system
Mistake, and instrument, reagent etc. are expensive.
It is not directly, inaccurate in conclusion existing technology is there are system complex, the disadvantages such as the period is long or of high cost
End.
Invention content
The present invention is provided a kind of for analyzing the carrier of promoter activity and be based on for the prior art is defective
The Assay of promoter activity method that RNA is counted, this method is by comparing promoter direct product -- the quantity assessment promoter of RNA
Activity, the process of this method is direct, will not introduce systematic error.
To achieve the above object, a kind of carrier for being used to analyze promoter activity provided by the invention, the bone of the carrier
Transcriptional units there are two settings on frame, respectively transcriptional units A and transcriptional units B, the transcriptional units A include ginseng to be compared
Examine promoter Pa, DNAa sequence and terminator；The transcriptional units B include target promoter Pb, DNAb sequence to be compared and
Terminator；Wherein, the DNAa sequences and DNAb sequences are from same sequence, and the Individual base between DNAa and DNAb is deposited
In difference.
Further, the DNAa sequences and DNAb sequences are arbitrary sequence or complete ORF, the DNAa sequences
It is preferably complete ORF with DNAb sequences, the reporter genes such as particularly preferably common reporter gene such as Gus, Gfp.
Still further, the carrier is pARC-gfp carriers, sequence for shown in SEQ ID No.1, wherein,
It is included using one section of sequence on Gfp genes as DNAa, DNAb sequence, respectively such as SEQ ID No.2 and SEQ
Shown in ID No.3, particular sequence is as follows：
DNAa：
5’-TTCTTCAAGGACGACGGCAACTACAAGACGCGAGCTGAGGTGAAGTTCGAGGGCGACACGCTCGTC
AACCGTATCGAGCTCAAGGGAATCGACTTCAAGGAGGACGGAAACATTCTCGGACACAAGCTGGAGTACAACTACAA
CTCCCACAACGTTTACATAATGGCGGACAAGCAGAAGAACGGCATTAAGGCCAACTT-3’；
DNAb：
5’-TTCTTCAAGGACGACGGGAACTACAAGACCCGTGCAGAGGTCAAGTTCGAGGGGGACACCCTCGTG
AACAGAATCGAGCTCAAGGGTATCGACTTCAAGGAGGACGGTAACATACTCGGTCACAAGCTCGAGTACAACTACAA
CTCGCACAACGTATACATTATGGCCGACAAGCAGAAGAACGGGATAAAGGCCAACTT-3’。
It, which is further included, is inserted into reference to promoter Pa and target promoter Pb promoters, and multiple cloning sites are respectively：
MCS1：
5’-GTTGTGAGACCTTTTTAAATTTTGGTCTCTTCTA-3’；
MCS2：
5’-TAGCAGAGACGAAAATTTAAAAACGTCTCACACC-3’。
The present invention also provides a kind of Assay of promoter activity method counted based on RNA, first by DNA molecular or load
During body is transferred in host cell, then converted, then total serum IgE extracted to acceptor material, including corresponding RNAa and
RNAb, and reverse transcription is cDNA, using this cDNA as template, is all matched using a pair of and DNAa sequences and DNAb sequences special
Property DNA primer carry out PCR, obtain DNAa-PCR products DNA and DNAb-PCR product DNA, calculate DNAa-PCR products DNA with
The quantity ratio of DNAb-PCR products DNA, as with reference to promoter Pa relative to the relative activity ratio of target promoter Pb；Wherein,
Transcriptional units there are two being respectively provided on the skeleton of DNA molecular or carrier, respectively transcriptional units A and transcriptional units B, described turn
It records unit A and includes reference promoter Pa, DNA sequence dna DNAa and terminator to be compared；The transcriptional units B includes to be compared
Target promoter Pb, DNA sequence dna DNAb and terminator；Wherein, the DNAa and DNAb derive from same sequence, and DNAa and
Individual base between DNAb has differences.
Further, the quantity ratio of the DNAa-PCR products DNA and DNAb-PCR product DNA by a generation be sequenced or
The method of two generations sequencing obtains.
Still further, the computational methods of the quantity ratio of the DNAa-PCR products DNA and DNAb-PCR product DNA：It is first
The sequencing result peak value figure that generation sequencing approach obtains DNAa-PCR product DNA and DNAb-PCR products DNA respectively is first passed through,
In the peak value figure of generation sequencing, the height at peak represents signal strength and DNA quantity, then according to the peak value figure meter of sequencing result
It calculates two kinds of bases at difference site and generates the strong and weak ratio of signal to get to DNAa-PCR product DNA and DNAb-PCR products DNA's
Quantity ratio by counting multiple difference sites power ratio, can statistically obtain the quantity of two kinds of sequences in PCR product
Than.
Still further, the computational methods of the quantity ratio of the DNAa-PCR products DNA and DNAb-PCR product DNA：It is first
It first passes through two generation sequencing approaches DNAa-PCR product DNA and DNAb-PCR products DNA is sequenced, counts two generation sequencing results
In the number that is tested of two kinds of DNA moleculars, the number that then comparison dna a-PCR products DNA and DNAb-PCR products DNA are tested, i.e.,
Quantity ratio for DNAa-PCR product DNA and DNAb-PCR products DNA.
Still further, the method for transformation is stable genetic transformation or instantaneous conversion；Wherein,
During the genetic transformation of the stabilization, two transcriptional units are inserted into as an entirety in the genome of acceptor material；
During the instantaneous conversion, acceptor material is the individual cells or histoorgan of dispersion；
The individual cells are bacterium, yeast, zooblast or plant protoplast；
Histoorgan is root, stem, leaf, flower, the heart, liver or kidney.Method for transformation can be agrobacterium-mediated transformation, particle bombardment,
Any method for transformation such as PEG mediated methods.
Still further, the DNAa sequences and DNAb sequences are arbitrary sequence or complete ORF,
Still further, the DNAa sequences and DNAb sequences are complete ORF.Particularly preferably common reporter gene
Such as Gus, Gfp reporter gene.
Preferably, the Assay of promoter activity method counted based on RNA, it is characterised in that：Include the following steps：
1) carrier of two transcriptional units is built
Using initial carrier pBWA (V) H as skeleton, structure obtains pARC-gfp carriers, sequence for shown in SEQ ID No.1,
Wherein,
It is included using one section of sequence on Gfp genes as DNAa, DNAb sequence, respectively such as SEQ ID No.2 and SEQ
Shown in ID No.3, particular sequence is as follows：
DNAa：
5’-TTCTTCAAGGACGACGGCAACTACAAGACGCGAGCTGAGGTGAAGTTCGAGGGCGACACGCTCGTC
AACCGTATCGAGCTCAAGGGAATCGACTTCAAGGAGGACGGAAACATTCTCGGACACAAGCTGGAGTACAACTACAA
CTCCCACAACGTTTACATAATGGCGGACAAGCAGAAGAACGGCATTAAGGCCAACTT-3’；
DNAb：
5’-TTCTTCAAGGACGACGGGAACTACAAGACCCGTGCAGAGGTCAAGTTCGAGGGGGACACCCTCGTG
AACAGAATCGAGCTCAAGGGTATCGACTTCAAGGAGGACGGTAACATACTCGGTCACAAGCTCGAGTACAACTACAA
CTCGCACAACGTATACATTATGGCCGACAAGCAGAAGAACGGGATAAAGGCCAACTT-3’。
It, which is further included, is inserted into reference to promoter Pa and target promoter Pb promoters, and multiple cloning sites are respectively：
MCS1：
5 '-GTTGTGAGACCTTTTTAAATTTTGGTCTCTTCTA-3 ',
MCS2：
5’-TAGCAGAGACGAAAATTTAAAAACGTCTCACACC-3’；
2) it is inserted into respectively with reference to promoter on the multiple cloning sites MCS1 of pARC-gfp carriers and multiple cloning sites MCS2
Pa and target promoter Pb；
3) carrier converts
By in vector introduction host cell, then in transformation receptor material, the genetic transformation of instantaneous conversion or stabilization is carried out；
4) total serum IgE is extracted
5) total serum IgE is inverted to cDNA
6) PCR amplification
The primer of DNA amplification a sequences and DNAb sequences simultaneously is capable of in design, is then expanded according to normal PCR programs；
7) interpretation of result
Obtain the sequencing knot of DNAa-PCR product DNA and DNAb-PCR products DNA respectively by generation sequencing approach first
Then fruit peak value figure calculates the strong and weak ratio of two kinds of bases generation signals at difference site, statistics according to the peak value figure of sequencing result
The ratio for two kinds of sequences that all signal strengths represent is averaged and obtains DNAa-PCR products DNA and DNAb-PCR production
The quantity ratio of object DNA, as with reference to promoter Pa relative to the relative activity ratio of target promoter Pb；
Alternatively, DNAa-PCR product DNA and DNAb-PCR products DNA is sequenced by two generation sequencing approaches first,
The number that two kinds of DNA moleculars are tested in two generation sequencing results is counted, then comparison dna a-PCR products DNA and DNAb-PCR products
The number that DNA is tested is to get to the quantity ratio of DNAa-PCR product DNA and DNAb-PCR products DNA, as with reference to promoter Pa
Relative to the relative activity ratio of target promoter Pb.
The beneficial effects of the present invention are：
The present invention can accurate quantification measure promoter activity；The present invention depends on the direct product to promoter driving gene
RNA is quantitative determined rather than other methods are the final translation product i.e. surveys of protein level that gene is driven for promoter
It is fixed；The present invention can obtain the result of promoter activity measure by instantaneous conversion in very short time；The present invention can not only measure
The promoter activity of plant can also measure animal and the promoter activity of other species.
Description of the drawings
Fig. 1 builds structure chart for carrier pARC-gfp；
Fig. 2 is sequencing peak value figure.
Specific embodiment
In order to preferably explain the present invention, below in conjunction with the specific embodiment main contents that the present invention is furture elucidated, but
Present disclosure is not limited solely to following embodiment.
Embodiment 1
Promoter Analysis carrier (the Promoter activity test counted based on RNA using Gfp as reporter gene
By RNA counts, PARC) design, illustrate this design simply to illustrate that the content of the invention, the realization of the invention
It is not limited thereto design, carrier name：pARC-gfp.
1st, using the sequence of one section of 200bp on Gfp genes or so as DNAa, DNAb sequence, respectively such as SEQ ID No.2
It is as follows with particular sequence shown in SEQ ID No.3：
DNAa：
5’-TTCTTCAAGGACGACGGCAACTACAAGACGCGAGCTGAGGTGAAGTTCGAGGGCGACACGCTCGTC
AACCGTATCGAGCTCAAGGGAATCGACTTCAAGGAGGACGGAAACATTCTCGGACACAAGCTGGAGTACAACTACAA
CTCCCACAACGTTTACATAATGGCGGACAAGCAGAAGAACGGCATTAAGGCCAACTT-3’；
DNAb：
5’-TTCTTCAAGGACGACGGGAACTACAAGACCCGTGCAGAGGTCAAGTTCGAGGGGGACACCCTCGTG
AACAGAATCGAGCTCAAGGGTATCGACTTCAAGGAGGACGGTAACATACTCGGTCACAAGCTCGAGTACAACTACAA
CTCGCACAACGTATACATTATGGCCGACAAGCAGAAGAACGGGATAAAGGCCAACTT-3’。
2nd, multiple cloning sites：Pa is inserted into, the multiple cloning sites of Pb promoters are respectively：
MCS1：
5’-GTTGTGAGACCTTTTTAAATTTTGGTCTCTTCTA-3’；
MCS2：
5’-TAGCAGAGACGAAAATTTAAAAACGTCTCACACC-3’。
3rd, insulator segment：It is present between two transcriptional units " being promoter-ORF- terminators " structure, prevents
It is interfered with each other between promoter.
4th, carrier framework selects：This programme selection plant expressing vector skeleton is that initial carrier pBWA (V) H (is purchased from city
), it can be with dual-purpose stable conversion and instantaneous conversion.
5th, pARC-gfp vector constructions：Carrier is by synthesizing public affairs according to designed sequence by full genome synthetic method
Department's synthesis obtains, and sequence is shown in SEQ ID No.1.If Fig. 1 is the pARC-gfp carriers that build, two transcriptions of carrier are single
Member, " one is the gfpA genes+terminator being transformed with reference to promoter Pa+ multiple cloning sites MCS1+；Another is startup to be measured
GfpB genes+terminator of sub- Pb+ multiple cloning sites MCS2+ transformations ", above-mentioned DNAa and DNAb are that gfpA, gfpB are read respectively
The segment of each 200bp in frame sequence.Wherein MCS1 is reference promoter area to be replaced, and MCS2 is target promoter area to be replaced.
This carrier is easy to build by conventional molecular biology method, and construction method repeats no more.
The verification result of the DNAa and DNAb of the different starting molar ratios of embodiment 2.
The present embodiment uses DNAa, DNAb solution for containing different starting molar ratios, and as PCR amplification template, verification is originally
It invents the experimental program proposed and obtains error correction parameter.
1st, 17 groups of DNAa, DNAb standard solution for containing different mol ratio are prepared, molar ratio is respectively 1:1,2:1,3:1,
4:1,5:1,6:1,7:1,8:1,10:1,1:2,1:3,1:4,1:5,1:6,1:7,1:8,1:10.
2nd, synthetic pcr primer object：PCR amplification is carried out with 17 pairs of primers respectively, this 17 pairs of primers have identical template
Sequence is matched, but every group of prime end sequence has a flag sequence of 6bp, flag sequence is during respectively difference is sequenced as two generations to every
The label that sequence is distinguished, but generation sequencing analysis is not influenced, primer is as follows：
P1F：5’-GATTACACCACCTTCTCCTACGGC-3 ', P1R：5’-GATTACCTTCTCGTTCGGGTCCTT-
3’；P2F：5’-TATACAACCACCTTCTCCTACGGC-3 ', P2R：5’-TATACACTTCTCGTTCGGGTCCTT-3’；P3F：
5’-CTATTAACCACCTTCTCCTACGGC-3 ', P3R：5’-CTATTACTTCTCGTTCGGGTCCTT-3’；P4F：5’-TCGAATACCACCTTCTCCTACGGC-3 ', P4R：5’-TCGAATCTTCTCGTTCGGGTCCTT-3’；P5F：5’-GTCTATACCACCTTCTCCTACGGC-3 ', P5R：5’-GTCTATCTTCTCGTTCGGGTCCTT-3’；P6F：5’-TTAATAACCACCTTCTCCTACGGC-3 ', P6R：5’-TTAATACTTCTCGTTCGGGTCCTT-3’；P7F：5’-GTCTAGACCACCTTCTCCTACGGC-3 ', P7R：5’-GTCTAGCTTCTCGTTCGGGTCCTT-3’；P8F：5’-TTATCAACCACCTTCTCCTACGGC-3 ', P8R：5’-TTATCACTTCTCGTTCGGGTCCTT-3’；P9F：5’-ATAAGCACCACCTTCTCCTACGGC-3 ', P9R：5’-ATAAGCCTTCTCGTTCGGGTCCTT-3’；P10F：5’-CTTAGTACCACCTTCTCCTACGGC-3 ', P10R：5’-CTTAGTCTTCTCGTTCGGGTCCTT-3’；P11F：5’-TGTACAACCACCTTCTCCTACGGC-3 ', P11R：5’-TGTACACTTCTCGTTCGGGTCCTT-3’；P12F：5’-ATTCATACCACCTTCTCCTACGGC-3 ', P12R：5’-ATTCATCTTCTCGTTCGGGTCCTT-3’；P13F：5’-CATCTGACCACCTTCTCCTACGGC-3 ', P13R：5’-CATCTGCTTCTCGTTCGGGTCCTT-3’；P14F：5’-GTCTAAACCACCTTCTCCTACGGC-3 ', P14R：5’-GTCTAACTTCTCGTTCGGGTCCTT-3’；P15F：5’-TCATTGACCACCTTCTCCTACGGC-3 ', P15R：5’-TCATTGCTTCTCGTTCGGGTCCTT-3’；P16F：5’-TGATAGACCACCTTCTCCTACGGC-3 ', P16R：5’-TGATAGCTTCTCGTTCGGGTCCTT-3’；
P17F：5’-AGCTTGACCACCTTCTCCTACGGC-3 ',
P17R：5’-AGCTTGCTTCTCGTTCGGGTCCTT-3’。
3rd, PCR amplification is operated according to existing standard experimental program, is had no especially.
4th, amplified production carries out generation sequencing or the sequencing of two generations.
5th, experimental result and data：
When DNAa, DNAb initial molar ratio are 1：When 1, the amplified production using it as template is after a generation is sequenced, system
The peak value that meter obtains that peak (shown in Fig. 2) is sequenced at distinguishing base is 230.3,210.7 respectively, i.e., DNAa and DNAb in PCR product
Molar ratio be still 1：1.Remaining each group PCR product obtained after statistics DNAa in the molar ratio and template of DNAa and DNAb,
The initial molar ratio of DNAb is identical.
When DNAa, DNAb initial molar ratio are 1：When 1, (two generations are sequenced by two generations using it as the amplified production of template
Sequencing uses the data volume of 1G) after, the reads numbers for measuring DNAa and DNAb in PCR product are 33324,34087 respectively,
I.e. the molar ratio of DNAa and DNAb is still 1 in PCR product：1.Remaining each group PCR product through reads numbers statistics after obtain DNAa with
The molar ratio of DNAb is identical with the initial molar ratio of DNAa, DNAb in template.
6th, experiment conclusion：The ratio and its starting molar of two kinds of DNA sequence dna, that is, DNAa, DNAb in product through PCR amplification
Ratio is identical.
The promoter of embodiment 3Ubi is in tobacco leaf instantaneous conversion verification result.
The present embodiment tobacco leaf makees acceptor material, measures activity of the Ubi promoters in tobacco leaf, and reference starts
Son is 35s promoters, and (can be also sequenced with a generation) is sequenced for two generations in sequencing approach.This programme be suitable for it is any can be straight with tissue
Connect the plant species that material is infected as Agrobacterium.
1st, vector construction, multiple cloning sites MCS1 is inserted by 35s promoters, and Ubi promoters are inserted into multiple cloning sites
MCS2, routinely vector construction flow.
2nd, build three carriers are converted into Agrobacterium EHA105.
3, tobacco leaf is injected by page disk injection, Agrobacterium is carried out and infects, operated according to existing standard experimental program
.
The tobacco leaf of conversion is collected when the 4th, infecting 72 hours, blade total serum IgE is extracted respectively, according to existing standard experiment side
Case operates.
5th, reverse transcription is operated into cDNA according to existing standard experimental program.
6th, design primer is expanded, these primers are identical with the position of template matches and sequence, each primer end
The flag sequence of end addition 6bp, for distinguishing the sequence that each pair of primer amplification goes out, primer is as follows：
P1F：5’-GATTACACCACCTTCTCCTACGGC-3 ',
P1R：5’-GATTACCTTCTCGTTCGGGTCCTT-3’；
P2F：5’-TATACAACCACCTTCTCCTACGGC-3 ',
P2R：5’-TATACACTTCTCGTTCGGGTCCTT-3’。
7th, the PCR product 1 for going out primer amplification：1, which mixes, carries out two generations sequencing (or respectively carrying out generation sequencing).
Sequencing result is analyzed：The reads numbers of DNAb that start of DNAa and Ubi promoters that 35s promoters start are respectively
158443,47559, i.e., the molar ratio of DNAa and DNAb is 3.33 in PCR product：1, show that 35s promoters start with Ubi
The activity of son is than being 3.33：1.
Embodiment 4Nos promoters are in tobacco leaf instantaneous conversion verification result.
The present embodiment tobacco leaf makees acceptor material, measures activity of the Nos promoters in tobacco leaf, and reference starts
Son is 35s promoters, and (can be also sequenced with a generation) is sequenced for two generations in sequencing approach.This programme be suitable for it is any can be straight with tissue
Connect the plant species that material is infected as Agrobacterium.
35s promoters are inserted into multiple cloning sites MCS1, Nos promoters are inserted into polyclonal position respectively by the 1st, vector construction
Point MCS2, routinely vector construction flow.
2nd, build three carriers are converted into Agrobacterium EHA105.
3, tobacco leaf is injected by page disk injection, Agrobacterium is carried out and infects, operated according to existing standard experimental program
.
The tobacco leaf of conversion is collected when the 4th, infecting 72 hours, blade total serum IgE is extracted respectively, according to existing standard experiment side
Case operates.
5th, reverse transcription is operated into cDNA according to existing standard experimental program.
6th, design primer is expanded, these primers are identical with the position of template matches and sequence, each primer end
The flag sequence of end addition 6bp, for distinguishing the sequence that each pair of primer amplification goes out, primer is as follows：
P1F：5’-GATTACACCACCTTCTCCTACGGC-3 ',
P1R：5’-GATTACCTTCTCGTTCGGGTCCTT-3’；
P2F：5’-TATACAACCACCTTCTCCTACGGC-3 ',
P2R：5’-TATACACTTCTCGTTCGGGTCCTT-3’。
7th, the PCR product 1 for going out primer amplification：1, which mixes, carries out two generations sequencing (or respectively carrying out generation sequencing).
Sequencing result is analyzed：The reads numbers of DNAb that start of DNAa and Nos promoters that 35s promoters start are respectively
185429,130489, i.e., the molar ratio of DNAa and DNAb is 1.42 in PCR product：1, show that 35s promoters are opened with Nos
The activity of mover is than being 1.42：1.
Embodiment 5G1090Promoter is in tobacco leaf instantaneous conversion verification result.
The present embodiment tobacco leaf makees acceptor material, measures G1090Activity of the promoter in tobacco leaf, reference open
Mover is 35s promoters, and (can be also sequenced with a generation) is sequenced for two generations in sequencing approach.This programme is suitable for any to use tissue
The plant species of material are infected directly as Agrobacterium.
35s promoters are inserted into multiple cloning sites MCS1, by G by the 1st, vector construction1090Promoter is inserted into polyclonal position respectively
Point MCS2, routinely vector construction flow.
2nd, build three carriers are converted into Agrobacterium EHA105.
3, tobacco leaf is injected by page disk injection, Agrobacterium is carried out and infects, operated according to existing standard experimental program
.
The tobacco leaf of conversion is collected when the 4th, infecting 72 hours, blade total serum IgE is extracted respectively, according to existing standard experiment side
Case operates.
5th, reverse transcription is operated into cDNA according to existing standard experimental program.
6th, design primer is expanded, these primers are identical with the position of template matches and sequence, each primer end
The flag sequence of end addition 6bp, for distinguishing the sequence that each pair of primer amplification goes out, primer is as follows：
P1F：5’-GATTACACCACCTTCTCCTACGGC-3 ',
P1R：5’-GATTACCTTCTCGTTCGGGTCCTT-3’；
P2F：5’-TATACAACCACCTTCTCCTACGGC-3 ',
P2R：5’-TATACACTTCTCGTTCGGGTCCTT-3’。
7th, the PCR product 1 for going out primer amplification：1, which mixes, carries out two generations sequencing (or respectively carrying out generation sequencing).
Sequencing result is analyzed：The DNAa and G that 35s promoters start1090The reads numbers of DNAb that promoter starts are respectively
125645,113149, i.e., the molar ratio of DNAa and DNAb is 1.11 in PCR product：1, obtain 35s promoters and G1090It opens
The activity of mover is than being 1.11：1.
Verification result of the embodiment 6Ubi promoters in rice protoplast.
The present embodiment rice protoplast makees acceptor material, measures work of the Ubi promoters in rice stem protoplast
Property, reference promoter is 35s promoters, and (can be also sequenced with a generation) is sequenced for two generations in sequencing approach.As long as the tissue can be made
Protoplast simultaneously can successful conversion, this programme is suitable for any plant species, any tissue site detects arbitrary promoter and lives
Property.
1st, vector construction, routinely vector construction flow, belongs to general technology, 35s promoters is inserted into polyclonal
Ubi promoters are inserted into multiple cloning sites MCS2 by site MCS1 respectively.
2nd, the plasmid of recombinant vector is extracted respectively, and concentration is not less than 100ng/ μ l.
3rd, it prepares rice protoplast and carries out plasmid conversion, operated according to existing standard experimental program.
4th, protoplast is collected in 12 to 72 hours and extracts total serum IgE respectively, operated according to existing standard experimental program.
5th, reverse transcription is into cDNA.
6th, design primer is expanded, and primer is identical with the position of template matches and sequence, and each prime end adds
Add the flag sequence of 6bp, for distinguishing the sequence that each pair of primer amplification goes out, primer is as follows：
P1F：5’-GATTACACCACCTTCTCCTACGGC-3 ',
P1R：5’-GATTACCTTCTCGTTCGGGTCCTT-3’；
P2F：5’-TATACAACCACCTTCTCCTACGGC-3 ',
P2R：5’-TATACACTTCTCGTTCGGGTCCTT-3’。
7th, the PCR product 1 for going out primer amplification:1, which mixes, carries out two generations sequencing (or respectively carrying out generation sequencing).
Sequencing result is analyzed：The reads numbers of DNAb that start of DNAa and Ubi promoters that 35s promoters start are respectively
205896,247395, i.e., the molar ratio of DNAa and DNAb is 0.83 in PCR product：1, show that 35s promoters are opened with Ubi
The activity of mover is than being 0.83：1.
Verification result of the embodiment 7Nos promoters in rice protoplast.
The present embodiment rice protoplast makees acceptor material, measures work of the Nos promoters in rice stem protoplast
Property, reference promoter is 35s promoters, and (can be also sequenced with a generation) is sequenced for two generations in sequencing approach.As long as the tissue can be made
Protoplast simultaneously can successful conversion, this programme is suitable for any plant species, any tissue site detects arbitrary promoter and lives
Property.
1st, vector construction, routinely vector construction flow, belongs to general technology, 35s promoters is inserted into polyclonal
Nos promoters are inserted into multiple cloning sites MCS2 by site MCS1 respectively.
2nd, the plasmid of this recombinant vector is extracted respectively, and concentration is not less than 100ng/ μ l.
3rd, it prepares rice protoplast and carries out plasmid conversion, operated according to existing standard experimental program.
4th, protoplast is collected in 12 to 72 hours and extracts total serum IgE respectively, operated according to existing standard experimental program.
5th, reverse transcription is into cDNA.
6th, design primer is expanded, and primer is identical with the position of template matches and sequence, and each prime end adds
Add the flag sequence of 6bp, for distinguishing the sequence that each pair of primer amplification goes out, primer is as follows：
P1F：5’-GATTACACCACCTTCTCCTACGGC-3 ',
P1R：5’-GATTACCTTCTCGTTCGGGTCCTT-3’；
P2F：5’-TATACAACCACCTTCTCCTACGGC-3 ',
P2R：5’-TATACACTTCTCGTTCGGGTCCTT-3’。
7th, the PCR product 1 for going out primer amplification:1, which mixes, carries out two generations sequencing (or respectively carrying out generation sequencing).
Sequencing result is analyzed：The reads numbers of DNAb that start of DNAa and Nos promoters that 35s promoters start are respectively
135596,27651, i.e., the molar ratio of DNAa and DNAb is 4.9 in PCR product：1, show that 35s promoters start with Nos
The activity of son is than being 4.9：1.
Embodiment 8G1090Verification result of the promoter in rice protoplast.
The present embodiment rice protoplast makees acceptor material, measures G1090Work of the promoter in rice stem protoplast
Property, reference promoter is 35s promoters, and (can be also sequenced with a generation) is sequenced for two generations in sequencing approach.As long as the tissue can be made
Protoplast simultaneously can successful conversion, this programme is suitable for any plant species, any tissue site detects arbitrary promoter and lives
Property.
1st, vector construction, routinely vector construction flow, belongs to general technology, 35s promoters is inserted into polyclonal
Site MCS1, by G1090Promoter is inserted into multiple cloning sites MCS2 respectively.
2nd, the plasmid of recombinant vector is extracted respectively, and concentration is not less than 100ng/ μ l.
3rd, it prepares rice protoplast and carries out plasmid conversion, operated according to existing standard experimental program.
4th, protoplast is collected in 12 to 72 hours and extracts total serum IgE respectively, operated according to existing standard experimental program.
5th, reverse transcription is into cDNA.
6th, design primer is expanded, and primer is identical with the position of template matches and sequence, and each prime end adds
Add the flag sequence of 6bp, for distinguishing the sequence that each pair of primer amplification goes out, primer is as follows：
P1F：5’-GATTACACCACCTTCTCCTACGGC-3 ',
P1R：5’-GATTACCTTCTCGTTCGGGTCCTT-3’；
P2F：5’-TATACAACCACCTTCTCCTACGGC-3 ',
P2R：5’-TATACACTTCTCGTTCGGGTCCTT-3’。
7th, the PCR product 1 for going out primer amplification:1, which mixes, carries out two generations sequencing (or respectively carrying out generation sequencing).
Sequencing result is analyzed：The DNAa and G that 35s promoters start1090The reads numbers of DNAb that promoter starts are respectively
178459,143568, i.e., the molar ratio of DNAa and DNAb is 1.24 in PCR product：1, obtain 35s promoters and G1090It opens
The activity of mover is than being 1.24：1.
The test starting activity in zooblast of embodiment 9
The present embodiment is acceptor material with 293T cells, measures the activity of EF1 α promoters, and reference promoter starts for CMV
(can be also sequenced with a generation) is sequenced for two generations in son, sequencing approach.This programme is suitable for any zooblast, any tissue site is verified
Arbitrary promoter activity.
1st, vector construction, routinely vector construction flow, belongs to general technology, CMV promoter is inserted into polyclonal
EF1 α promoters are inserted into multiple cloning sites MCS2 by site MCS1；It extracts plasmid and is used for follow-up genetic transformation.
2nd, it uses3000 reagents prepare Plasmid DNA-liposome complex.
3rd, inoculating cell makes to reach 70% degree of converging during its transfection.
4th, it adds in DNA- liposome complexes to cell, 37 DEG C of incubated cells 3 days.
5th, cell is collected, extracts total serum IgE, reverse transcription is into cDNA.
6th, design primer is expanded, and primer is as follows：
P1F：5’-GATTACACCACCTTCTCCTACGGC-3 ',
P1R：5’-CTATTAGCTTCTCGTTCGGGTCCTT-3’；
P2F：5’-TATACAACCACCTTCTCCTACGGC-3 ',
P2R：5’-GTATCAGCTTCTCGTTCGGGTCCTT-3’；
7th, sequencing result is analyzed：The reads for the DNAb that the DNAa that CMV promoter starts starts with EF1 α promoters
Number is 195748,159559 respectively, i.e., the molar ratio of DNAa and DNAb is 1.23 in PCR product：1, obtain 35s promoters
Activity with Ubi promoters is than being 1.23：1.
Activity of 10 plant stability of the embodiment conversion test Ubi promoters in plant different tissues
The present embodiment is acceptor material with rice root, measures activity of the Ubi promoters in rice different tissues, and reference opens
Mover is 35s promoters, and (can be also sequenced with a generation) is sequenced for two generations in sequencing approach.This programme is suitable for any plant species, appoints
What tissue site verifies arbitrary promoter activity.
1st, vector construction, routinely vector construction flow, belongs to general technology, 35s promoters is inserted into polyclonal
Ubi promoters are inserted into multiple cloning sites MCS2 by site MCS1；It extracts plasmid and is used for follow-up genetic transformation.
2nd, the carrier built is transferred to Agrobacterium EHA105, is operated for follow-up Transgenic Rice.
3rd, transgeneic procedure (routine techniques) is operated according to existing standard experimental program.
4th, rice cultivation seedling takes the tissues such as root, stem, leaf, flower, extracts total serum IgE (standard rna extraction step) respectively.
5th, reverse transcription is into cDNA.
6th, design is drawn 4 pairs of objects and is expanded, and 4 pairs of primers are identical with the position of template matches and sequence, each primer
The flag sequence of 6bp is added in end, and for distinguishing the sequence that each pair of primer amplification goes out, primer is as follows：
P1F：5 '-GATTACACCACCTTCTCCTACGGC-3 ',
P1R：5’-GATTACCTTCTCGTTCGGGTCCTT-3’；
P2F：5 '-TATACAACCACCTTCTCCTACGGC-3 ',
P2R：5’-TATACACTTCTCGTTCGGGTCCTT-3’；
P3F：5 '-CTATTAACCACCTTCTCCTACGGC-3 ',
P3R：5’-CTATTACTTCTCGTTCGGGTCCTT-3’；
P4F：5 '-TCGAATACCACCTTCTCCTACGGC-3 ',
P4R：5’-TCGAATCTTCTCGTTCGGGTCCTT-3’.
7th, the PCR product 1 for going out 4 pairs of primer amplifications:1, which mixes, carries out the sequencing of two generations.Sequencing result is analyzed：
The reads numbers for the DNAb that the DNAa that 35s promoters start starts with Ubi promoters are 158794 and 191474 in root, in stem
In for 184965 and 222143, be 154712 and 180548 in leaf, be 124986 and 150478 in spending, is i.e. 35s promoters
With Ubi promoters activity root, stem, leaf, spend in be 1：1.2.
Ubi promoter activities are quickly tested in instantaneous conversion in 11 plant tissue of embodiment.
The present embodiment is acceptor material with rice callus, activity of the fast verification Ubi promoters in rice callus, reference
Promoter is 35s promoters.This programme is suitable for any plant species, any tissue site verifies arbitrary promoter activity.
1st, containing there are two the synthesis of the segment of transcriptional units：By full genome synthetic method by the sequence of design by synthesizing public affairs
Department's synthesis obtains, the main element of this DNA fragmentation is 35s promoter-gfpA- terminators and Ubi promoter-gfpB- terminators,
This DNA fragmentation is converted for subsequent gene rifle again.
2nd, rice cultivation seedling collects paddy rice root tip tissue, organization of root tips is bombarded with standard gene rifle conversion method, after conversion
Plant tissue preculture -5 days 2 days on plant MS culture mediums.
3rd, the organization of root tips of culture, extraction total serum IgE (standard rna extraction step) are collected.
4th, reverse transcription is into cDNA.
5th, design primer is expanded, and primer is as follows：
P1F：5’-GATTACACCACCTTCTCCTACGGC-3 ',
P1R：5’-CTATTAGCTTCTCGTTCGGGTCCTT-3’；
P2F：5’-TATACAACCACCTTCTCCTACGGC-3 ',
P2R：5’-GTATCAGCTTCTCGTTCGGGTCCTT-3’。
6th, sequencing result is analyzed：The reads for the DNAb that the DNAa that 35s promoters start starts with Ubi promoters
Number is 159683,196410 respectively, i.e. 35s promoters and the activity ratio of Ubi promoters is 1：1.23.
G is quickly tested in instantaneous conversion in 12 plant tissue of embodiment1090Promoter activity.
The present embodiment rice protoplast makees acceptor material, measures G1090Work of the promoter in rice stem protoplast
Property, reference promoter is rbcs2 promoters, and (can be also sequenced with a generation) is sequenced for two generations in sequencing approach.As long as the group can be made
The protoplast knitted simultaneously can successful conversion, this programme is suitable for any plant species, any tissue site detects arbitrary promoter
Activity.
1st, vector construction, routinely vector construction flow, belongs to general technology, and rbcs2 promoters are inserted into more grams
Grand site MCS1, by G1090Promoter is inserted into multiple cloning sites MCS2 respectively.
2nd, the plasmid of recombinant vector is extracted respectively, and concentration is not less than 100ng/ μ l.
3rd, it prepares rice protoplast and carries out plasmid conversion, operated according to existing standard experimental program.
4th, protoplast is collected in 12 to 72 hours and extracts total serum IgE respectively, operated according to existing standard experimental program.
5th, reverse transcription is into cDNA.
6th, design primer is expanded, and primer is identical with the position of template matches and sequence, and each prime end adds
Add the flag sequence of 6bp, for distinguishing the sequence that each pair of primer amplification goes out, primer is as follows：
P1F：5’-GATTACACCACCTTCTCCTACGGC-3 ',
P1R：5’-GATTACCTTCTCGTTCGGGTCCTT-3’；
P2F：5’-TATACAACCACCTTCTCCTACGGC-3 ',
P2R：5’-TATACACTTCTCGTTCGGGTCCTT-3’。
7th, the PCR product 1 for going out primer amplification:1, which mixes, carries out two generations sequencing (or respectively carrying out generation sequencing).
Sequencing result is analyzed：The DNAa and G that rbcs2 promoters start1090The reads numbers of DNAb that promoter starts are respectively
167845,129520, i.e., the molar ratio of DNAa and DNAb is 1.3 in PCR product：1, obtain rbcs2 promoters and G1090
The activity of promoter is than being 1.3：1.
Other unspecified parts are the prior art.Although above-described embodiment is made that the present invention and retouches in detail
State, but it be only part of the embodiment rather than whole embodiments of the present invention, people can also according to the present embodiment without
Other embodiment is obtained under the premise of creativeness, these embodiments belong to the scope of the present invention.
Sequence table
<110>Wuhan Biorun Bio-Tech. Co., Ltd.
<120>For the carrier for analyzing promoter activity and the Assay of promoter activity method counted based on RNA
<160> 3
<170> SIPOSequenceListing 1.0
<210> 1
<211> 11017
<212> DNA
<213>PARC-gfp carriers (pARC-gfp)
<400> 1
tagaatagca tcggtaacat gagcaaagtc tgccgcctta caacggctct cccgctgacg 60
ccgtcccgga ctgatgggct gcctgtatcg agtggtgatt ttgtgccgag ctgccggtcg 120
gggagctgtt ggctggctgg tggcaggata tattgtggtg taaacaaatt gacgcttaga 180
caacttaata acacattgcg gacgttttta atgttagact gaattaacgc cgaattaatt 240
cgggggatct ggattttagt actggatttt ggttttagga attagaaatt ttattgatag 300
aagtatttta caaatacaaa tacatactaa gggtttctta tatgctcaac acatgagcga 360
aaccctatag gaaccctaat tcccttatct gggaactact cacacattat tatggagaaa 420
ctcgagcttg tcgatcgaca gatccggtcg gcatctactc tatttctttg ccctcggacg 480
agtgctgggg cgtcggtttc cactatcggc gagtacttct acacagccat cggtccagac 540
ggccgcgctt ctgcgggcga tttgtgtacg cccgacagtc ccggctccgg atcggacgat 600
tgcgtcgcat cgaccctgcg cccaagctgc atcatcgaaa ttgccgtcaa ccaagctctg 660
atagagttgg tcaagaccaa tgcggagcat atacgcccgg agtcgtggcg atcctgcaag 720
ctccggatgc ctccgctcga agtagcgcgt ctgctgctcc atacaagcca accacggcct 780
ccagaagaag atgttggcga cctcgtattg ggaatccccg aacatcgcct cgctccagtc 840
aatgaccgct gttatgcggc cattgtccgt caggacattg ttggagccga aatccgcgtg 900
cacgaggtgc cggacttcgg ggcagtcctc ggcccaaagc atcagctcat cgagagcctg 960
cgcgacggac gcactgacgg tgtcgtccat cacagtttgc cagtgataca catggggatc 1020
agcaatcgcg catatgaaat cacgccatgt agtgtattga ccgattcctt gcggtccgaa 1080
tgggccgaac ccgctcgtct ggctaagatc ggccgcagcg atcgcatcca tagcctccgc 1140
gaccggttgt agaacagcgg gcagttcggt ttcaggcagg tcttgcaacg tgacaccctg 1200
tgcacggcgg gagatgcaat aggtcaggct ctcgctaaac tccccaatgt caagcacttc 1260
cggaatcggg agcgcggccg atgcaaagtg ccgataaaca taacgatctt tgtagaaacc 1320
atcggcgcag ctatttaccc gcaggacata tccacgccct cctacatcga agctgaaagc 1380
acgagattct tcgccctccg agagctgcat caggtcggag acactgtcga acttttcgat 1440
cagaaacttc tcgacagacg tcgcggtgag ttcaggcttt ttcatatctc attgcccccc 1500
cggatctgcg aaagctcgag agagatagat ttgtagagag agactggtga tttcagcgtg 1560
tcctctccaa atgaaatgaa cttccttata tagaggaagg tcttgcgaag gatagtggga 1620
ttgtgcgtca tcccttacgt cagtggagat atcacatcaa tccacttgct ttgaagacgt 1680
ggttggaacg tcttcttttt ccacgatgct cctcgtgggt gggggtccat ctttgggacc 1740
actgtcggca gaggcatctt gaacgatagc ctttccttta tcgcaatgat ggcatttgta 1800
ggtgccacct tccttttcta ctgtcctttt gatgaagtga cagatagctg ggcaatggaa 1860
tccgaggagg tttcccgata ttaccctttg ttgaaaagtc tcaatagccc tttggtcttc 1920
tgagactgta tctttgatat tcttggagta gacgagagtg tcgtgctcca ccatgttatc 1980
acatcaatcc acttgctttg aagacgtggt tggaacgtct tctttttcca cgatgctcct 2040
cgtgggtggg ggtccatctt tgggaccact gtcggcagag gcatcttgaa cgatagcctt 2100
tcctttatcg caatgatggc atttgtaggt gccaccttcc ttttctactg tccttttgat 2160
gaagtgacag atagctgggc aatggaatcc gaggaggttt cccgatatta ccctttgttg 2220
aaaagtctca atagcccttt ggtcttctga gactgtatct ttgatattct tggagtagac 2280
gagagtgtcg tgctccacca tgttggcaag ctgctctagc caatacgcaa accgcctgca 2340
ggtctagatt ctagtttttt ttttaggcca tccgctacag tgcggatggc ccgatctagt 2400
aacatagatg acaccgcgcg cgataattta tcctagtttg cgcgctatat tttgttttct 2460
atcgcgtatt aaatgtataa ttgcgggact ctaatcataa aaacccatct cataaataac 2520
gtcatgcatt acatgttaat tattacatgc ttaacgtaat tcaacagaaa ttatatgata 2580
atcatcgcaa gaccggcaac aggattcaat cttaagaaac tttattgcca aatgtttgaa 2640
cgatcgggga aattcgagct ggtcagtctt cgggcccagt actgaagaca gagctagtta 2700
cattttgcag gtgaggtgct ctcacctgca tcagttgtag agctcgtcca tgccgtgggt 2760
gatgccggcg gcggtcacga actcgaggag caccatgtgg tcgcgcttct cgttcgggtc 2820
cttggagagg gcgctctggg tggagaggta gtggttgtcc gggaggagca ccgggccgtc 2880
gccgatcggg gtgttctgct ggtagtggtc ggcgagctgc acgccgccgt cctcgatgtt 2940
gtggcgggtc ttgaagttgg ccttaatgcc gttcttctgc ttgtccgcca ttatgtaaac 3000
gttgtgggag ttgtagttgt actccagctt gtgtccgaga atgtttccgt cctccttgaa 3060
gtcgattccc ttgagctcga tacggttgac gagcgtgtcg ccctcgaact tcacctcagc 3120
tcgcgtcttg tagttgccgt cgtccttgaa gaagatggtg cgctcctgca cgtagccctc 3180
cggcatggcg gacttgaaga agtcgtggcg cttcatgtgg tccgggtagc gggagaagca 3240
ctgcacgccg taggagaagg tggtcacgag ggtcggccac ggcaccggga gcttgccggt 3300
ggtgcagatg aacttgaggg tgagcttgcc gtaggtggcg tcgccctcgc cctcgccgga 3360
cacggagaac ttgtggccgt tcacgtcgcc gtcgagctcc acgaggatcg gcaccacgcc 3420
ggtgaagagt tcctcgccct tcaccatggt tgtgagacct ttttaaattt tggtctcttc 3480
taaaagccta tactgtactt aacttgattg cataattact tgatcataga ctcatagtaa 3540
acttgattac acagataagt gaagaaacaa accaattcaa gacataacca aagagaggtg 3600
aaagactgtt ttatatgtct aacattgcac cttaatatca cactgttagt tcctttctta 3660
cttaaattca acccattaaa gtaaaaacaa cagataataa taatttgaga atgaacaaaa 3720
ggaccatatc atttattaac tcttatccat ccatttgcat tttgatgtcc gaaaacaaaa 3780
actgaaagaa cacagtaaat tacaagcaga acaaatgata gaagaaaaca gcttttccaa 3840
tgccataata ctcaaactta gtaggattct ggtgtgtggg caatgaaact gatgcattga 3900
acttgacgaa cgttgtcgaa accgatgata cggacgaaag ctgggaggcc tggtcgtaga 3960
tgtagtcggc ttgcggataa agaataacta aataaataaa ttgcaagcaa ttgttttgct 4020
gctatgtact gtccagtctt tcgactaatg atgataaagc ctctctttat ccttatgttt 4080
gttctttact tctacagtaa tgttcgaaaa taagcaattg ttttgttctg taatccataa 4140
aaatataaca cccctttaag tagttatttg aatgacccac cataaaatta atacgcatgc 4200
cacggctatc aaggttccac tgcaccgaag catttaggga agctcaccgc actggtcttc 4260
ttacttcaca ggagaagggc aaaggccttg gccaagatgc agataagaaa tgactactcc 4320
aattcaaaga ttttattaca ttcaatgaac attggaagga aaattttaat aggagtacga 4380
aaaaaaacca gaattattta caatacaata gcagagacga aaatttaaaa acgtctcaca 4440
ccatggtgaa gggcgaggaa ctcttcaccg gcgtggtgcc gatcctcgtg gagctcgacg 4500
gcgacgtgaa cggccacaag ttctccgtgt ccggcgaggg cgagggcgac gccacctacg 4560
gcaagctcac cctcaagttc atctgcacca ccggcaagct cccggtgccg tggccgaccc 4620
tcgtgaccac cttctcctac ggcgtgcagt gcttctcccg ctacccggac cacatgaagc 4680
gccacgactt cttcaagtcc gccatgccgg agggctacgt gcaggagcgc accatcttct 4740
tcaaggacga cgggaactac aagacccgtg cagaggtcaa gttcgagggg gacaccctcg 4800
tgaacagaat cgagctcaag ggtatcgact tcaaggagga cggtaacata ctcggtcaca 4860
agctcgagta caactacaac tcgcacaacg tatacattat ggccgacaag cagaagaacg 4920
ggataaaggc caacttcaag acccgccaca acatcgagga cggcggcgtg cagctcgccg 4980
accactacca gcagaacacc ccgatcggcg acggcccggt gctcctcccg gacaaccact 5040
acctctccac ccagagcgcc ctctccaagg acccgaacga gaagcgcgac cacatggtgc 5100
tcctcgagtt cgtgaccgcc gccggcatca cccacggcat ggacgagctc tacaactgat 5160
gcaggtgaga gcacctcacc tgcaaaatgt aactagctct gtcttcagta ctgggcccga 5220
agactgacca gctcgaattt ccccgatcgt tcaaacattt ggcaataaag tttcttaaga 5280
ttgaatcctg ttgccggtct tgcgatgatt atcatataat ttctgttgaa ttacgttaag 5340
catgtaataa ttaacatgta atgcatgacg ttatttatga gatgggtttt tatgattaga 5400
gtcccgcaat tatacattta atacgcgata gaaaacaaaa tatagcgcgc aaactaggat 5460
aaattatcgc gcgcggtgtc atctatgtta ctagatcggg ccatccgcac tgtagcggat 5520
ggcctaaaaa aaaaactaga agtcgcagtc ataacttcgt atagcataca ttatacgaag 5580
ttatgggccg cattaccctg ttatccctag gccgcataac ttcgtatagc ctacattata 5640
ggatggaggg atatcctctc ttaaggtagc gagcaagctc taagaggagt gtcgacaagc 5700
ttggcactgg ccgtcgtttt acaacgtcgt gactgggaaa accctggcgt tacccaactt 5760
aatcgccttg cagcacatcc ccctttcgcc agctggcgta atagcgaaga ggcccgcacc 5820
gatcgccctt cccaacagtt gcgcagcctg aatggcgaat gctagagcag cttgagcttg 5880
gatcagattg tcgtttcccg ccttcagttt aaactatcag tgtttgacag gatatattgg 5940
cgggtaaacc taagagaaaa gagcgtttat tagaataacg gatatttaaa agggcgtgaa 6000
aaggtttatc cgttcgtcca tttgtatgtg catgccaacc acagggttcc cctcgggatc 6060
aaagtacttt gatccaaccc ctccgctgct atagtgcagt cggcttctga cgttcagtgc 6120
aggagatgat cgcggccggg tacgtgttcg agccgcccgc gcatgtctca accgtgcggc 6180
tgcatgaaat cctggccggt ttgtctgatg ccaagctggc ggcctggccg gccagcttgg 6240
ccgctgaaga aaccgagcgc cgccgtctaa aaaggtgatg tgtatttgag taaaacagct 6300
tgcgtcatgc ggtcgctgcg tatatgatgc gatgagtaaa taaacaaata cgcaagggga 6360
acgcatgaag gttatcgctg tacttaacca gaaaggcggg tcaggcaaga cgaccatcgc 6420
aacccatcta gcccgcgccc tgcaactcgc cggggccgat gttctgttag tcgattccga 6480
tccccagggc agtgcccgcg attgggcggc cgtgcgggaa gatcaaccgc taaccgttgt 6540
cggcatcgac cgcccgacga ttgaccgcga cgtgaaggcc atcggccggc gcgacttcgt 6600
agtgatcgac ggagcgcccc aggcggcgga cttggctgtg tccgcgatca aggcagccga 6660
cttcgtgctg attccggtgc agccaagccc ttacgacata tgggccaccg ccgacctggt 6720
ggagctggtt aagcagcgca ttgaggtcac ggatggaagg ctacaagcgg cctttgtcgt 6780
gtcgcgggcg atcaaaggca cgcgcatcgg cggtgaggtt gccgaggcgc tggccgggta 6840
cgagctgccc attcttgagt cccgtatcac gcagcgcgtg agctacccag gcactgccgc 6900
cgccggcaca accgttcttg aatcagaacc cgagggcgac gctgcccgcg aggtccaggc 6960
gctggccgct gaaattaaat caaaactcat ttgagttaat gaggtaaaga gaaaatgagc 7020
aaaagcacaa acacgctaag tgccggccgt ccgagcgcac gcagcagcaa ggctgcaacg 7080
ttggccagcc tggcagacac gccagccatg aagcgggtca actttcagtt gccggcggag 7140
gatcacacca agctgaagat gtacgcggta cgccaaggca agaccattac cgagctgcta 7200
tctgaataca tcgcgcagct accagagtaa atgagcaaat gaataaatga gtagatgaat 7260
tttagcggct aaaggaggcg gcatggaaaa tcaagaacaa ccaggcaccg acgccgtgga 7320
atgccccatg tgtggaggaa cgggcggttg gccaggcgta agcggctggg ttgtctgccg 7380
gccctgcaat ggcactggaa cccccaagcc cgaggaatcg gcgtgacggt cgcaaaccat 7440
ccggcccggt acaaatcggc gcggcgctgg gtgatgacct ggtggagaag ttgaaggccg 7500
cgcaggccgc ccagcggcaa cgcatcgagg cagaagcacg ccccggtgaa tcgtggcaag 7560
cggccgctga tcgaatccgc aaagaatccc ggcaaccgcc ggcagccggt gcgccgtcga 7620
ttaggaagcc gcccaagggc gacgagcaac cagatttttt cgttccgatg ctctatgacg 7680
tgggcacccg cgatagtcgc agcatcatgg acgtggccgt tttccgtctg tcgaagcgtg 7740
accgacgagc tggcgaggtg atccgctacg agcttccaga cgggcacgta gaggtttccg 7800
cagggccggc cggcatggcc agtgtgtggg attacgacct ggtactgatg gcggtttccc 7860
atctaaccga atccatgaac cgataccggg aagggaaggg agacaagccc ggccgcgtgt 7920
tccgtccaca cgttgcggac gtactcaagt tctgccggcg agccgatggc ggaaagcaga 7980
aagacgacct ggtagaaacc tgcattcggt taaacaccac gcacgttgcc atgcagcgta 8040
cgaagaaggc caagaacggc cgcctggtga cggtatccga gggtgaagcc ttgattagcc 8100
gctacaagat cgtaaagagc gaaaccgggc ggccggagta catcgagatc gagctagctg 8160
attggatgta ccgcgagatc acagaaggca agaacccgga cgtgctgacg gttcaccccg 8220
attacttttt gatcgatccc ggcatcggcc gttttctcta ccgcctggca cgccgcgccg 8280
caggcaaggc agaagccaga tggttgttca agacgatcta cgaacgcagt ggcagcgccg 8340
gagagttcaa gaagttctgt ttcaccgtgc gcaagctgat cgggtcaaat gacctgccgg 8400
agtacgattt gaaggaggag gcggggcagg ctggcccgat cctagtcatg cgctaccgca 8460
acctgatcga gggcgaagca tccgccggtt cctaatgtac ggagcagatg ctagggcaaa 8520
ttgccctagc aggggaaaaa ggtcgaaaag atctctttcc tgtggatagc acgtacattg 8580
ggaacccaaa gccgtacatt gggaaccgga acccgtacat tgggaaccca aagccgtaca 8640
ttgggaaccg gtcacacatg taagtgactg atataaaaga gaaaaaaggc gatttttccg 8700
cctaaaactc tttaaaactt attaaaactc ttaaaacccg cctggcctgt gcataactgt 8760
ctggccagcg cacagccgaa gctcccggat acggtcacag cttgtctgta agcggatgcc 8820
gggagcagac aagcccgtca gggcgcgtca gcgggtgttg gcgggtgtcg gggcgcagcc 8880
atgacccagt cacgtagcga tagcggagtg tatactggct taactatgcg gcatcagagc 8940
agattgtact gagagtgcac catatgcggt gtgaaatacc gcacagatgc gtaaggagaa 9000
aataccgcat caggcgttca tccgcttcct cgctcactga ctcgctgcgc tcggtcgttc 9060
ggctgcggcg agcggtatca gctcactcaa aggcggtaat acggttatcc acagaatcag 9120
gggataacgc aggaaagaac atgtgagcaa aaggccagca aaaggccagg aaccgtaaaa 9180
aggccgcgtt gctggcgttt ttccataggc tccgcccccc tgacgagcat cacaaaaatc 9240
gacgctcaag tcagaggtgg cgaaacccga caggactata aagataccag gcgtttcccc 9300
ctggaagctc cctcgtgcgc tctcctgttc cgaccctgcc gcttaccgga tacctgtccg 9360
cctttctccc ttcgggaagc gtggcgcttt ctcatagctc acgctgtagg tatctcagtt 9420
cggtgtaggt cgttcgctcc aagctgggct gtgtgcacga accccccgtt cagcccgacc 9480
gctgcgcctt atccggtaac tatcgtcttg agtccaaccc ggtaagacac gacttatcgc 9540
cactggcagc agccactggt aacaggatta gcagagcgag gtatgtaggc ggtgctacag 9600
agttcttgaa gtggtggcct aactacggct acactagaag gacagtattt ggtatctgcg 9660
ctctgctgaa gccagttacc ttcggaaaaa gagttggtag ctcttgatcc ggcaaacaaa 9720
ccaccgctgg tagcggtggt ttttttgttt gcaagcagca gattacgcgc agaaaaaaag 9780
gatctcaaga agatcctttg atcttttcta cggggtctga cgctcagtgg aacgaaaact 9840
cacgttaagg gattttggtc atgcattcta ggtactaaaa caattcatcc agtaaaatat 9900
aatattttat tttctcccaa tcaggcttga tccccagtaa gtcaaaaaat agctcgacat 9960
actgttcttc cccgatatcc tccctgatcg accggacgca gaaggcaatg tcataccact 10020
tgtccgccct gccgcttctc ccaagatcaa taaagccact tactttgcca tctttcacaa 10080
agatgttgct gtctcccagg tcgccgtggg aaaagacaag ttcctcttcg ggcttttccg 10140
tctttaaaaa atcatacagc tcgcgcggat ctttaaatgg agtgtcctct tcccagtttt 10200
cgcaatccac atcggccaga tcgttattca gtaagtaatc caattcggct aagcggctgt 10260
ctaagctatt cgtataggga caatccgata tgtcgatgga gtgaaagagc ctgatgcact 10320
ccgcatacag ctcgataatc ttttcagggc tttgttcatc ttcatactct tccgagcaaa 10380
ggacgccatc ggcctcactc atgagcagat tgctccagcc atcatgccgt tcaaagtgca 10440
ggacctttgg aacaggcagc tttccttcca gccatagcat catgtccttt tcccgttcca 10500
catcataggt ggtcccttta taccggctgt ccgtcatttt taaatatagg ttttcatttt 10560
ctcccaccag cttatatacc ttagcaggag acattccttc cgtatctttt acgcagcggt 10620
atttttcgat cagttttttc aattccggtg atattctcat tttagccatt tattatttcc 10680
ttcctctttt ctacagtatt taaagatacc ccaagaagct aattataaca agacgaactc 10740
caattcactg ttccttgcat tctaaaacct taaataccag aaaacagctt tttcaaagtt 10800
gttttcaaag ttggcgtata acatagtatc gacggagccg attttgaaac cgcggtgatc 10860
acaggcagca acgctctgtc atcgttacaa tcaacatgct accctccgcg agatcatccg 10920
tgtttcaaac ccggcagctt agttgccgtt cttccgaata gcatcggtaa catgagcaaa 10980
gtctgccgcc ttacaacggc tctcccgctg acgccgt 11017
<210> 2
<211> 200
<212> DNA
<213>Artificial sequence (Synthetic sequence)
<400> 2
ttcttcaagg acgacggcaa ctacaagacg cgagctgagg tgaagttcga gggcgacacg 60
ctcgtcaacc gtatcgagct caagggaatc gacttcaagg aggacggaaa cattctcgga 120
cacaagctgg agtacaacta caactcccac aacgtttaca taatggcgga caagcagaag 180
aacggcatta aggccaactt 200
<210> 3
<211> 200
<212> DNA
<213>Artificial sequence (Synthetic sequence)
<400> 3
ttcttcaagg acgacgggaa ctacaagacc cgtgcagagg tcaagttcga gggggacacc 60
ctcgtgaaca gaatcgagct caagggtatc gacttcaagg aggacggtaa catactcggt 120
cacaagctcg agtacaacta caactcgcac aacgtataca ttatggccga caagcagaag 180
aacgggataa aggccaactt 200
Claims (10)
1. a kind of carrier for being used to analyze promoter activity, it is characterised in that：There are two transcribe for setting on the skeleton of the carrier
Unit, respectively transcriptional units A and transcriptional units B, the transcriptional units A include reference promoter Pa, DNAa sequence to be compared
Row and terminator；The transcriptional units B includes target promoter Pb, DNAb sequence and terminator to be compared；Wherein, it is described
DNAa sequences and DNAb sequences are from same sequence, and the Individual base between DNAa and DNAb has differences.
2. it is used to analyze the carrier of promoter activity according to claim 1, it is characterised in that：The DNAa sequences and DNAb
Sequence is arbitrary sequence or complete ORF.
3. it is used to analyze the carrier of promoter activity according to claim 2, it is characterised in that：The carrier is pARC-gfp
Carrier, sequence for shown in SEQ ID No.1, wherein,
It is included using one section of sequence on Gfp genes as DNAa, DNAb sequence, respectively such as SEQ ID No.2 and SEQ ID
Shown in No.3, particular sequence is as follows：
DNAa：
5’-TTCTTCAAGGACGACGGCAACTACAAGACGCGAGCTGAGGTGAAGTTCGAGGGCGACACGCTCGTCAACC
GTATCGAGCTCAAGGGAATCGACTTCAAGGAGGACGGAAACATTCTCGGACACAAGCTGGAGTACAACTACAACTCC
CACAACGTTTACATAATGGCGGACAAGCAGAAGAACGGCATTAAGGCCAACTT-3’；
DNAb：
5’-TTCTTCAAGGACGACGGGAACTACAAGACCCGTGCAGAGGTCAAGTTCGAGGGGGACACCCTCGTGAACA
GAATCGAGCTCAAGGGTATCGACTTCAAGGAGGACGGTAACATACTCGGTCACAAGCTCGAGTACAACTACAACTCG
CACAACGTATACATTATGGCCGACAAGCAGAAGAACGGGATAAAGGCCAACTT-3’；
It, which is further included, is inserted into reference to promoter Pa and target promoter Pb promoters, and multiple cloning sites are respectively：
MCS1：
5’-GTTGTGAGACCTTTTTAAATTTTGGTCTCTTCTA-3’；
MCS2：
5’-TAGCAGAGACGAAAATTTAAAAACGTCTCACACC-3’。
A kind of 4. Assay of promoter activity method counted based on RNA, it is characterised in that：DNA molecular or carrier are turned first
It in entering into host cell, is then converted, then total serum IgE is extracted to acceptor material, it includes corresponding RNAa and RNAb, then
Reverse transcription is cDNA, is respectively template with this cDNA, the specificity all to be matched using a pair of and DNAa sequences and DNAb sequences
DNA primer carries out PCR, obtains DNAa-PCR products DNA and DNAb-PCR product DNA, calculate DNAa-PCR products DNA with
The quantity ratio of DNAb-PCR products DNA, as with reference to promoter Pa relative to the relative activity ratio of target promoter Pb；Wherein,
Transcriptional units there are two being respectively provided on the skeleton of DNA molecular or carrier, respectively transcriptional units A and transcriptional units B, described turn
It records unit A and includes reference promoter Pa, DNA sequence dna DNAa and terminator to be compared；The transcriptional units B includes to be compared
Target promoter Pb, DNA sequence dna DNAb and terminator；Wherein, the DNAa and DNAb derive from same sequence, and DNAa and
Individual base between DNAb has differences.
5. the Assay of promoter activity method counted according to claim 4 based on RNA, it is characterised in that：The DNAa-
The method that the quantity ratio of PCR product DNA and DNAb-PCR product DNA is sequenced by a generation or two generations were sequenced obtains.
6. the Assay of promoter activity method counted according to claim 5 based on RNA, it is characterised in that：The DNAa-
The computational methods of the quantity ratio of PCR product DNA and DNAb-PCR product DNA：It is obtained respectively by generation sequencing approach first
Then the sequencing result peak value figure of DNAa-PCR product DNA and DNAb-PCR products DNA is calculated according to the peak value figure of sequencing result
Two kinds of bases generate the strong and weak ratio of signal at difference site, and the ratio of two kinds of sequences that the signal strength for counting all represents takes
Average value obtains the quantity ratio of DNAa-PCR product DNA and DNAb-PCR products DNA.
7. the Assay of promoter activity method counted according to claim 5 based on RNA, it is characterised in that：The DNAa-
The computational methods of the quantity ratio of PCR product DNA and DNAb-PCR product DNA：First by two generation sequencing approaches to DNAa-PCR
Product DNA and DNAb-PCR product DNA is sequenced, and counts the number that two kinds of DNA moleculars are tested in two generation sequencing results, then
The number that comparison dna a-PCR product DNA and DNAb-PCR products DNA is tested, as DNAa-PCR products DNA and DNAb-PCR
The quantity ratio of product DNA.
8. the Assay of promoter activity method counted according to claim 4 based on RNA, it is characterised in that：The conversion side
Method is stable genetic transformation or instantaneous conversion；Wherein,
During the genetic transformation of the stabilization, two transcriptional units are inserted into as an entirety in the genome of acceptor material；
During the instantaneous conversion, acceptor material is the individual cells or histoorgan of dispersion；
The individual cells are bacterium, yeast, zooblast or plant protoplast；
Histoorgan is root, stem, leaf, flower, the heart, liver or kidney.
9. the Assay of promoter activity method counted according to claim 4 based on RNA, it is characterised in that：The DNAa sequences
Row and DNAb sequences are arbitrary sequence or complete ORF.
10. the Assay of promoter activity method counted according to claim 4 based on RNA, it is characterised in that：Including following step
Suddenly：
1) carrier of two transcriptional units is built
Using initial carrier pBWA (V) H as skeleton, structure obtains pARC-gfp carriers, sequence for shown in SEQ ID No.1, wherein,
It is included using one section of sequence on Gfp genes as DNAa, DNAb sequence, respectively such as SEQ ID No.2 and SEQ ID
Shown in No.3, particular sequence is as follows：
DNAa：
5’-TTCTTCAAGGACGACGGCAACTACAAGACGCGAGCTGAGGTGAAGTTCGAGGGCGACACGCTCGTCAACC
GTATCGAGCTCAAGGGAATCGACTTCAAGGAGGACGGAAACATTCTCGGACACAAGCTGGAGTACAACTACAACTCC
CACAACGTTTACATAATGGCGGACAAGCAGAAGAACGGCATTAAGGCCAACTT-3’；
DNAb：
5’-TTCTTCAAGGACGACGGGAACTACAAGACCCGTGCAGAGGTCAAGTTCGAGGGGGACACCCTCGTGAACA
GAATCGAGCTCAAGGGTATCGACTTCAAGGAGGACGGTAACATACTCGGTCACAAGCTCGAGTACAACTACAACTCG
CACAACGTATACATTATGGCCGACAAGCAGAAGAACGGGATAAAGGCCAACTT-3’；
It, which is further included, is inserted into reference to promoter Pa and target promoter Pb promoters, and multiple cloning sites are respectively：
MCS1：
5 '-GTTGTGAGACCTTTTTAAATTTTGGTCTCTTCTA-3 ',
MCS2：
5’-TAGCAGAGACGAAAATTTAAAAACGTCTCACACC-3’；
2) be inserted into respectively on the multiple cloning sites MCS1 of pARC-gfp carriers and multiple cloning sites MCS2 with reference to promoter Pa and
Target promoter Pb；
3) carrier converts
By in vector introduction host cell, then in transformation receptor material, the genetic transformation of instantaneous conversion or stabilization is carried out；
4) total serum IgE is extracted
5) total serum IgE is inverted to cDNA
6) PCR amplification
The primer of DNA amplification a sequences and DNAb sequences simultaneously is capable of in design, is then expanded according to normal PCR programs；
7) interpretation of result
Obtain the sequencing result peak of DNAa-PCR product DNA and DNAb-PCR products DNA respectively by generation sequencing approach first
Value figure, then calculates the strong and weak ratio of two kinds of bases generation signals at difference site according to the peak value figure of sequencing result, and statistics is all
Signal strength represent two kinds of sequences ratio, be averaged and obtain DNAa-PCR product DNA and DNAb-PCR products DNA
Quantity ratio, as with reference to promoter Pa relative to the relative activity ratio of target promoter Pb；
Alternatively, DNAa-PCR product DNA and DNAb-PCR products DNA is sequenced by two generation sequencing approaches first, count
The number that two kinds of DNA moleculars are tested in two generation sequencing results, then comparison dna a-PCR products DNA and DNAb-PCR products DNA
Tested number is to get to the quantity ratio of DNAa-PCR product DNA and DNAb-PCR products DNA, as with reference to promoter Pa phases
For the relative activity ratio of target promoter Pb.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711382250.6A CN108220312A (en) | 2017-12-20 | 2017-12-20 | For the carrier for analyzing promoter activity and the Assay of promoter activity method counted based on RNA |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711382250.6A CN108220312A (en) | 2017-12-20 | 2017-12-20 | For the carrier for analyzing promoter activity and the Assay of promoter activity method counted based on RNA |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN108220312A true CN108220312A (en) | 2018-06-29 |
Family
ID=62652554
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201711382250.6A Pending CN108220312A (en) | 2017-12-20 | 2017-12-20 | For the carrier for analyzing promoter activity and the Assay of promoter activity method counted based on RNA |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108220312A (en) |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JPH0499490A (en) * | 1990-08-17 | 1992-03-31 | Mitsubishi Rayon Co Ltd | Vector for detection of bacterium promoter |
| EP0894866A1 (en) * | 1996-03-12 | 1999-02-03 | Dnavec Research Inc. | Promoter |
| CN101781679A (en) * | 2009-10-19 | 2010-07-21 | 南通大学附属医院 | Method for detecting activity of human BAFF-R gene promoter |
| CN101974560A (en) * | 2010-10-19 | 2011-02-16 | 南开大学 | General expression vector pSK-E-P/T construction for plant mitochondria and promoter activity identification |
| CN106755057A (en) * | 2016-09-21 | 2017-05-31 | 武汉伯远生物科技有限公司 | A kind of method strong and weak by protoplast fast verification promoter |
-
2017
- 2017-12-20 CN CN201711382250.6A patent/CN108220312A/en active Pending
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JPH0499490A (en) * | 1990-08-17 | 1992-03-31 | Mitsubishi Rayon Co Ltd | Vector for detection of bacterium promoter |
| EP0894866A1 (en) * | 1996-03-12 | 1999-02-03 | Dnavec Research Inc. | Promoter |
| CN101781679A (en) * | 2009-10-19 | 2010-07-21 | 南通大学附属医院 | Method for detecting activity of human BAFF-R gene promoter |
| CN101974560A (en) * | 2010-10-19 | 2011-02-16 | 南开大学 | General expression vector pSK-E-P/T construction for plant mitochondria and promoter activity identification |
| CN106755057A (en) * | 2016-09-21 | 2017-05-31 | 武汉伯远生物科技有限公司 | A kind of method strong and weak by protoplast fast verification promoter |
Non-Patent Citations (4)
| Title |
|---|
| ANNE-LYSE DUCREST ET AL.: "Detection of promoter activity by flow cytometric analysis of GFP reporter expression", 《NUCLEIC ACIDS RESEARCH》 * |
| 叶江等: "《基因工程简明教程》", 31 August 2015, 华东理工大学出版社有限公司 * |
| 梁新乐: "《现代微生物学实验指导》", 31 March 2014, 浙江工商大学出版社 * |
| 白斌等: "一种快速检测启动子调控基因表达活性方法的探讨", 《中国农学通报》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN111593073B (en) | Double-reporter gene framework vector, four-plasmid pseudovirus packaging system and new packaging corolla pneumonia pseudovirus | |
| KR101234981B1 (en) | Nucleic Acid Constructs | |
| CN109069668B (en) | Gene therapy for eye diseases | |
| CN114230677B (en) | Recombinant protein containing Cap of hog cholera E2 and circovirus, preparation method and application thereof | |
| MXPA01010273A (en) | Novel recombinant and mutant herpesviruses. | |
| KR20220056241A (en) | Recombinant turkey herpesvirus vectors expressing antigens of avian pathogens and uses thereof | |
| CN115094068A (en) | Application of OsbHLH189 gene in improving rice grain type | |
| CN110669775B (en) | Application of differential proxy technology in enrichment of A.G base substitution cells | |
| CN1650013A (en) | DNA vaccines against hantavirus infections | |
| CN116075595A (en) | Diagnostic control compositions | |
| CN108220312A (en) | For the carrier for analyzing promoter activity and the Assay of promoter activity method counted based on RNA | |
| CN102732543B (en) | With the oncogene engineered vaccine that MUC-1 and survivin are target spot | |
| CN113667683B (en) | Polynucleotide for expressing HPV39L1, expression vector, host cell and application thereof | |
| CN114438115A (en) | CRISPR/Cas9 gene editing vector, construction method and application thereof | |
| CN112831519B (en) | Method for preparing santalol by utilizing sweet wormwood herbs | |
| CN111304239B (en) | Rolling circle replication recombinant vector, construction method and application | |
| KR100660040B1 (en) | DNA Vaccines Against Hantavirus Infections | |
| CN114621974B (en) | Vector of plant single-gene or multi-gene CRISPR (clustered regularly interspaced short palindromic surface plasmon) activation technology, and construction method and application thereof | |
| CN112501177B (en) | Method for promoting development of lateral root of salvia miltiorrhiza and improving content of tanshinone in salvia miltiorrhiza root, salvia miltiorrhiza gene sequence and overexpression vector | |
| CN110846334B (en) | Upland cotton transformation event ICR24-378 and application thereof in cotton breeding | |
| US20010014335A1 (en) | Novel fused protein, gene therefor, recombinant vector, recombinant virus, and its use | |
| CN112280798B (en) | Spinach green RNA visualization-based method and application thereof | |
| CN114395021A (en) | Latex-like protein 43, expression vector and application thereof in inhibiting plant virus infection | |
| CN113897376B (en) | HN protein mutated gene VII type Newcastle disease virus recombinant vaccine strain | |
| CN106947764B (en) | Plant root specific promoter and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20180629 |