CN114395021A - Latex-like protein 43, expression vector and application thereof in inhibiting plant virus infection - Google Patents

Abstract

The invention provides a latex-like protein 43 and application thereof in inhibiting plant virus infection, wherein the amino acid sequence of the latex-like protein 43 is shown as SEQ ID NO: 1 is shown. The latex-like protein NbMLP43 resistant to plant viruses is obtained through screening, NbMLP43 is knocked out through a CRISPR technology to obtain the Shi tobacco mlp43 mutant, and the mutation NbMLP43 is used for adjusting the sensitivity of the Shi tobacco to PVY and promoting virus infection, which is explained from the three aspects of RNA, protein and PVY-GFP fluorescence intensity. Meanwhile, the constructed overexpression vector is used for transforming the burley tobacco to obtain a homozygous transgenic plant of the stably overexpressed NbMLP43, and the fact that the overexpression of the NbMLP43 inhibits the infection of PVY is also proved. This indicates that NbMLP43 can resist virus infection as a new potential disease-resistant gene.

Description

Latex-like protein 43, expression vector and application thereof in inhibiting plant virus infection

Technical Field

The invention relates to the technical field of biology, in particular to latex-like protein 43, an expression vector and application thereof in inhibiting plant virus infection.

Background

Tobacco viral diseases are one of the main diseases of all tobacco regions in the world, and huge economic losses are caused every year. The tobacco virus diseases in China are documented in the initial stage of national establishment, and after the 20 th century 70 years, the harm of the virus diseases is aggravated year by year. The national tobacco monopoly awarded research project 'national tobacco infectious disease investigation and research' carried out in 1989 and 1991 finds out 16 viruses causing tobacco virus diseases in China, wherein the viruses are widely distributed and seriously harmful, and the viruses comprise 4 types: including tobacco common mosaic virus (TMV), tobacco Cucumber Mosaic Virus (CMV), Tobacco Etch Virus (TEV), Potato Virus Y (PVY), and tobacco ringspot virus (TRsv), Potato Virus X (PVX), tobacco necrosis virus (TNv), Tobacco Streak Virus (TSV), etc. In the 20 th century and before the 60 th year, the big tobacco areas in China are most seriously damaged by TMV, and later, the cucumber mosaic virus, the potato virus Y and the tobacco mosaic virus are infected pairwise or compositely to harm the production of tobacco. TMV can occur from the seedling stage to the whole growth and development stage of the field in the growth process of tobacco plants, mainly causes uneven thickness and even deformity of leaves of tobacco leaves, shrinkage and yellowish green mottle, can deform floral organs when serious, causes small fruits to shrink, prevents seeds from sprouting, and can reduce the color, taste and quality of flue-cured tobacco in different degrees. It is estimated that only one hazard from tobacco mosaic virus worldwide causes about 1 billion or more dollars of economic loss each year due to the hazards of the virus. PVY, a representative species of the genus Potyvirus (Potyvirus), is a typical plant-infecting RNA virus. PVY mainly infects solanaceous crops and causes a great yield loss, the virus being transmitted in a non-persistent manner by virulent aphids. PVY exists in tobacco planting areas all over the world, virus diseases caused by PVY are also one of the most serious diseases in tobacco production in China, and are widely distributed in 22 tobacco planting areas in China. PVY isolates causing systemic zonal symptoms significantly reduced tobacco yield, leading to systemic vascular necrosis (PV)Y^N) The isolate of (a) results in the greatest yield loss in tobacco planting. Once the tobacco virus disease occurs, few chemical methods are used for controlling the tobacco virus disease in time, the prediction and forecast of plant diseases and insect pests should be enhanced for the control of the virus disease, the occurrence dynamics of the virus disease is mastered in time, and the control measures can be taken in a targeted manner. Generally, a strategy of taking prevention as a main part and combining comprehensive prevention and treatment is adopted.

Chemical pesticides have been very important in agricultural production for more than half a century, however, the unreasonable use of chemical pesticides and the high toxicity and high residue of chemical pesticides not only pose great threat to the safety of human and livestock, but also seriously destroy the ecological balance. Along with the year-by-year enhancement of the drug resistance of plant diseases and insect pests, the use amount and the use frequency of pesticides are correspondingly increased, and meanwhile, a more serious vicious circle is caused on the environmental pollution and the killing power of non-target organisms. The biopesticides have low toxicity, are fast to reproduce, do not harm natural enemies, are not easy to generate drug resistance in prevention and treatment objects, and are called as 'pollution-free pesticides'. Although biopesticides have the advantages that many chemical pesticides are difficult to have, biopesticide products have many inherent weaknesses compared with chemical pesticides, such as slow effect, susceptibility to temperature and humidity and other conditions, complex active ingredients and the like.

Therefore, how to screen out the disease-resistant gene has important significance for preventing and treating plant viruses.

Disclosure of Invention

The invention aims to provide a latex-like protein 43 and application thereof in inhibiting plant virus infection, wherein the latex-like protein for resisting plant viruses is used for biological control of plant virus diseases, and provides a new disease-resistant gene category for control of the plant virus diseases.

In order to achieve the purpose, the invention adopts the following technical scheme:

in a first aspect of the present invention, a latex-like protein 43 is provided, wherein the amino acid sequence of the latex-like protein 43 is as shown in SEQ ID NO: 1 is shown.

In a second aspect of the present invention, there is provided a nucleic acid molecule encoding the latex-like protein 43, the nucleotide sequence of the nucleic acid molecule is as shown in SEQ ID NO: 2, respectively.

In a third aspect of the present invention, there is provided a recombinant expression vector of latex protein 43, wherein the recombinant expression vector is obtained by inserting the nucleic acid molecule into a multiple cloning site of an expression vector; the recombinant expression vector can express the latex-like protein 43, and comprises one of a prokaryotic expression vector, a eukaryotic expression vector and a viral expression vector.

Further, the expression vector further comprises an encoding tag sequence upstream of the nucleic acid molecule, wherein the tag sequence comprises one of a His tag, an HA tag, a GFP tag and a Flag tag.

In a fourth aspect of the present invention, there is provided a method for preparing an expression vector for latex protein 43, the method comprising:

obtaining a target gene segment of the latex-like protein 43;

adopting the target gene fragment as SEQ ID NO: 3-4, carrying out PCR to obtain a PCR product;

vector pFu46-RFP is subjected to XhoI/KpnI double enzyme digestion and then is enzymatically linked with the PCR product to obtain plant expression vector p35S: MLP43: RFP.

In the fourth aspect of the invention, a recombinant cell line or recombinant expression bacterium for expressing the latex-like protein 43 is provided, which comprises the recombinant expression vector.

In a fifth aspect of the present invention, there is provided a method for producing a transgenic plant expressing said latex-like protein 43, said method comprising:

obtaining an expression vector of the latex-like protein 43;

transforming the expression vector of the latex-like protein 43 into agrobacterium tumefaciens EHA105 to obtain an agrobacterium transformant;

and infecting flue-cured tobacco leaves with the agrobacterium transformant to obtain a T0 generation transgenic plant.

In a fifth aspect of the invention, a transgenic plant expressing said latex-like protein 43 is provided.

In the sixth aspect of the present invention, there is provided the use of said latex-like protein 43 and/or said nucleic acid molecule and/or said recombinant expression vector for inhibiting plant viral infection.

In a seventh aspect of the present invention, there is provided a method of inhibiting plant viral infection, the method comprising: the recombinant expression vector mediates the genetic transformation of plants by means of genetic engineering to obtain transgenic plants capable of inhibiting the infection of plant viruses.

One or more technical solutions in the embodiments of the present invention have at least the following technical effects or advantages:

according to the latex-like protein 43 and the application thereof in inhibiting plant virus infection, NbMLP43 is knocked out by the CRISPR technology to obtain the Bunsen/Yan mlp43 mutant, and the mutation NbMLP43 is used for up-regulating the sensitivity of the Bunsen/Yan to PVY and promoting virus infection, which is explained from the three aspects of RNA, protein and PVY-GFP fluorescence intensity. Meanwhile, the constructed overexpression vector p35S, MLP43, RFP is used for transforming the Nicotiana benthamiana to obtain a homozygous transgenic plant for stably overexpressing NbMLP43, and the fact that the overexpression of NbMLP43 inhibits the infection of PVY is also proved. This indicates that NbMLP43 can resist virus infection as a new potential disease-resistant gene.

Drawings

In order to more clearly illustrate the technical solutions in the embodiments of the present invention, the drawings needed to be used in the description of the embodiments are briefly introduced below, and it is obvious that the drawings in the following description are some embodiments of the present invention, and it is obvious for those skilled in the art to obtain other drawings based on the drawings without creative efforts.

FIG. 1 is a phylogenetic tree of NbMLP43 and MLP family members of other species;

FIG. 2 is the 3D structure of NbMLP43, cotton MLP28 and Arabidopsis MLP-like protein 43;

FIG. 3 is a subcellular localization of NbMLP 43; wherein FIG. 3a is a subcellular localization of NbMLP43 in healthy Nicotiana benthamiana; FIG. 3b is the subcellular localization of NbMLP43 during PVY infection;

FIG. 4 shows subcellular localization of NbMLP43 observed with protoplasts; wherein FIG. 4a is the subcellular localization of NbMLP43 in healthy Nicotiana benthamiana; FIG. 4b is the subcellular localization of 3dNbMLP43 following PVY infection; FIG. 4c is the subcellular localization of 5d NbMLP43 after PVY infection;

FIG. 5 is a pattern of gene expression of NbMLP43 in wild-type B.benthamiana; wherein FIG. 5a is the PVY-GFP expression trend at 1, 3, 5, 7d after inoculation; FIG. 5b shows the expression trend of NbMLP43 after PVY inoculation; FIG. 5c is the expression trend of NbMLP43 in roots, stems, leaves and flowers;

FIG. 6 is a graph of the effect of knock-out of NbMLP43 on PVY infestation; wherein FIG. 6a is the expression trend of NbMLP43 in roots, stems, leaves and flowers; FIG. 6b is the difference in protein level of PVY CP between 4d, mlp43 and WT after PVY infection; FIG. 6c is the PVY-GFP fluorescence difference between mlp43 and WT, Mock is a negative control;

FIG. 7 is a graph of the effect of over-expressing NbMLP43 on PVY infestation. Wherein FIG. 7a is the detection of virus expression differences 1, 2, 3, 4d post-inoculation using real-time PCR; FIG. 7b shows the detection of differences in viral CP protein expression after 4d of PVY inoculation; (ii) a FIG. 7c shows the difference in GFP fluorescence observed at 12d after treatment.

Detailed Description

The present invention will be described in detail below with reference to specific embodiments and examples, and the advantages and various effects of the present invention will be more clearly apparent therefrom. It will be understood by those skilled in the art that these specific embodiments and examples are for the purpose of illustrating the invention and are not to be construed as limiting the invention.

Throughout the specification, unless otherwise specifically noted, terms used herein should be understood as having meanings as commonly used in the art. Accordingly, unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. If there is a conflict, the present specification will control.

Unless otherwise specifically stated, various raw materials, reagents, instruments, equipment and the like used in the present invention are commercially available or can be obtained by an existing method.

In order to solve the technical problems, the general idea of the embodiment of the application is as follows:

1) the present inventors isolated RNA from Nicotiana benthamiana using TRIzol reagent, and performed first strand cDNA synthesis using total RNA and reverse transcriptase. According to the Benzenbacher genome data of Sol Genomics Network, gene specific primers are designed and used for PCR amplification. The resulting PCR products were subjected to 1% agarose gel electrophoresis and Sanger sequencing. The amino acid sequence of the putative MLP-like protein 43 (designated NbMLP43) was aligned with orthologs of other species using DNAMAN and SWISS-MODEL for structural prediction. The phylogenetic tree was generated using MEGA 7. Potential cis-regulatory elements in the NbMLP43 promoter were analyzed using the online program Plant CARE;

2) observing subcellular localization of NbMLP43 and changes of subcellular localization before and after PVY infection by using the constructed NbMLP43 transgenic Benzen smoke carrying RFP labels under laser confocal conditions;

3) detecting the expression trend of target protein NbMLP43 after PVY infection and the relative expression difference of NbMLP43 in different tissues by utilizing a qRT-PCR technology;

4) detecting the difference of the expression quantity of PVY from three aspects of fluorescence intensity of gene, protein and GFP by using a mlp43 mutant of which NbMLP43 is knocked out and wild type Benzeng tobacco;

5) the constructed NbMLP43 transgenic gene carrying RFP labels and wild type Benzenbach are utilized to detect the difference of the expression quantity of PVY from three aspects of fluorescence intensity of genes, proteins and GFP. It was also demonstrated that overexpression of NbMLP43 inhibited PVY infection. This indicates that NbMLP43 can resist virus infection as a new potential disease-resistant gene.

The CDS sequence of MLP-like protein 43 (NbMLP 43 for short) is amplified from Nicotiana benthamiana for the first time, and the CDS sequence is phylogenetic analysis with members of MLP families in other species to find that the CDS sequence is closest to the MLP28 of upland cotton.

The predicted NbMLP43 protein structure of SWISS-MODEL is very similar to that of upland cotton MLP28 and Arabidopsis MLP-like protein 43. Tissue specificity tests show that the protein gene has the highest expression level in leaf tissues. Cells and protoplasts are observed through laser confocal observation, the protein is mainly positioned in cytoplasm and nucleus, and the expression quantity of the protein in the cytoplasm becomes less and mainly turns into nucleus after virus infection, which is required to be verified and researched later. The expression pattern analysis shows that the protein gene is induced to express by PVY and reaches the expression peak at 3 dpi. We cloned and analyzed a 2,000bp NbMLP43 promoter sequence containing cis-acting elements for SA, stress, and light response.

NbMLP43 is knocked out by CRISPR technology to obtain the mutant of Nicotiana benthamiana mlp43, and the mutant NbMLP43 regulates the sensitivity of Nicotiana benthamiana to PVY and promotes virus infection from the three aspects of RNA, protein and PVY-GFP fluorescence intensity. Meanwhile, the constructed overexpression vector 35S (MLP 43) RFP is used for transforming the Nicotiana benthamiana to obtain a homozygous transgenic plant for stably overexpressing NbMLP43, and the fact that the overexpression of NbMLP43 inhibits the infection of PVY is also proved. This indicates that NbMLP43 can resist virus infection as a new potential disease-resistant gene.

A latex-like protein 43 and its use in inhibiting plant viral infection according to the present application will be described in detail below with reference to examples and experimental data.

Example 1 identification and phylogenetic analysis of the NbMLP43 Gene

1. Obtaining NbMLP43 by screening

The CDS of NbMLP43 was amplified from Nicotiana benthamiana using primers (F: 5'-ATGGGTCTCAAAGGCAAGTTGATCTC-3'; R: 5'-CTATTTCCCGACA TGATGAGGCTC-3'), and the CDS of NbMLP43 was aligned with the ORF sequence of NbMLP43 predicted in Nicotiana benthamiana database (https:// solgenomics. A phylogenetic tree of NbMLP43 and MLP family members in related species was constructed (FIG. 1), and the results show that NbMLP43 has the highest sequence similarity to upland cotton MLP 28.

The multiple alignment analysis shown in FIG. 2 revealed less similarity to Gossypium hirsutum MLP28 and Arabidopsis thaliana MLP-like protein 43. The predicted NbMLP43 protein structure by SWISS-MODEL has a similar 3D structure to that of upland cotton MLP28 and Arabidopsis MLP-like protein 43. The SMART prediction shows that NbMLP43 contains a Bet v 1 structural domain, and the stress resistance function is suggested. 2,000bp NbMLP43 promoter sequence was cloned and analyzed, and the Plant CARE online software analyzed to contain the cis-acting elements involved in response to SA, light, stress, low temperature and auxin, etc. see Table 1.

TABLE 1 analysis of cis-regulatory elements of the NbMLP43 promoter

2. Subcellular localization of NbMLP43

The subcellular localization of NbMLP43 was predicted using the online Plant-mLo tool (http:// www.csbio.sjtu.edu.cn/bioinf/Plant-multi /), and the results indicated that the protein was localized in the cytoplasm. In addition, the protein also contains the predicted nuclear localization signal peptide of NLS Mapper (http:// NLS-Mapper. iab. keio. ac. jp/cgi-bin/NLS _ Mapper. cgi). Laser confocal results of both protoplasts and intact cells showed that NbMLP43 was localized predominantly in the cytoplasm and nucleus (fig. 3, fig. 4), and interestingly, following PVY infection, NbMLP43 expression decreased in the cytoplasm and shifted predominantly to the nucleus by 5dpi (fig. 4, b).

3. NbMLP43 expression Pattern

Viral accumulation was on an increasing trend at 7dpi, 1, 3, 5 and 7d post-PVY infection (figure 5 a). Similarly, PVY-GFP infection at 1dpi induced the expression of NbMLP43, and reached a maximum at 3dpi (FIG. 5 b). The results of qRT-PCR analysis showed that expression of NbMLP43 was detected in various tissues of wild-type ben-zenia, and NbMLP43 transcript levels were higher in leaf tissues than in other tissues detected (fig. 5 c).

Example 2 NbMLP43 knockout favours PVY-infesting Nicotiana benthamiana

1. To further investigate the role of NbMLP43 in plant defense, the NbMLP43 gene was knocked out using CRISPR-gas9 editing techniques. Specifically, the construction steps and the knockout steps of pCRISPR-MLP43 are as follows: two target sites (T1: GACATGGTGGAGGTTTGGTG and T2: ACGTTACATGAGGGTCAGTT) were designed based on the CDS sequence of the gene NbMLP 43.

2. Designing PCR amplification primers of target sites according to target sites (see table 2 specifically), using an intermediate vector PGTR plasmid (Biovector-063143) as a template, amplifying a fragment 1 by using a primer pRGEB32-7s/T1as, amplifying a fragment 2 by using a primer T1s/T2as, mixing and diluting two products of the PCR by 20 times, using the two products as a template, amplifying the two products by using a primer inf pRGEB32-7 s/CRISPR-inf-T2as, and cloning the PCR fragments to a final CRISPR expression vector by using a recombinase of Nanjing Novozapine Biotechnology Ltd. The constructed CRISPR vector is electrically transferred into escherichia coli TOP10, and a carrier primer U6-7S and CRISPR-inf-T2as are used for carrying out colony PCR detection and screening positive clones. Sequencing the CRISPR vector with primer U6-7S to determine whether there is any target site sequence.

TABLE 2

3. Primers CRISPR-MLP43-dF2 and CRISPR-MLP43-dR2 (shown in Table 2) are designed according to the pCRISPR-MLP43 constructed above, and are subjected to amplification sequencing to detect whether the transgenic plant has an editing site. Editing plants cannot be judged according to the PCR result, PCR products of 6 individuals of mlp43(1, 2, 3, 4, 5 and 6) are selected and sequenced, the sequencing result is further decoded at a website http:// skl.scau.edu.cn/dsdecode, the decoding result shows that a strain mlp43(3, 5 and 6) is an editing plant, a T2 generation transgenic plant of mlp43-6 is selected to be sequenced into a homozygous mutant, the function of NbMLP43 is verified subsequently, and no phenotypic difference is observed between a mlp43 mutant and a control plant (FIG. 6 c).

3. Next, mlp43 and control plants were infected with PVY-GFP and virus infection was detected for at least one week. Wherein the nucleotide sequence of the PVY-GFP vector is shown as SEQ ID NO. 17.

The results showed that the expression level of viral CP was significantly higher at 1-5d, mlp43 after infection than in the control group, and was 2.6-fold and 1.2-fold higher at 4dpi and 5dpi, respectively (FIG. 6 a). At 4dpi, western blot detected a higher level of viral CP protein in mlp43 than in WT (fig. 6 b). Consistent with the above results, strong and broad GFP signals were observed in mlp43 leaf, while only a few fluorescent spots were observed in WT leaf. In particular, GFP signals were detected throughout the mlp43 system leaves at 12dpi, but only in the WT veins, petioles and few leaves. mlp43 the number and size of the infected areas in the system blade was significantly higher than WT (FIG. 6 c). Taken together, these results indicate that knockout of NbMLP43 renders burrows of PVY highly susceptible.

Example 3 overexpression of NbMLP43 inhibited infection of PVY with Nicotiana benthamiana

1. Construction of overexpression vector p35S MLP43 RFP

Obtaining a target gene segment of the latex-like protein 43;

adopting the target gene fragment as SEQ ID NO: 3-4, carrying out PCR to obtain a PCR product; wherein, the primer pair specifically comprises:

f: 5'-CTTTAGATCTTCTAGAATGGGTCTCAAAGGCAAGTTG-3' (SEQ ID NO: 3);

r: 5'-AGGAGGCCATGAATTCTTTCCCGACATGATGAGGCTC-3' (SEQ ID NO: 4);

vector pFu46-RFP is subjected to XhoI/KpnI double enzyme digestion and then is enzymatically linked with the PCR product to obtain plant expression vector p35S: MLP43: RFP.

Wherein the vector pFu46-RFP is described in the literature

“SunH,Shen L,Qin Y,Liu X,Hao K,Li Y,WangF,et al.(2018).CLC-Nt1 affects Potato Virus Y infection viaregulation ofendoplasmic reticulum luminal Ph.New Phytologist,220(2),539-552.”

2. Transgenic plant

Transforming the expression vector of the latex protein 43 into agrobacterium tumefaciens LBA4404 to obtain an agrobacterium transformant; and infecting flue-cured tobacco leaves with the agrobacterium transformant to obtain a T0 generation transgenic plant.

3. Firstly, NbMLP43-OE transgenic seedlings are respectively detected on the gene and protein level, strong expression seeds are selected for subculture, and T3 generation transgenic seeds are screened by Kan antibiotics without yellowing, which indicates that NbMLP43-OE transgenic homozygotes are obtained.

The transgenic seedlings overexpressing NbMLP43 at the T4 generation are inoculated with PVY-GFP, and the difference of the expression amount of the treated PVY and the control PVY is detected from the fluorescence intensity of RNA, protein and GFP. Samples were taken at 1, 2, 3 and 4d after inoculation, the expression of PVY CP at RNA level was detected by fluorescence quantitative PCR, the result was shown in figure (FIG. 7a) and the treatment was significantly lower than the control virus expression, and the result was consistent with the gene level when the sample at 4d was used for Western blot (FIG. 7 b). Differences in viral fluorescence were observed between treatment and control at 12d post inoculation, with the tobacco strain virus overexpressing NbMLP43 spreading less than the control (fig. 7 c).

Taken together, overexpression of NbMLP43 inhibited infection by PVY.

The above embodiments are preferred embodiments of the present invention, but the present invention is not limited to the above embodiments, and any other changes, modifications, substitutions, combinations, and simplifications which do not depart from the spirit and principle of the present invention should be construed as equivalents thereof, and all such changes, modifications, substitutions, combinations, and simplifications are intended to be included in the scope of the present invention.

Finally, it should also be noted that the terms "comprises," "comprising," or any other variation thereof, are intended to cover a non-exclusive inclusion, such that a process, method, article, or apparatus that comprises a list of elements does not include only those elements but may include other elements not expressly listed or inherent to such process, method, article, or apparatus.

While preferred embodiments of the present invention have been described, additional variations and modifications in those embodiments may occur to those skilled in the art once they learn of the basic inventive concepts. Therefore, it is intended that the appended claims be interpreted as including preferred embodiments and all such alterations and modifications as fall within the scope of the invention.

It will be apparent to those skilled in the art that various changes and modifications may be made in the present invention without departing from the spirit and scope of the invention. Thus, if such modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalents, the present invention is also intended to include such modifications and variations.

Sequence listing

<110> tobacco institute of agricultural sciences, Yunnan tobacco corporation, Honghe corporation, Yunnan tobacco institute of agricultural sciences

<120> type latex protein 43, expression vector and application thereof in inhibiting plant virus infection

<160> 17

<170> SIPOSequenceListing 1.0

<210> 1

<211> 146

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 1

Met Gly Leu Lys Gly Lys Leu Ile Ser Gln Ile Glu Met Lys Cys Ala

1 5 10 15

Gly Asp Leu Leu His Glu His Phe Lys Ser Asn Pro His Gln Thr Ser

20 25 30

Thr Met Ser Pro Asp Lys Ile Lys Asn Phe Thr Leu His Glu Gly Gln

35 40 45

Leu Gly Asn Thr Gly Ser Val Ile Ser Trp Lys Tyr Val Leu Gly Gly

50 55 60

Lys Glu Arg His Ala Lys Gln Val Leu His Val Asp Asp Ala Lys Lys

65 70 75 80

Ser Ile Thr Phe Asn Phe Val Glu Gly Tyr Met Asn Glu Leu Tyr Lys

85 90 95

Ser Ile Thr Ala Thr Leu Thr Ala Glu Gly Asn Trp Met Thr Trp Thr

100 105 110

Leu Val Tyr Glu Lys Leu Asn Glu Asn Thr Pro Glu Pro Leu Asp Leu

115 120 125

Leu Glu Phe Ala Ile Cys Leu Leu Lys Asp Ile Glu Pro His His Val

130 135 140

Gly Lys

145

<210> 2

<211> 441

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

atgggtctca aaggcaagtt gatctctcaa atagagatga agtgtgctgg agatttgctt 60

catgaacact tcaaatcaaa tccacaccaa acctccacca tgtctcctga taagataaaa 120

aatttcacgt tacatgaggg tcagttaggt aatactggtt ctgttatcag ctggaagtac 180

gttcttggag gaaaagagag gcatgcgaag caggtcctac acgttgatga tgcgaaaaaa 240

tcaatcacct tcaattttgt tgaaggttat atgaatgaat tatacaagtc cataacagct 300

actttgactg cagagggaaa ctggatgact tggacccttg tgtatgagaa gttgaatgaa 360

aacacaccag agccccttga tcttttggaa tttgctattt gcctcctcaa agatattgag 420

cctcatcatg tcgggaaata g 441

<210> 3

<211> 37

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

ctttagatct tctagaatgg gtctcaaagg caagttg 37

<210> 4

<211> 37

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

aggaggccat gaattctttc ccgacatgat gaggctc 37

<210> 5

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

gacatggtgg aggtttggtg 20

<210> 6

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

acgttacatg agggtcagtt 20

<210> 7

<211> 37

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

aagcatcaga tgggcaaaca aagcaccagt ggtctag 37

<210> 8

<211> 36

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

caccaaacct ccaccatgtc tgcaccagcc gggaat 36

<210> 9

<211> 38

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

gacatggtgg aggtttggtg gttttagagc tagaaata 38

<210> 10

<211> 36

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

aactgaccct catgtaacgt tgcaccagcc gggaat 36

<210> 11

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

aagcatcaga tgggcaaaca aa 22

<210> 12

<211> 35

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

ttctagctct aaaacaactg accctcatgt aacgt 35

<210> 13

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

tgtgccactc caaagacatc ag 22

<210> 14

<211> 35

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

ttctagctct aaaacaactg accctcatgt aacgt 35

<210> 15

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 15

cgtgtaagaa aatctcacac tgc 23

<210> 16

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 16

cacttgtacc aaagcaaact cg 22

<210> 17

<211> 20413

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 17

tggcaggata tattgtggtg taaacaaatt gacgcttaga caacttaata acacattgcg 60

gacgttttta atgtactgaa ttaacgccga attaattcga gctcggatct gataatttat 120

ttgaaaattc ataagaaaag caaacgttac atgaattgat gaaacaatac aaagacagat 180

aaagccacgc acatttagga tattggccga gattactgaa tattgagtaa gatcacggaa 240

tttctgacag gagcatgtct tcaattcagc ccaaatggca gttgaaatac tcaaaccgcc 300

ccatatgcag gagcggatca ttcattgttt gtttggttgc ctttgccaac atgggagtcc 360

aagattctgc agtcaaatct cggtgacggg caggaccgga cggggcggta ccggcaggct 420

gaagtccagc tgccagaaac ccacgtcatg ccagttcccg tgcttgaagc cggccgcccg 480

cagcatgcct cttggggcat atccgagcgc ctcgtgcatg cgcacgctcg ggtcgttggg 540

cagcccgatg acagcgacca cgctcttgaa gccctgtgcc tccagggact tcagcaggtg 600

ggtgtagagc gtggagccca gtcccgtccg ctggtggcgg ggggagacgt acacggtcga 660

ctcggccgtc cagtcgtagg cgttgcgtgc cttccagggg cccgcgtagg cgatgccggc 720

gacctcgccg tccacctcgg cgacgagcca gggatagcgc tcccgcagac ggacgaggtc 780

gtccgtccac tcctgcggtt cctgcggctc ggtacggaag ttgaccgtgc ttgtctcgat 840

gtagtggttg acgatggtgc agaccgccgg catgtccgcc tcggtggcac ggcggatgtc 900

ggccgggcgt cgttctgggc tcatcgattc gatttggtgt atcgagattg gttatgaaat 960

tcagatgcta gtgtaatgta ttggtaattt gggaagatat aataggaagc aaggctattt 1020

atccatttct gaaaaggcga aatggcgtca ccgcgagcgt cacgcgcatt ccgttcttgc 1080

tgtaaagcgt tgtttggtac acttttgact agcgaggctt ggcgtgtcag cgtatctatt 1140

caaaagtcgt taatggctgc ggatcaagaa aaagttggaa tagaaacaga atacccgcga 1200

aattcaggcc cggttgccat gtcctacacg ccgaaataaa cgaccaaatt agtagaaaaa 1260

taaaaactga ctcggatact tacgtcacgt cttgcgcact gatttgaaaa atctcagaat 1320

tccaatccca caaaaatctg agcttaacag cacagttgct cctctcagag cagaatcggg 1380

tattcaacac cctcatatca actactacgt tgtgtataac ggtccacatg ccggtatata 1440

cgatgactgg ggttgtacaa aggcggcaac aaacggcgtt cccggagttg cacacaagaa 1500

atttgccact attacagagg caagagcagc agctgacgcg tacacaacaa gtcagcaaac 1560

agacaggttg aacttcatcc ccaaaggaga agctcaactc aagcccaaga gctttgctaa 1620

ggccctaaca agcccaccaa agcaaaaagc ccactggctc acgctaggaa ccaaaaggcc 1680

cagcagtgat ccagccccaa aagagatctc ctttgccccg gagattacaa tggacgattt 1740

cctctatctt tacgatctag gaaggaagtt cgaaggtgaa ggtgacgaca ctatgttcac 1800

cactgataat gagaaggtta gcctcttcaa tttcagaaag aatgctgacc cacagatggt 1860

tagagaggcc tacgcagcag gtctcatcaa gacgatctac ccgagtaaca atctccagga 1920

gatcaaatac cttcccaaga aggttaaaga tgcagtcaaa agattcagga ctaattgcat 1980

caagaacaca gagaaagaca tatttctcaa gatcagaagt actattccag tatggacgat 2040

tcaaggcttg cttcataaac caaggcaagt aatagagatt ggagtctcta aaaaggtagt 2100

tcctactgaa tctaaggcca tgcatggagt ctaagattca aatcgaggat ctaacagaac 2160

tcgccgtgaa gactggcgaa cagttcatac agagtctttt acgactcaat gacaagaaga 2220

aaatcttcgt caacatggtg gagcacgaca ctctggtcta ctccaaaaat gtcaaagata 2280

cagtctcaga agaccaaagg gctattgaga cttttcaaca aaggataatt tcgggaaacc 2340

tcctcggatt ccattgccca gctatctgtc acttcatcga aaggacagta gaaaaggaag 2400

gtggctccta caaatgccat cattgcgata aaggaaaggc tatcattcaa gatctctctg 2460

ccgacagtgg tcccaaagat ggacccccac ccacgaggag catcgtggaa aaagaagacg 2520

ttccaaccac gtcttcaaag caagtggatt gatgtgacat ctccactgac gtaagggatg 2580

acgcacaatc ccactatcct tcgcaagacc cttcctctat ataaggaagt tcatttcatt 2640

tggagaggac acgctcgaga aattaaaaca actcaataca acataagaaa aatcaacgca 2700

aaaacactca caaaagcttt caactctaat tcaaacaatt tgttaagttt caatttcaat 2760

cttcatcaaa caaactcttt caatttcagt gtaagctatc gtaattcagt aagttatttc 2820

aaactctcgt aaattgcaga agatcatcca tggcaactta cacatcaaca atccggtttg 2880

gctccattga atgcaaactt ccatactcac ccgccccttt tgggctagtc gcggggaaac 2940

gagaagtttc aaccaccact gaccccttcg caagtttgga gatgcagctt agtgcgcgat 3000

tacgaaggca ggagtttgca actattcgaa catccaagaa tggtacttgt atgtatcgat 3060

acaagactga tgcccagatt gcgcgcattc aaaagaagcg cgaggaaaga gaaagagagg 3120

aatataattt ccaaatggct gcgtcaagtg ttgtgtcgaa gatcactatt gctggtggag 3180

agccaccttc aaaacttgaa tcacaagtgc ggaggggtgt catccacaca actccaagga 3240

tgcgcacagc aaaaacatat cacacgccaa agttgacaga gggacaaatg aaccacctta 3300

tcaagcaggt gaagcaaatt atgtcaacca aaggagggtc tgttcaactg attagcaaga 3360

aaagtaccca tgttcactat aaagaagttt tgggatcaca tcgcgcagtt gtttgcactg 3420

cacatatgag aggtttacga aagagagtgg actttcggtg tgataaatgg accgttgtgc 3480

gtctacagca tctcgccagg acggacaagt ggactaacca agttcgtgcc actgatctac 3540

gcaagggcga tagtggagtt atattgagta atactaatct caaaggaaac tttgggagaa 3600

gttcggaggg cctatttata gtgcgtgggt cgcatgaagg aaaaatctat gatgcacgtt 3660

ccaaggttac ccaaggggtt atggactcaa tgattcagtt ctcttccgcg gaaatggtag 3720

atctgactag taaaggagaa gaacttttca ctggagttgt cccaattctt gttgaattag 3780

atggtgatgt taatgggcac aaattttctg tcagtggaga gggtgaaggt gatgcaacat 3840

acggaaaact tacccttaaa tttatttgca ctactggaaa actacctgtt ccgtggccaa 3900

cacttgtcac tactttctct tatggtgttc aatgcttttc aagataccca gatcatatga 3960

agcggcacga cttcttcaag agcgccatgc ctgagggata cgtgcaggag aggaccatct 4020

tcttcaagga cgacgggaac tacaagacac gtgctgaagt caagtttgag ggagacaccc 4080

tcgtcaacag gatcgagctt aagggaatcg atttcaagga ggacggaaac atcctcggcc 4140

acaagttgga atacaactac aactcccaca acgtatacat catggccgac aagcaaaaga 4200

acggcatcaa agccaacttc aagacccgcc acaacatcga agacggcggc gtgcaactcg 4260

ctgatcatta tcaacaaaat actccaattg gcgatggccc tgtcctttta ccagacaacc 4320

attacctgtc cacacaatct gccctttcga aagatcccaa cgaaaagaga gaccacatgg 4380

tccttcttga gtttgtaaca gctgctggga ttacacatgg catggatgaa ctatacaaag 4440

ctagctacga ggttcatcac caggctaact cttccgcgga aagcttttgg aagggattgg 4500

acggcaattg gacacaaatg agatatccta cagatcatac atgtgtggca ggcttgccag 4560

ttgaagactg tggcagagtt gcagcgataa taacacacag tattttaccg tgttataaaa 4620

taacctgccc tacctgcgcc caacaatatg ccaacttgcc agccagtgac ttacttaaga 4680

tattacacaa gcacgcaagt gatggtctaa atcgattggg ggcagacaaa gatcgctttg 4740

tgcatgtcaa aaagttcttg acaaccttag agcacttaac tgaaccggtt gatctgagtc 4800

tagaaatttt caatgaagta ttcaagtcta taggggagaa gcaacaatca cctttcaaaa 4860

acctgaatat tctgaataat ttctttttga aaggaaagga aaatacagct cgtgaatggc 4920

aggtggctca attaagctta cttgaattgg caagattcca aaagaacaga acggataata 4980

tcaagaaagg agacatctcg ttctttagga ataaactatc tgccaaagca aattggaact 5040

tgtatctgtc atgtgataac cagctggaca agaatgcaaa tttcctgtgg ggacagaggg 5100

aatatcatgc taagcgattt ttctcgaact atttcgagga aattgatcca gcgaagggct 5160

attcagcata cgaaaatcgt ttgcatccga atgggacaag aaaacttgca attggaaacc 5220

taattgtacc acttgatctg gctgagttta ggctgaagat gaaaggtgat tataaaagac 5280

aaccaggagt gagtaagaag tgcacgagct cgaaggatgg aaactacgtg tatccctgtt 5340

gttgcactac acttgatgat ggctcagctg ttgaatcaac attttacccg ccaactaaga 5400

agcacctcgt aataggtaat agtggcgacc aaaagtatgt tgacttacca aaagggaatt 5460

ctgagatgtt atatattgcc aggcaaggct tctgttacat taacattttc ctcgcgatgt 5520

tgattaacat tagtgaggaa gatgcaaagg atttcactaa gaaggttcgt gacatgtgtg 5580

tgccaaagct tggaacctgg ccaaccatga tggatctggc tacaacttgt gctcaaatga 5640

gaatattcta ccctgatgtt catgatgcag aactgcctag aatactagtc gatcacgaaa 5700

cgcagacatg ccatgtggtt gactcgtttg gctcacaaac aactgggtat catattttga 5760

aagcatctag cgtgtcccaa cttattttgt ttgctaatga tgagttggag tctgacatta 5820

agcactatag agttggtggt attcctggag catgctctga gcttgggagc gtcatatcac 5880

cttttagaga aggaggaatc attatgtctg agtcagcagc gctaaaactg ctcctaaagg 5940

gaatttttag acctaaggtg atgagacagt tgctgttaga tgagccttac ctgttgattc 6000

tatcaatatt atctcctggc atactgatgg ctatgtataa taatgggatt tttgaacttg 6060

cagtaaggtt gtggattaat gagaaacaat ccatagccat gatagcatcg ctactatcag 6120

ctttagccct acgagtgtcg gcggcagaaa cactcgtcgc acagaggatt atcattgatg 6180

ctgcagctac agacctcctt gatgctacgt gtgatgggtt caacctacat ctaacgtacc 6240

ccactgcatt gatggtgttg caagttgtta agaatagaaa tgaatgtgat gataccctat 6300

tcaaggcggg tttttcaagt tacaacacga gcgtcgtaca gattatggaa aaaaattatc 6360

taaatctctt ggacgatgct tggaaagatt taacttggcg ggaaaaatta tccgcaacat 6420

ggtgctcata cagagcaaaa cgctctatca ctcggtacat aaaacccaca ggaagggcag 6480

atttgagagg gttatacaac atatcaccac aagcattctt gggtcgaagc gcccaggtgg 6540

tcaaaggtac tgcctcagga ttgagcgagc gatttaataa ttacttcaat actaagtgtg 6600

taaatatttc atcctttttc attcgtagaa tctttaggcg tttgccaact tttgtcactt 6660

ttgttaactc attattagtt attagtatgt tgactagcgt agtggcagtg tgtcaggcaa 6720

taattttaga tcagaggaag tataggagag aaatcgagtt gatgcagata gagaagaatg 6780

aaattgtctg catggagcta tatgcaagtt tacagcgcaa acttgaacgc gatttcacat 6840

gggatgagta cattgagtat ttgaaatcag taaaccctca gatagttcag tttgctcaag 6900

cgcagatgga agaatatgat gtgagacacc agcgttccac accaggtgtt aaaaatttgg 6960

aacaagtggt agcattcatg gctttagtca tcatggtgtt cgatgctgaa aggagtgatt 7020

gcgtgttcaa gactctcaat aaatttaagg gtgtcctttc ctcaatggac catgaagtta 7080

aacatcagtc cttagacgat gtgatcaaga actttgatga gaggaatgag attattgatt 7140

ttgaattgag tgaggacaca attcgaacat catcagtgct agatacaaag tttagtgatt 7200

ggtgggaccg acaaatccag atgggacata cacttccaca ttacagaacc gaggggcact 7260

tcatggaatt tacaagagca actgctgttc aagtggctaa tgacattgcc catagcgaac 7320

acctagactt tttagtaagg ggagctgttg ggtctggaaa gtcaactggg ttgcctgttc 7380

atcttagtgt agctggatct gtgcttttga ttgaaccaac gcgaccacta gcggagaacg 7440

ttttcaaaca gctatctagt gaaccattct tcaagaagcc aacactgcgt atgcgtggaa 7500

atagcatatt tggctcttct ccaatctccg tcatgactag tggatttgca ctacattact 7560

ttgccaacaa tcgctctcaa ttagctcagt tcaactttgt aatatttgat gagtgccatg 7620

ttctggatcc ttccgcaatg gcgttccgca gtctgctgag tgtttatcat caagcatgca 7680

aagtattaaa agtgtcagct actccagtgg gaagagaggt tgaatttaca acacagcaac 7740

cagtcaagtt aatagtggaa gacacactgt ctttccaatc atttgttgat gcacaaggtt 7800

ctaaaactaa tgctgatgtt gttcagtttg gttcgaacgt acttgtgtac gtgtcgagct 7860

acaatgaagt tgataccttg gctaagctcc taacagacaa gaatatgatg gtcacaaagg 7920

ttgatggcag aacaatgaag cacggttgcc tagaaattgt cacaaaagga accagtgcga 7980

gaccacattt tgttgtagca accaacataa ttgagaatgg agtgactttg gacatagacg 8040

tggttgtaga ttttgggttg aaagtctcac cgttcttgga cattgacaat aggagcattg 8100

cttacaataa ggtgagtgtt agctatggtg agagaattca aaggctgggt cgtgttggac 8160

gcttcaagaa aggagtagca ttgcgcattg gacacactga gaagggaatt attgaaattc 8220

caagcatgat cgctacagag gcggctcttg cttgctttgc atataacttg ccagtgatga 8280

caggaggcgt ctcaactagt ctgattggca attgtactgt gcgccaagtt aaaacaatgc 8340

agcaatttga attgagtccc ttctttatcc agaatttcgt cgcccatgat ggatcaatgc 8400

atcctgtcat acatgacatt cttaaaaagt ataaacttcg agattgtatg acacctttgt 8460

gcgatcagtc tataccatac agggcatcga gcacttggtt atcggttagt gaatatgagc 8520

gacttggagt ggccttagaa attccaaagc aagtcaaaat tgcattccat atcaaagaga 8580

tccctcctaa gctccacgaa atgctttggg aaacggttgt taagtacaaa gacgtttgct 8640

tatttccaag cattcgagca tcgtccatca gcaaaatcgc atacacattg cgtacagacc 8700

tcttcgccat cccaagaact ctaatattgg tggagagact gcttgaagag gagcgagtga 8760

agcagagcca attcagaagt ctcatcgatg aaggatgctc aagcatgttt tcaattgtca 8820

atttgacaaa cactctcaga gctagatatg caaaagatta caccgcagag aacatacaaa 8880

aacttgagaa agtgagaagt caattgaaag aattctcaaa tttggatggt tctgcatgtg 8940

aggaaaattt aataaagagg tatgagtctt tgcagttcgt tcatcaccag gctacgacgt 9000

cacttgcaaa ggatctcaag ttgaagggga cttggaagaa gtcattagtg gccaaagact 9060

tgatcatagc aggcgctgtt gcaattggtg gaataggact catatatagt tggttcacac 9120

aatcagttga gactgtgtct caccaaggga aaaataaatc caaaagaatt caagccttga 9180

agtttcgcca tgctcgtgac aaaagggctg gctttgaaat tgacaacaat gatgacacaa 9240

tagaggaatt ctttggatct gcatacagga aaaagggaaa aggtaaaggt accactgttg 9300

gtatgggcaa gtcaagcagg aggtttgtta atatgtatgg atttgaccca acagaatatt 9360

cattcatcca gttcgttgat ccgctcactg gagctcaaat tgaagagaac gtctatgctg 9420

atattagaga catccaagag cgctttagtg atgttcgcaa gaaaatggta gaggatgatg 9480

aaatcgaatt gcaagcattg ggcagcaaca caaccattca tgcttacttc aggaaagatt 9540

ggtctgacaa ggctcttaaa gttgatttga tgccacacaa cccactcaaa atctgtgata 9600

aatcgaatgg tattgctaag tttcctgaaa gagaacttga gttgaggcaa actgggccag 9660

caacagaggt tgatgtgaaa gacattccaa aacaggaagt ggagcatgaa gccaaatcac 9720

tcatgagagg tttaagggat ttcaatccaa ttgctcaaac agtttgcaga gtaaaagtgt 9780

ctgttgaata tggaacgtct gaaatgtatg gattcggttt tggtgcgtat attatagtaa 9840

accaccatct attcaagagc ttcaatggat ccatggaagt gcgatcaatg catggaacat 9900

tcagagtgaa gaatttgcat agcttgagcg ttttaccgat caaaggcaga gacattatca 9960

tcataaagat gccaaaggat ttccctattt tcccacaaaa actgcacttc cgagctccag 10020

tgcagaatga gaggatttgt ttggttggaa ctaattttca agaaaaacat gcatcatcaa 10080

tcatcacaga aacgagtact acgtacaatg taccgggcag cactttttgg aagcattgga 10140

ttgaaacaaa tgatgggcat tgtggattac cagtagtgag tacagctgat ggatgtctag 10200

ttggaataca cagcttggcg aataatgtgc aaaccacgaa ttattattca gcctttgatg 10260

aggattttga aagtaagtat ctccgaacta atgagcataa tgagtggacc aaatcgtggg 10320

tatataaccc agatactgta ttgtggggtc cgttgaagct caaggagagt acccctaaag 10380

gcctgtttaa gacaacaaaa cttgtacagg atttaattga tcatgatgtt gttgtagagc 10440

aagctaaaca ttctgcgtgg atgtatgagg ctctaacagg gaatttgcaa gctgtggcga 10500

caatgaagag tcagctagtg acaaagcacg tggtcaaagg ggagtgtcgg cacttcaaag 10560

agttcttaac tgtggattcg gaagcagaag ctttcttcag gcctttgatg gatgcttatg 10620

ggaagagctt gttaaataga gaagcatata taaaggacat aatgaaatac tcaaagccta 10680

ttgatgttgg aatagtagac tgtgatgctt ttgaagaggc tatcaatagg gttatcattt 10740

atctgcaagt gcatggcttc cagaaatgca attacatcac cgatgagcag gaaattttca 10800

aagctctcaa tatgaaagct gctgtcggag caatgtatgg aggcaagaag aaagactact 10860

tcgagcattt tactgaggcg gataaagagg aaattgttat gcaaagttgc tttcgattgt 10920

acaagggctc gcttggcata tggaatggat cattgaaagc agaacttcgg tgcaaagaga 10980

agatacttgc aaataagaca aggactttca ctgctgcacc tttagatact ttattgggtg 11040

gaaaggtgtg cgttgacgat tttaataatc aattctactc aaagaacatt gaatgctgct 11100

ggactgttgg aatgactaag ttttatggag gttgggacaa attgcttcgg cgtctacctg 11160

aaaattgggt gtactgcgat gccgatggtt cacaattcga tagttcactc accccatacc 11220

taattaatgc tgttctcatc atcagaagca catacatgga agattgggat ttggggttgc 11280

aaatgttgcg caatttgtac acagaaataa tttacacacc aatctcaact ccagatggaa 11340

caattgtcaa gaagtttaga ggtaataata gcggtcaacc ttctaccgtt gtggataatt 11400

ctctcatggt tgtccttgct atgcattacg ctctcattaa ggagtgcgtc gagtttgaag 11460

aaatcgacag cacgtgtgta ttctttgtta atggtgatga cttattgatt gctgtgaatc 11520

cggagaaaga gagcattctc gatagaatgt cacaacattt ctcagatctt ggtttgaact 11580

atgatttttc gtcgagaaca agaaggaagg aggaattgtg gttcatgtcc catagaggcc 11640

tgctaatcga gggtatgtac gtgccaaagc ttgaagaaga gagaattgta tccattctgc 11700

aatgggatag agctgatctg ccagagcaca gattagaagc gatctgtgca gcaatgatag 11760

aatcctgggg ttattctgag ttaacgcacc aaatcaggag attctactca tggttgttgc 11820

aacagcaacc tttttcaacg atagcacagg aaggaaaagc tccatacata gcgagcatgg 11880

cattgaagaa gctgtacatg gataggacag tagatgagga ggaactgaag gctttcactg 11940

aaatgatggt tgccttggat gatgaatttg agtgcgatac ttatgaagta caccatcaag 12000

caaatgacac aatcgttgca ggaggaagca gcaagaaaga tgcaaaacca gagcaagaca 12060

gcatccagtc agacccgaac aaaggaaaag ataaggatgt gaatgctggt acatctggga 12120

cacatactgt gccgagaatc aaggctatca cgtccaaaat gagaatgccc aaaagcaagg 12180

gagcaaccgt gctaaactta ggacacttgc ttgagtatgc tccacaacaa attgatattt 12240

caaatactcg ggcaactcaa tcacagtttg atacgtggta tgaggcagtg cggatggcat 12300

acgacatagg agaaactgag atgccaactg tgatgaatgg gcttatggtt tggtgcattg 12360

aaaatggaac ctcgccaaat gtcaacggag tctgggttat gatggatggg gatgaacaag 12420

tcgagtaccc gttgaaacca atcgttgaga atgcgaaacc aacccttagg caaatcatgg 12480

cacatttctc agatgttgca gaagcgtata tagaaatgcg caacaaaaag gaaccatata 12540

tgccacgata tggtttaatt cgaaatctgc gggatgtggg tttagcgcgt tatgcctttg 12600

acttttatga ggtcacatca cgaacaccag tgagggctag ggaagcgcac attcaaatga 12660

aggccgcagc attgaaatca gcccaacctc gacttttcgg gttggacggt ggcatcagta 12720

cacaagagga aaacacagag aggcacacca ccgaggatgt ttctccaagt atgcatactc 12780

tacttggagt taagaacatg tgatatagtg tctctccgga cgatatataa gtatttacat 12840

atgcagtaag tattttggct tttcctgtac tacttttatc ataattaata atcagtttga 12900

atattactaa tagatagagg tggcagggtg atttcgtcat tgtggtgact ctatctgtta 12960

attccgtatt attaagtctt agataaaagt gccgggttgt cgttgttgtg gatgattcat 13020

cgattaggtg atgttgcgat tctgtcgtaa cagtgactac gtctggatct atctacttgg 13080

gtggtgttgt gattccgtca taacagtgac tgtaaacttc aatcaggaga caaaaaaaaa 13140

aaaaaaaaaa attaattaag acccgggact agtccctaga gtcctgcttt aatgagatat 13200

gcgagacgcc tatgatcgca tgatatttgc tttcaattct gttgtgcacg ttgtaaaaaa 13260

cctgagcatg tgtagctcag atccttaccg ccggtttcgg ttcattctaa tgaatatatc 13320

acccgttact atcgtatttt tatgaataat attctccgtt caatttactg attgtaccct 13380

actacttata tgtacaatat taaaatgaaa acaatatatt gtgctgaata ggtttatagc 13440

gacatctatg atagagcgcc acaataacaa acaattgcgt tttattatta caaatccaat 13500

tttaaaaaaa gcggcagaac cggtcaaacc taaaagactg attacataaa tcttattcaa 13560

atttcaaaag tgccccaggg gctagtatct acgacacacc gagcggcgaa ctaataacgc 13620

tcactgaagg gaactccggt tccccgccgg cgcgcatggg tgagattcct tgaagttgag 13680

tattggccgt ccgctctacc gaaagttacg ggcaccattc aacccggtcc agcacggcgg 13740

ccgggtaacc gacttgctgc cccgagaatt atgcagcatt tttttggtgt atgtgggccc 13800

caaatgaagt gcaggtcaaa ccttgacagt gacgacaaat cgttgggcgg gtccagggcg 13860

aattttgcga caacatgtcg aggctcagca ggacctgcag gcatgcaagc ttggcactgg 13920

ccgtcgtttt acaacgtcgt gactgggaaa accctggcgt tacccaactt aatcgccttg 13980

cagcacatcc ccctttcgcc agctggcgta atagcgaaga ggcccgcacc gatcgccctt 14040

cccaacagtt gcgcagcctg aatggcgaat gctagagcag cttgagcttg gatcagattg 14100

tcgtttcccg ccttcagttt aaactatcag tgtttgacag gatatattgg cgggtaaacc 14160

taagagaaaa gagcgtttat tagaataacg gatatttaaa agggcgtgaa aaggtttatc 14220

cgttcgtcca tttgtatgtg catgccaacc acagggttcc cctcgggatc aaagtacttt 14280

gatccaaccc ctccgctgct atagtgcagt cggcttctga cgttcagtgc agccgtcttc 14340

tgaaaacgac atgtcgcaca agtcctaagt tacgcgacag gctgccgccc tgcccttttc 14400

ctggcgtttt cttgtcgcgt gttttagtcg cataaagtag aatacttgcg actagaaccg 14460

gagacattac gccatgaaca agagcgccgc cgctggcctg ctgggctatg cccgcgtcag 14520

caccgacgac caggacttga ccaaccaacg ggccgaactg cacgcggccg gctgcaccaa 14580

gctgttttcc gagaagatca ccggcaccag gcgcgaccgc ccggagctgg ccaggatgct 14640

tgaccaccta cgccctggcg acgttgtgac agtgaccagg ctagaccgcc tggcccgcag 14700

cacccgcgac ctactggaca ttgccgagcg catccaggag gccggcgcgg gcctgcgtag 14760

cctggcagag ccgtgggccg acaccaccac gccggccggc cgcatggtgt tgaccgtgtt 14820

cgccggcatt gccgagttcg agcgttccct aatcatcgac cgcacccgga gcgggcgcga 14880

ggccgccaag gcccgaggcg tgaagtttgg cccccgccct accctcaccc cggcacagat 14940

cgcgcacgcc cgcgagctga tcgaccagga aggccgcacc gtgaaagagg cggctgcact 15000

gcttggcgtg catcgctcga ccctgtaccg cgcacttgag cgcagcgagg aagtgacgcc 15060

caccgaggcc aggcggcgcg gtgccttccg tgaggacgca ttgaccgagg ccgacgccct 15120

ggcggccgcc gagaatgaac gccaagagga acaagcatga aaccgcacca ggacggccag 15180

gacgaaccgt ttttcattac cgaagagatc gaggcggaga tgatcgcggc cgggtacgtg 15240

ttcgagccgc ccgcgcacgt ctcaaccgtg cggctgcatg aaatcctggc cggtttgtct 15300

gatgccaagc tggcggcctg gccggccagc ttggccgctg aagaaaccga gcgccgccgt 15360

ctaaaaaggt gatgtgtatt tgagtaaaac agcttgcgtc atgcggtcgc tgcgtatatg 15420

atgcgatgag taaataaaca aatacgcaag gggaacgcat gaaggttatc gctgtactta 15480

accagaaagg cgggtcaggc aagacgacca tcgcaaccca tctagcccgc gccctgcaac 15540

tcgccggggc cgatgttctg ttagtcgatt ccgatcccca gggcagtgcc cgcgattggg 15600

cggccgtgcg ggaagatcaa ccgctaaccg ttgtcggcat cgaccgcccg acgattgacc 15660

gcgacgtgaa ggccatcggc cggcgcgact tcgtagtgat cgacggagcg ccccaggcgg 15720

cggacttggc tgtgtccgcg atcaaggcag ccgacttcgt gctgattccg gtgcagccaa 15780

gcccttacga catatgggcc accgccgacc tggtggagct ggttaagcag cgcattgagg 15840

tcacggatgg aaggctacaa gcggcctttg tcgtgtcgcg ggcgatcaaa ggcacgcgca 15900

tcggcggtga ggttgccgag gcgctggccg ggtacgagct gcccattctt gagtcccgta 15960

tcacgcagcg cgtgagctac ccaggcactg ccgccgccgg cacaaccgtt cttgaatcag 16020

aacccgaggg cgacgctgcc cgcgaggtcc aggcgctggc cgctgaaatt aaatcaaaac 16080

tcatttgagt taatgaggta aagagaaaat gagcaaaagc acaaacacgc taagtgccgg 16140

ccgtccgagc gcacgcagca gcaaggctgc aacgttggcc agcctggcag acacgccagc 16200

catgaagcgg gtcaactttc agttgccggc ggaggatcac accaagctga agatgtacgc 16260

ggtacgccaa ggcaagacca ttaccgagct gctatctgaa tacatcgcgc agctaccaga 16320

gtaaatgagc aaatgaataa atgagtagat gaattttagc ggctaaagga ggcggcatgg 16380

aaaatcaaga acaaccaggc accgacgccg tggaatgccc catgtgtgga ggaacgggcg 16440

gttggccagg cgtaagcggc tgggttgtct gccggccctg caatggcact ggaaccccca 16500

agcccgagga atcggcgtga gcggtcgcaa accatccggc ccggtacaaa tcggcgcggc 16560

gctgggtgat gacctggtgg agaagttgaa ggccgcgcag gccgcccagc ggcaacgcat 16620

cgaggcagaa gcacgccccg gtgaatcgtg gcaagcggcc gctgatcgaa tccgcaaaga 16680

atcccggcaa ccgccggcag ccggtgcgcc gtcgattagg aagccgccca agggcgacga 16740

gcaaccagat tttttcgttc cgatgctcta tgacgtgggc acccgcgata gtcgcagcat 16800

catggacgtg gccgttttcc gtctgtcgaa gcgtgaccga cgagctggcg aggtgatccg 16860

ctacgagctt ccagacgggc acgtagaggt ttccgcaggg ccggccggca tggccagtgt 16920

gtgggattac gacctggtac tgatggcggt ttcccatcta accgaatcca tgaaccgata 16980

ccgggaaggg aagggagaca agcccggccg cgtgttccgt ccacacgttg cggacgtact 17040

caagttctgc cggcgagccg atggcggaaa gcagaaagac gacctggtag aaacctgcat 17100

tcggttaaac accacgcacg ttgccatgca gcgtacgaag aaggccaaga acggccgcct 17160

ggtgacggta tccgagggtg aagccttgat tagccgctac aagatcgtaa agagcgaaac 17220

cgggcggccg gagtacatcg agatcgagct agctgattgg atgtaccgcg agatcacaga 17280

aggcaagaac ccggacgtgc tgacggttca ccccgattac tttttgatcg atcccggcat 17340

cggccgtttt ctctaccgcc tggcacgccg cgccgcaggc aaggcagaag ccagatggtt 17400

gttcaagacg atctacgaac gcagtggcag cgccggagag ttcaagaagt tctgtttcac 17460

cgtgcgcaag ctgatcgggt caaatgacct gccggagtac gatttgaagg aggaggcggg 17520

gcaggctggc ccgatcctag tcatgcgcta ccgcaacctg atcgagggcg aagcatccgc 17580

cggttcctaa tgtacggagc agatgctagg gcaaattgcc ctagcagggg aaaaaggtcg 17640

aaaaggtctc tttcctgtgg atagcacgta cattgggaac ccaaagccgt acattgggaa 17700

ccggaacccg tacattggga acccaaagcc gtacattggg aaccggtcac acatgtaagt 17760

gactgatata aaagagaaaa aaggcgattt ttccgcctaa aactctttaa aacttattaa 17820

aactcttaaa acccgcctgg cctgtgcata actgtctggc cagcgcacag ccgaagagct 17880

gcaaaaagcg cctacccttc ggtcgctgcg ctccctacgc cccgccgctt cgcgtcggcc 17940

tatcgcggcc gctggccgct caaaaatggc tggcctacgg ccaggcaatc taccagggcg 18000

cggacaagcc gcgccgtcgc cactcgaccg ccggcgccca catcaaggca ccctgcctcg 18060

cgcgtttcgg tgatgacggt gaaaacctct gacacatgca gctcccggag acggtcacag 18120

cttgtctgta agcggatgcc gggagcagac aagcccgtca gggcgcgtca gcgggtgttg 18180

gcgggtgtcg gggcgcagcc atgacccagt cacgtagcga tagcggagtg tatactggct 18240

taactatgcg gcatcagagc agattgtact gagagtgcac catatgcggt gtgaaatacc 18300

gcacagatgc gtaaggagaa aataccgcat caggcgctct tccgcttcct cgctcactga 18360

ctcgctgcgc tcggtcgttc ggctgcggcg agcggtatca gctcactcaa aggcggtaat 18420

acggttatcc acagaatcag gggataacgc aggaaagaac atgtgagcaa aaggccagca 18480

aaaggccagg aaccgtaaaa aggccgcgtt gctggcgttt ttccataggc tccgcccccc 18540

tgacgagcat cacaaaaatc gacgctcaag tcagaggtgg cgaaacccga caggactata 18600

aagataccag gcgtttcccc ctggaagctc cctcgtgcgc tctcctgttc cgaccctgcc 18660

gcttaccgga tacctgtccg cctttctccc ttcgggaagc gtggcgcttt ctcatagctc 18720

acgctgtagg tatctcagtt cggtgtaggt cgttcgctcc aagctgggct gtgtgcacga 18780

accccccgtt cagcccgacc gctgcgcctt atccggtaac tatcgtcttg agtccaaccc 18840

ggtaagacac gacttatcgc cactggcagc agccactggt aacaggatta gcagagcgag 18900

gtatgtaggc ggtgctacag agttcttgaa gtggtggcct aactacggct acactagaag 18960

gacagtattt ggtatctgcg ctctgctgaa gccagttacc ttcggaaaaa gagttggtag 19020

ctcttgatcc ggcaaacaaa ccaccgctgg tagcggtggt ttttttgttt gcaagcagca 19080

gattacgcgc agaaaaaaag gatctcaaga agatcctttg atcttttcta cggggtctga 19140

cgctcagtgg aacgaaaact cacgttaagg gattttggtc atgcattcta ggtactaaaa 19200

caattcatcc agtaaaatat aatattttat tttctcccaa tcaggcttga tccccagtaa 19260

gtcaaaaaat agctcgacat actgttcttc cccgatatcc tccctgatcg accggacgca 19320

gaaggcaatg tcataccact tgtccgccct gccgcttctc ccaagatcaa taaagccact 19380

tactttgcca tctttcacaa agatgttgct gtctcccagg tcgccgtggg aaaagacaag 19440

ttcctcttcg ggcttttccg tctttaaaaa atcatacagc tcgcgcggat ctttaaatgg 19500

agtgtcttct tcccagtttt cgcaatccac atcggccaga tcgttattca gtaagtaatc 19560

caattcggct aagcggctgt ctaagctatt cgtataggga caatccgata tgtcgatgga 19620

gtgaaagagc ctgatgcact ccgcatacag ctcgataatc ttttcagggc tttgttcatc 19680

ttcatactct tccgagcaaa ggacgccatc ggcctcactc atgagcagat tgctccagcc 19740

atcatgccgt tcaaagtgca ggacctttgg aacaggcagc tttccttcca gccatagcat 19800

catgtccttt tcccgttcca catcataggt ggtcccttta taccggctgt ccgtcatttt 19860

taaatatagg ttttcatttt ctcccaccag cttatatacc ttagcaggag acattccttc 19920

cgtatctttt acgcagcggt atttttcgat cagttttttc aattccggtg atattctcat 19980

tttagccatt tattatttcc ttcctctttt ctacagtatt taaagatacc ccaagaagct 20040

aattataaca agacgaactc caattcactg ttccttgcat tctaaaacct taaataccag 20100

aaaacagctt tttcaaagtt gttttcaaag ttggcgtata acatagtatc gacggagccg 20160

attttgaaac ctctttgatc acaggcagca acgctctgtc atcgttacaa tcaacatgct 20220

accctccgcg agatcatccg tgtttcaaac ccggcagctt agttgccgtt cttccgaata 20280

gcatcggtaa catgagcaaa gtctgccgcc ttacaacggc tctcccgctg acgccgtccc 20340

ggactgatgg gctgcctgta tcgagtggtg attttgtgcc gagctgccgg tcggggagct 20400

gttggctggc tgg 20413

Claims (10)

1. A latex-like protein 43, wherein the amino acid sequence of said latex-like protein 43 is as set forth in SEQ ID NO: 1 is shown.

2. A nucleic acid molecule encoding the latex-like protein 43 of claim 1, wherein the nucleotide sequence of said nucleic acid molecule is as set forth in SEQ ID NO: 2, respectively.

3. A recombinant expression vector of the latex-like protein 43 of claim 1, wherein the recombinant expression vector is obtained by inserting the nucleic acid molecule of claim 2 into a multiple cloning site of an expression vector; the expression vector comprises one of a prokaryotic expression vector, a eukaryotic expression vector and a viral expression vector.

4. The recombinant expression vector of claim 3, wherein the nucleic acid molecule further comprises a coding tag sequence upstream of the expression vector, wherein the coding tag sequence comprises one of a His tag, an HA tag, a GFP tag, and a Flag tag.

5. A method for preparing an expression vector for latex-like protein 43, comprising:

obtaining a target gene segment of the latex-like protein 43 of claim 1;

adopting the target gene fragment as SEQ ID NO: 3-4, carrying out PCR to obtain a PCR product;

vector pFu46-RFP is subjected to XhoI/KpnI double enzyme digestion and then is enzymatically linked with the PCR product to obtain plant expression vector p35S: MLP43: RFP.

6. A recombinant cell line or recombinant expression bacterium for expressing the latex-like protein 43 of claim 1, comprising the recombinant expression vector of any one of claims 3 to 4.

7. A method of producing a transgenic plant expressing the latex-like protein 43 of claim 1, said method comprising:

obtaining an expression vector of the latex-like protein 43;

transforming the expression vector of the latex-like protein 43 into agrobacterium tumefaciens EHA105 to obtain an agrobacterium transformant;

and infecting flue-cured tobacco leaves with the agrobacterium transformant to obtain a T0 generation transgenic plant.

8. A latex protein 43-like transgenic plant obtained by the method of claim 7.

9. Use of the latex-like protein 43 of claim 1 and/or the nucleic acid molecule of claim 2 and/or the recombinant expression vector of any one of claims 3-4 for inhibiting plant viral infection.

10. A method of inhibiting viral infection in a plant, said method comprising: the recombinant expression vector of any one of claims 3-4 is used for mediating plant genetic transformation by means of genetic engineering to obtain transgenic plants capable of inhibiting plant virus infection.

Images