CN108192951A - Observe tumour cell excretion body and the method for miRNA DYNAMIC DISTRIBUTIONs in recipient cell inside excretion body - Google Patents
Observe tumour cell excretion body and the method for miRNA DYNAMIC DISTRIBUTIONs in recipient cell inside excretion body Download PDFInfo
- Publication number
- CN108192951A CN108192951A CN201711429720.XA CN201711429720A CN108192951A CN 108192951 A CN108192951 A CN 108192951A CN 201711429720 A CN201711429720 A CN 201711429720A CN 108192951 A CN108192951 A CN 108192951A
- Authority
- CN
- China
- Prior art keywords
- excretion body
- cell
- mirna
- excretion
- tumour cell
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6816—Hybridisation assays characterised by the detection means
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N21/00—Investigating or analysing materials by the use of optical means, i.e. using sub-millimetre waves, infrared, visible or ultraviolet light
- G01N21/62—Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light
- G01N21/63—Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light optically excited
- G01N21/64—Fluorescence; Phosphorescence
- G01N21/6486—Measuring fluorescence of biological material, e.g. DNA, RNA, cells
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Physics & Mathematics (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Molecular Biology (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Zoology (AREA)
- Immunology (AREA)
- Wood Science & Technology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Microbiology (AREA)
- Biomedical Technology (AREA)
- Pathology (AREA)
- General Physics & Mathematics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Investigating Or Analysing Biological Materials (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention discloses a kind of method for observing miRNA DYNAMIC DISTRIBUTIONs in recipient cell inside tumour cell excretion body and excretion body, after extracting tumour cell excretion body, fluorescent marker is carried out to miRNA inside tumour cell excretion body film and its excretion body, while use cell membrane staining reagent recipient cell respectively using excretion body film coloring agent and with the molecular beacon of miRNA complementations inside excretion body；It will be through the good tumour cell excretion body of fluorescent marker and the recipient cell co-incubation dyed, tumour cell excretion body adds in imaging buffer solution after interacting with recipient cell, living cells interior excretion body and its dynamic tracer of inside miRNA are realized using surper resolution optical microscope.The present invention solves the problems, such as that, in the prior art since diffraction limit limitation careful can not observe excretion body, cancer metastasis mechanism and cancer metastasis for research excretion body mediation spread Therapy study and provides new technological means.
Description
Technical field
The present invention relates to bio-photon fields, and in particular to inside a kind of observation tumour cell excretion and excretion body
The method of miRNA DYNAMIC DISTRIBUTIONs in recipient cell.
Background technology
Excretion body is one kind in the vesica secreted out of by cell, size about 30-100nm.This interesting nanoscale
Vesica outer layer is lipid film, and expression has specific signaling molecule thereon, and the biomolecule such as protein, RNA are contained inside it.
Excretion body plays highly important role in cell-cell communication and mass exchange.Existing research shows that excretion body with by
Interaction between body cell is broadly divided into three kinds：1）Excretion body is combined by the excretion body adhesion molecule on recipient cell surface
To recipient cell surface；2）Excretion body is directly merged with recipient cell；3）The encytosis that excretion body is connected to by receptor
Into recipient cell.Tumour cell excretion body and the development relationship of tumour are closely related, and one side excretion physical efficiency transformation tumour is micro-
Environment makes it be more suitable for the growth of tumour；On the other hand, tumour cell excretion body again with " infection " recipient cell can
Energy.This causes excretion body to become a kind of important tumor markers and potential AD-targeted drugs.But tumour cell excretion
The practical role that body is played the part of in the evolution of cancer is unclear.Therefore, study tumor cell excretion body is needed exist for
It is modality of cancer treatment so as to the cancer metastasis mechanism of deeply parsing excretion body mediation with the interaction process of recipient cell
The useful reference information of determining offer.
However, the size of excretion body 30-100nm substantially increases the difficulty being observed to it, currently used for observation
The method of excretion body has nano particle trace analysis technology（NTA）, confocal microscopy（CLSM）, electron microscopy（TEM、
SEM）, flow cytometry（FCM）Deng, wherein, it is subordinate to the CLSM of optical microscopy since its is lossless, intuitive and can real-time tracking
Observe living cells sample the features such as and obtain relatively broad application, but the resolution ratio of light microscope is by diffraction limit
Limitation, is typically only capable to reach 200-300nm, this causes the light microscopes such as CLSM that can not carry out careful observation to excretion body.
In recent years, scientists are directed to the resolution limit of light microscope, and the oversubscription of diffraction limit can be broken through by having developed several classes
Distinguish light microscope.Such as stimulated emission depletion microscope（STED）, Structured Illumination microscope（SIM）, random optical rebuild
Microscope（STORM）And photoactivation position finding microscope（PALM）Deng.Wherein, with the attainable resolution ratio of STORM/PALM technologies
The most prominent, their image-forming principle is similar, is all based on unimolecule positioning microtechnic.At present, the microscopes such as Zeiss, Nikon factory
Quotient has been proposed the super-resolution microscopic system of the 50-80nm resolution ratio based on PALM/STORM technologies.
Invention content
Under above-mentioned background, the present invention proposes swollen using the super-resolution optical imaging technique observation based on unimolecule positioning mode
DYNAMIC DISTRIBUTION of the oncocyte excretion body with miRNA inside excretion body in recipient cell, solves in the prior art due to diffraction
Limit limitation can not careful the problem of observing excretion body, the cancer metastasis mechanism mediated for research excretion body and cancer metastasis expansion
Scattered Therapy study provides new technological means.
To solve the above problems, the present invention is using following technical scheme, a kind of observation tumour cell excretion body and excretion body
The method of internal miRNA DYNAMIC DISTRIBUTIONs in recipient cell, includes the following steps：
1）After extracting tumour cell excretion body, believe using excretion body film coloring agent and with the molecule of miRNA complementations inside excretion body
Mark carries out fluorescent marker to miRNA inside tumour cell excretion body film and its excretion body respectively, while uses cell membrane coloring agent
Dye recipient cell；
2）It will be through step 1）The good tumour cell excretion body of fluorescent marker and the recipient cell co-incubation dyed, make tumour thin
Extracellular body of secreting interacts with recipient cell；
3）After tumour cell excretion body interacts with recipient cell, the imaging buffering needed for unimolecule positioning imaging is added in
Liquid realizes living cells interior excretion body and its dynamic tracer of inside miRNA using surper resolution optical microscope.
Wherein, when carrying out living cells super-resolution imaging using surper resolution optical microscope, recipient cell after birth passes through complete interior anti-
It penetrates（TIRF）Micro-imaging, excretion body film are imaged with miRNA inside excretion body by super-resolution optical microtechnic, the super-resolution
Optical microscope imaging method is based on unimolecule location technology, and resolution ratio is improved to 50-80nm, can meticulously observe excretion body
And its DYNAMIC DISTRIBUTIONs of the inside miRNA in recipient cell.
When carrying out fluorescent molecular label, the fluorescent molecular and cell membrane modified on excretion body film coloring agent, molecular beacon
The fluorescence emission spectrum of coloring agent cannot have notable overlapping, i.e., be spaced more than 30nm between fluorescence emission peak.
In order to adapt to unimolecule positioning super-resolution optical imaging, the fluorescent molecular and excretion modified on the molecular beacon
Body film coloring agent is with scintillation fluor（blink）Effect；Preferably, the excretion body film coloring agent is glimmering for lipophilicity
Photoinitiator dye, further preferably DiI or PKH26；The fluorescent molecular modified on the molecular beacon is Alexa Fluor 647
Or Cy5.In addition, when carrying out tumour cell excretion body fluorescent marker, the miRNA to be marked is in the outer of tumor cell secretion
Secrete miRNA of the in-vivo content far above the excretion body of normal cell secretion.
Preferably, the cell membrane coloring agent is PKH67 or DiO.
Wherein it is preferred to the specific method of the extraction tumour cell excretion body is outside being added in into cell culture supernatant
Secrete body extracting solution, after 3-4 DEG C is reacted 12-24h, the excretion body that centrifuges precipitation be dispersed in 100-150 μ LPBS be made into it is outer
Liquid solution is secreted, wherein added in excretion body extracting solution is 1 with cell culture supernatant and volume ratio：5.
Fluorescent marker tumour cell excretion body specifically comprises the following steps：
The first step：The molecular beacon with miRNA complementations inside excretion body is added in the excretion liquid solution extracted, is hybridized
Reaction, molecular beacon a concentration of 5-20nM in excretion liquid solution；
Second step：Excretion body film dye marker excretion body film, the dyeing of excretion body film are added in the excretion liquid solution extracted
Agent a concentration of 1-5nM in excretion liquid solution；
Third walks：Extra excretion body film dyestuff and molecular beacon probe are filtered out using super filter tube.
Preferably, the imaging buffer solution has 27mM-mercaptoethanol to add in, 1wt% glucose, 0.1mg/mL's
The DMEM culture mediums of the catalase of glucose oxidase and 8 μ g/mL, it can be achieved that excretion body and its inside miRNA in work
The intracellular dynamic up to more than 1h is observed.
Advantageous effect：
1st, the present invention realizes the super-resolution optical imaging of miRNA inside excretion body and excretion body, can carry out more accurate
Positioning, more meticulously observe excretion body and its inside miRNA.
2 present invention use the imaging buffer solution of hypotoxicity, can realize excretion body and its inside miRNA in living cells
Dynamic observation.
3rd, the present invention uses the dye molecule with scintillation fluor effect as fluorescence probe, this kind of probe quantum yield
Height, illuminated state duty ratio is small, on-off times are more, good light stability and mark density are high, is conducive to improve unimolecule positioning imaging
Resolution ratio.
4th, the present invention utilizes the miRNA inside molecular beacon marked tumor cell excretion body, high sensitivity, fluorescence background
It is low.
Description of the drawings
Fig. 1 is the result that wide field and unimolecule positioning imaging are carried out to the miRNA in excretion body.（a）Common wide field is micro-
Formed by mirror in single excretion body miRNA image；（b）MiRNA in single excretion body formed by unimolecule position finding microscope
Image；（c）The fluorescence intensity distribution of the excretion body radially, it can be seen that unimolecule positioning is aobvious from fluorescence intensity profile
The excretion body size observed in micro mirror is significantly less than common wide-field microscope.
Fig. 2 is into Mobile state super-resolution optical imaging tracking figure to the excretion body in recipient cell；What is shown in the figure is white
Color dot is different excretion bodies, wherein, the excretion body of arrow meaning is same excretion body, moves to other positions at any time.
Fig. 3 is into Mobile state super-resolution optical imaging tracking figure, the figure to the mir-21 in recipient cell inside excretion body
The white point of middle display is different mir-21, wherein, the mir-21 of arrow meaning is same mir-21, moves to other at any time
Position.
Specific embodiment
In order to deepen the understanding of the present invention, below in conjunction with embodiment, the invention will be further described, the embodiment
It is only used for explaining the present invention, be not intended to limit the scope of the present invention..
Embodiment 1
PBS buffer solution involved in the embodiment is pH=7.4, the PBS buffer solution of a concentration of 10mM；The recipient cell after birth being related to
Dyestuff is PKH67, and reaction solution is the Diluent C solutions that sigma companies provide；The unimolecule positioning super-resolution light being related to
Imaging technique is PALM technologies, and the hypotoxicity imaging buffer solution being related to is DMEM culture mediums, wherein equipped with 27mM-sulfydryl
The catalase of ethyl alcohol, 1wt% glucose, the glucose oxidase of 0.1mg/mL and 8 μ g/mL；Outside the tumour cell being related to
Body is secreted for HeLa cell excretion bodies, and recipient cell is PC12 cells；MiRNA is mir- inside the tumour cell excretion body being related to
21,3 ' AGUUGUAGUCAGACUAUUCGAU 5 ' of sequence, the molecular beacon MB21 sequences used is 5 ' Cy5-
CTCTTTCAACATCAGTCTGATAAGCTAAAGAG-BHQ3 3 ', wherein Cy5 are fluorescent molecular, and BHQ3 is quenching group.It relates to
And excretion body film dyestuff be DiI;The excretion body extracting solution being related to is the ExoQuick-TC Exosomes of SBI companies
That is furnished in Preciptation Solution excretion body kits secretes body extracting solution.
Step 1: extraction tumour cell excretion body
Take the 1 × 10 of 5mL6The conditioned medium of the HeLa cells of a exponential phase is centrifuged 15 minutes with 3000 × g, taken
It cleans except the cell in suspension.The ExoQuick-TC Exosomes Preciptation provided using SBI companies
Solution excretion bodies kit extracts, and 1mL excretion body extracting solutions are added in into cell suspending liquid supernatant in 4oC reactions are overnight.
Mixed solution under 10000 × g rotating speeds is centrifuged 20 minutes, precipitation is taken to be resuspended in the PBS buffer solution of 100 μ L in -75oC freezes
It deposits.
Step 2: excretion body and its inside miRNA fluorescent markers
5 μ L excretion bodies frozen stock solutions is taken to be diluted in the PBS solution of 400 μ L after dissolving, 10 μM of the MB21 of 5 μ L of addition, 37oC shakes
Bed hybridization reaction adds in 1 μM of the DiI solution of 1 μ L, the reaction was continued 15 minutes after 2 hours.By reaction solution in 50KDa ultrafiltration
Pipe 6000rmp Ultrafiltration Purifyings 20 minutes remove extra molecular beacon MB21 and DiI.The PBS that precipitation is diluted in 400 μ L is molten
In liquid, in 4oC preserves for use.
Step 3: recipient cell dyes
The PKH67 solution of 0.2 μ L is taken to be diluted in the reaction solution of 50 μ L as cell membrane coloring agent, recipient cell PC12 cultures 48
After hour, extra culture solution is sucked, after gently being flushed three times with PBS, adds in 100 μ L PKH67 reaction buffers.By what is prepared
Cell membrane coloring agent is added in cell ware, and jiggling makes it be evenly distributed, and cell ware is continued to be put into, 4 points are reacted in incubator
It is taken out after clock, removes extra coloring agent, add in 1% BSA of 200 μ L for terminating PKH67 dyeing, it is extra to remove after five minutes
BSA adds in fresh medium.
Step 4: tumour excretion body is co-cultured and is imaged with normal cell
The labeled excretion liquid solutions of 50 μ L are uniformly instilled into normal cell, then continue to be put into cell culture fluid by cell ware
In after its co-culture 30 minutes after take out, suck extra culture solution, after gently being flushed three times with PBS, add in 200 μ L hypotoxicities
PALM imaging buffer solution after, pass through surper resolution optical microscope（Zeiss Elyra P.1）It can be respectively to excretion body and outer
It secretes internal portion mir-21 and carries out PALM imagings, 10000 frame pictures are acquired using the frame rate of 50Hz, wherein every 200 frame rebuilds one
Super-resolution picture is opened, it is final to realize that the dynamic that temporal resolution is 4s is observed.When observing excretion body, excitation wavelength 543nm, filter
Mating plate is 560-590nm bandpass filters, observes dynamic super-resolution optical imaging tracking figure of the excretion body in recipient cell
As shown in Figure 2；When observing mir-21, excitation wavelength 642nm, optical filter is 655nm long pass filters, is observed in excretion body
The mir-21 in portion dynamic super-resolution optical imaging tracking figures in recipient cell are as shown in Figure 3.
Embodiment 2
PBS buffer solution involved in the embodiment is pH=7.4, the PBS buffer solution of a concentration of 10mM；The recipient cell after birth being related to
Dyestuff is DiO；The unimolecule positioning super-resolution optical imaging technique being related to is PALM technologies, the hypotoxicity imaging buffer solution being related to
For DMEM culture mediums, wherein equipped with 27mM-mercaptoethanol, 1wt% glucose, the glucose oxidase of 0.1mg/mL and 8 μ
The catalase of g/mL；The tumour cell excretion body being related to is HeLa cell excretion bodies, and recipient cell is PC12 cells；It is related to
Tumour cell excretion body inside miRNA be mir-21,3 ' AGUUGUAGUCAGACUAUUCGAU 5 ' of sequence, use
Molecular beacon MB21 sequences are 5 ' Alexa Fluor 647-CTCTTTCAACATCAGTCTGATAAGCTAAAGAG-BHQ3 3 ',
Wherein Alexa Fluor 647 are fluorescent molecular, and BHQ3 is quenching group.The excretion body film dyestuff being related to is PKH26;It is related to
Excretion body extracting solution is the ExoQuick-TC Exosomes Preciptation Solution excretion body kits of SBI companies
In be furnished with secrete body extracting solution.
Step 1: extraction tumour cell excretion body
Take the 1 × 10 of 5mL6The conditioned medium of the HeLa cells of a exponential phase is centrifuged 15 minutes with 3000 × g, taken
It cleans except the cell in suspension.The ExoQuick-TC Exosomes Preciptation provided using SBI companies
Solution excretion bodies kit extracts, and 1mL excretion body extracting solutions are added in into cell suspending liquid supernatant in 4oC reactions are overnight.
Mixed solution under 10000 × g rotating speeds is centrifuged 20 minutes, precipitation is taken to be resuspended in the PBS buffer solution of 150 μ L in -75oC freezes
It deposits.
Step 2: excretion body and its inside miRNA fluorescent markers
5 μ L excretion bodies frozen stock solutions is taken to be diluted in the PBS solution of 400 μ L after dissolving, 10 μM of the MB21 of 5 μ L of addition, 37oC shakes
Bed hybridization reaction adds in 3 μM of the PKH26 solution of 0.5 μ L, the reaction was continued 10 minutes after 2 hours.By reaction solution in 50KDa
Super filter tube 6000rmp Ultrafiltration Purifyings 20 minutes remove extra molecular beacon MB21 and PKH26.Precipitation is diluted in 400 μ L's
In PBS solution, in 4oC preserves for use.
Step 3: recipient cell dyes
The DiO solution of 0.2 μ L is taken to be diluted in the PBS of 500 μ L and is used as cell membrane coloring agent.Recipient cell PC12 is cultivated 48 hours
Afterwards, extra culture solution is sucked, after gently being flushed three times with PBS, adds in the DiO that 100 μ L have diluted, jiggling makes its distribution
Uniformly.Cell ware is continued to be put into reacted 4 minutes in incubator after take out, remove extra coloring agent and add in fresh cultured
Liquid.
Step 4: tumour excretion body is co-cultured and is imaged with normal cell
The labeled excretion liquid solutions of 50 μ L are uniformly instilled into normal cell, then continue to be put into cell culture fluid by cell ware
In after its co-culture 30 minutes after take out, suck extra culture solution, after gently being flushed three times with PBS, add in 200 μ L hypotoxicities
PALM imaging buffer solution after, pass through surper resolution optical microscope（Zeiss Elyra P.1）It can be respectively to excretion body and outer
It secretes internal portion mir-21 and carries out PALM imagings.10000 frame pictures are acquired using the frame rate of 50Hz, wherein every 200 frame rebuilds one
Super-resolution picture is opened, it is final to realize that the dynamic that temporal resolution is 4s is observed.When observing excretion body, excitation wavelength 543nm, filter
Mating plate is 560-590nm bandpass filters, observes dynamic super-resolution optical imaging tracking figure of the excretion body in recipient cell
As shown in Figure 2；When observing mir-21, excitation wavelength 642nm, optical filter is 655nm long pass filters.When observing mir-21,
Excitation wavelength is 642nm, and optical filter is 655nm long pass filters, observes the mir-21 inside excretion body in recipient cell
Dynamic super-resolution optical imaging tracking figure is as shown in Figure 3.
The foregoing is merely illustrative of the preferred embodiments of the present invention, is not intended to limit the invention, all essences in the present invention
With within principle, any modification, equivalent replacement, improvement and so on should all be included in the protection scope of the present invention god.
Claims (9)
1. a kind of observe tumour cell excretion body and the method for miRNA DYNAMIC DISTRIBUTIONs in recipient cell inside excretion body, spy
Sign is, includes the following steps：
1）After extracting tumour cell excretion body, believe using excretion body film coloring agent and with the molecule of miRNA complementations inside excretion body
Mark carries out fluorescent marker to miRNA inside tumour cell excretion body film and its excretion body respectively, while uses cell membrane coloring agent
Dye recipient cell；
2）It will be through step 1）The good tumour cell excretion body of fluorescent marker and the recipient cell co-incubation dyed, make tumour thin
Extracellular body of secreting interacts with recipient cell；
3）After tumour cell excretion body interacts with recipient cell, the imaging buffering needed for unimolecule positioning imaging is added in
Liquid realizes living cells interior excretion body and its dynamic tracer of inside miRNA using surper resolution optical microscope.
2. a kind of observation tumour cell excretion body according to claim 1 is with miRNA inside excretion body in recipient cell
The method of DYNAMIC DISTRIBUTION, which is characterized in that fluorescent molecular and the cell membrane dyeing modified on excretion body film coloring agent, molecular beacon
More than 30nm is spaced between the fluorescence emission peak of agent.
3. a kind of observation tumour cell excretion body according to claim 2 is with miRNA inside excretion body in recipient cell
The method of DYNAMIC DISTRIBUTION, which is characterized in that the fluorescent molecular modified on the excretion body film coloring agent and molecular beacon is tool
There is scintillation fluor effect.
4. a kind of observation tumour cell excretion body according to claim 3 is with miRNA inside excretion body in recipient cell
The method of DYNAMIC DISTRIBUTION, which is characterized in that the excretion body film coloring agent is DiI or PKH26.
5. a kind of observation tumour cell excretion body according to claim 4 is with miRNA inside excretion body in recipient cell
The method of DYNAMIC DISTRIBUTION, which is characterized in that the fluorescent molecular modified on the molecular beacon for Alexa Fluor 647 or
Cy5。
6. a kind of observation tumour cell excretion body according to claim 2 is with miRNA inside excretion body in recipient cell
The method of DYNAMIC DISTRIBUTION, which is characterized in that the cell membrane coloring agent is PKH67 or DiO.
7. inside a kind of observation tumour cell excretion body and excretion body according to claim 1-6 any claims
The method of miRNA DYNAMIC DISTRIBUTIONs in recipient cell, which is characterized in that the specific method of extraction tumour cell excretion body is to thin
Excretion body extracting solution is added in born of the same parents' culture solution supernatant, after 3-4 DEG C is reacted 12-24h, the excretion body precipitation centrifuged is dispersed in
Excretion liquid solution is made into 100-150 μ LPBS, wherein added in excretion body extracting solution is 1 with cell culture supernatant volume ratio:
5。
8. a kind of observation tumour cell excretion body according to claim 7 is with miRNA inside excretion body in recipient cell
The method of DYNAMIC DISTRIBUTION, which is characterized in that the fluorescent marker tumour cell excretion body specifically comprises the following steps：
The first step：The molecular beacon with miRNA complementations inside excretion body is added in the excretion liquid solution extracted, is hybridized
Reaction, molecular beacon a concentration of 5-20nM in excretion liquid solution；
Second step：Excretion body film dye marker excretion body film, the dyeing of excretion body film are added in the excretion liquid solution extracted
Agent a concentration of 1-5nM in excretion liquid solution；
Third walks：Extra excretion body film dyestuff and molecular beacon probe are filtered out using super filter tube.
9. a kind of observation tumour cell excretion body according to claim 1 is with miRNA inside excretion body in recipient cell
The method of DYNAMIC DISTRIBUTION, which is characterized in that the imaging buffer solution has 27mM-mercaptoethanol, 1wt% grapes to add in
The DMEM culture mediums of the catalase of sugar, the glucose oxidase of 0.1mg/mL and 8 μ g/mL.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711429720.XA CN108192951A (en) | 2017-12-26 | 2017-12-26 | Observe tumour cell excretion body and the method for miRNA DYNAMIC DISTRIBUTIONs in recipient cell inside excretion body |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711429720.XA CN108192951A (en) | 2017-12-26 | 2017-12-26 | Observe tumour cell excretion body and the method for miRNA DYNAMIC DISTRIBUTIONs in recipient cell inside excretion body |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN108192951A true CN108192951A (en) | 2018-06-22 |
Family
ID=62584181
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201711429720.XA Pending CN108192951A (en) | 2017-12-26 | 2017-12-26 | Observe tumour cell excretion body and the method for miRNA DYNAMIC DISTRIBUTIONs in recipient cell inside excretion body |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108192951A (en) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109182362A (en) * | 2018-08-28 | 2019-01-11 | 大连理工大学 | A kind of recombinant plasmid and cell strain and its application for excretion body unimolecule positioning super-resolution imaging |
| CN109628277A (en) * | 2019-01-23 | 2019-04-16 | 东南大学 | The separation of excretion in-vivo tumour mark miRNA a kind of and detection system and method |
| CN110618002A (en) * | 2019-06-21 | 2019-12-27 | 浙江大学 | Method for labeling and tracing uterine epithelial cell source exosome by DiI dye |
| CN112807448A (en) * | 2021-01-11 | 2021-05-18 | 鱼丽娟 | Method for determining in-vivo distribution information of tumor cell-derived exosomes |
| CN113049552A (en) * | 2021-03-07 | 2021-06-29 | 天津大学 | MUC1 protein quantitative detection method based on exosome detection and single-molecule fluorescence bleaching technology |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR20150139096A (en) * | 2014-06-02 | 2015-12-11 | 인천대학교 산학협력단 | METHOD FOR DETECTING EXOSOME miRNA USING MOLECULAR BEACON |
| CN106053405A (en) * | 2016-05-10 | 2016-10-26 | 东南大学 | A super-resolution optical imaging method based on a single-molecule positioning process |
-
2017
- 2017-12-26 CN CN201711429720.XA patent/CN108192951A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR20150139096A (en) * | 2014-06-02 | 2015-12-11 | 인천대학교 산학협력단 | METHOD FOR DETECTING EXOSOME miRNA USING MOLECULAR BEACON |
| CN106053405A (en) * | 2016-05-10 | 2016-10-26 | 东南大学 | A super-resolution optical imaging method based on a single-molecule positioning process |
Non-Patent Citations (5)
| Title |
|---|
| JI HYE LEE等: "Simultaneous and multiplexed detection of exosome microRNAs using molecular beacons", 《BIOSENSORS AND BIOELECTRONICS》 * |
| 倪光烔 等: "《改变世界的物理学》", 30 April 2015, 复旦大学出版社 * |
| 刘爱平 等: "《细胞生物学荧光技术原理和应用》", 31 January 2012, 中国科学技术大学出版社 * |
| 陈智毅 等: "《分子影像学——基础与应用》", 31 January 2013, 广东高等教育出版社 * |
| 骆清铭 等: "《生物分子光子学研究前沿》", 31 October 2014, 上海交通大学出版社 * |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109182362A (en) * | 2018-08-28 | 2019-01-11 | 大连理工大学 | A kind of recombinant plasmid and cell strain and its application for excretion body unimolecule positioning super-resolution imaging |
| CN109628277A (en) * | 2019-01-23 | 2019-04-16 | 东南大学 | The separation of excretion in-vivo tumour mark miRNA a kind of and detection system and method |
| CN109628277B (en) * | 2019-01-23 | 2022-02-01 | 东南大学 | System and method for separating and detecting tumor marker miRNA in exosome |
| CN110618002A (en) * | 2019-06-21 | 2019-12-27 | 浙江大学 | Method for labeling and tracing uterine epithelial cell source exosome by DiI dye |
| CN112807448A (en) * | 2021-01-11 | 2021-05-18 | 鱼丽娟 | Method for determining in-vivo distribution information of tumor cell-derived exosomes |
| CN113049552A (en) * | 2021-03-07 | 2021-06-29 | 天津大学 | MUC1 protein quantitative detection method based on exosome detection and single-molecule fluorescence bleaching technology |
| CN113049552B (en) * | 2021-03-07 | 2022-08-05 | 天津大学 | MUC1 protein quantitative detection method based on exosome detection and single-molecule fluorescence bleaching technology |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108192951A (en) | Observe tumour cell excretion body and the method for miRNA DYNAMIC DISTRIBUTIONs in recipient cell inside excretion body | |
| CN106053405B (en) | A kind of super-resolution optical imaging method based on unimolecule positioning mode | |
| CN105026562B (en) | Gene quantification, sequence analysis two-dimentional cellular array device and device | |
| CN106587005B (en) | A kind of step carbonation high-quantum efficiency carbon quantum dot and preparation method thereof | |
| CN110079585A (en) | Gene expression analytic method, gene expression parsing equipment and gene expression resolver | |
| CN107601455B (en) | Preparation method of long-time targeted imaging RNA fluorescent carbon dots in living cells, product and application thereof | |
| CN108558967B (en) | Cell membrane imaging fluorescent probe and application thereof | |
| Xu et al. | High purity microfluidic sorting and in situ inactivation of circulating tumor cells based on multifunctional magnetic composites | |
| CN109021971B (en) | Fluorescent carbon dot for cell nucleus staining and application and method thereof in cell nucleus imaging | |
| Gluska et al. | Tracking Quantum-Dot labeled neurotropic factors transport along primary neuronal axons in compartmental microfluidic chambers | |
| Zurgil et al. | Polymer live-cell array for real-time kinetic imaging of immune cells | |
| Afrimzon et al. | Hydrogel microstructure live-cell array for multiplexed analyses of cancer stem cells, tumor heterogeneity and differential drug response at single-element resolution | |
| CN103221539A (en) | Protein or peptide printing method, protein or peptide array and functional protein or functional peptide identification method | |
| CN103014117B (en) | Nanogold-polypeptide biological probe and preparation and application method | |
| CN110205125A (en) | Graphene quantum dot fluorescence probe material and preparation method thereof with cell nucleus targeting imaging | |
| JP2003066035A (en) | Water-soluble tissue clear solution | |
| Yoshino et al. | Nano-scale imaging of chromosomes and DNA by scanning near-field optical/atomic force microscopy | |
| CN103087706B (en) | Single/double-photon acidic cell organelle fluorescent probe and application thereof | |
| CN100501402C (en) | Method of stably labelling liver cancer cell | |
| CN104931467B (en) | A kind of fluorescence imaging method of intracellular ATP | |
| Okkelman et al. | Affordable oxygen microscopy-assisted biofabrication of multicellular spheroids | |
| O’Donnell et al. | Three-dimensional tissue models and available probes for multi-parametric live cell microscopy: a brief overview | |
| CN110499279A (en) | A method of induce human urine derived stem cells to hepatocyte differentiation | |
| CN109096384B (en) | Green fluorescent protein-based nanoparticles, preparation method and application thereof in cell imaging and nuclear nucleolus staining | |
| Mammadov et al. | Extracellular matrix mimetic peptide scaffolds for neural stem cell culture and differentiation |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20180622 |
|
| RJ01 | Rejection of invention patent application after publication |