CN108165644A - The primer and preparation method and kit of quick detection bartonella henselae - Google Patents
The primer and preparation method and kit of quick detection bartonella henselae Download PDFInfo
- Publication number
- CN108165644A CN108165644A CN201810044923.5A CN201810044923A CN108165644A CN 108165644 A CN108165644 A CN 108165644A CN 201810044923 A CN201810044923 A CN 201810044923A CN 108165644 A CN108165644 A CN 108165644A
- Authority
- CN
- China
- Prior art keywords
- rpa
- primer
- detection
- lfa
- primers
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6806—Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/569—Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
- G01N33/56911—Bacteria
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Biotechnology (AREA)
- General Health & Medical Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Genetics & Genomics (AREA)
- General Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Biomedical Technology (AREA)
- Hematology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Urology & Nephrology (AREA)
- General Physics & Mathematics (AREA)
- Virology (AREA)
- Tropical Medicine & Parasitology (AREA)
- Food Science & Technology (AREA)
- Pathology (AREA)
- Cell Biology (AREA)
- Medicinal Chemistry (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of the present invention relates to a kind of foundation of bartonella henselae genomic DNA visual rapid detection method, category biotechnology filters out 1 pair of RPA primer that specificity is high, sensibility is strong, i.e. sense primer<210>2 and sense primer<210>2, establish the RPA detection architectures of detection Bh genomic DNAs.Compared with conventional PCR method, RPA LFA have many advantages, such as the visualization (can directly detect by an unaided eye testing result) of low to instrument and equipment requirement (only needing a thermostat water bath), detection speed fast (about 40min), testing result, these advantages cause the RPA LFA methods that the present invention establishes to can be used for the quick detect and diagnose of pet clinic cat Bh infection.
Description
Technical field
The present invention relates to a kind of foundation of bartonella henselae genomic DNA visual rapid detection method, belong to biological skill
Art field.
Background technology
Bartonellosis (Bartonellosis) is one as caused by not of the same race and subspecies Bartonella (Bartonella)
The universal important Arbo infectious disease of class is in recent years in one of China's emerging infectious disease.Cat scratch disease (Cat-
Scratch disease, CSD) it is one kind in bartonellosis (Bartonellosis), mainly by bartonella henselae
Amphixenosis is newly sent out caused by (Bartonella henselae, Bh).Cat is the natural host of the cause of disease, when cat infects Bh
After can keep bacteremia for a long time, but do not occur apparent clinical symptoms, and can be infected by directly scratching or biting
To people, it can also be bitten by cat flea and be propagated indirectly.The disease is in the U.S., Germany, France, Holland, Switzerland, Italy, Australia
The states such as big Leah, Japan exist, and are mainly in Children and teenager.It in recent years, should with the increase of China's pet cat number of animals raised
Disease reports that the case of population infection Bh is in quick in China Jiangsu, Zhejiang, Anhui, Shandong and Shanghai Deng20Yu Ge provinces and cities
The trend of rising.
Bartonella (Bartonella) is a kind of tiny spherical, rod-shaped or cricoid pleomorphism microorganism, gram dye
Color is negative, Ji's nurse Sa stained in purple or blue, and Maechiavell dyeing takes on a red color, atrichia.In classification, Bartonella
Belong to deformation Gammaproteobacteria, Rhizobiales order, Bartonellaceae, Bartonella member, it has now been found that 22 kinds and subspecies, wherein
At least nine kinds of have people pathogenic, mainly includes:Bacillus sample Bartonella (Bartonella bacilliform), quintan bar
You are entire body (Bartonella quintana), bartonella henselae (Bartonella henselae), Elizabethan Ba Ertong
Body (Bartonella elizabethae), Wen's Bartonella A Shi subspecies (Bartonella vinsonii
Arupensis), Wen's Bartonella Ge Huofu subspecies (Bartonella vinsonii subsp.Berkhoffii), kirschner
Bartonella (Bartonella clarridgeiae), Gray's model nurse Bartonella (Bartonella grahamii) and Wen
9 kinds of Bartonella Vincent subspecies (Bartonella vinsonii subsp.vinsonii) etc..
Cat is the important infection sources that the natural reservoir (of bird flu viruses) of Bh and people infect Bh, therefore the infection of prevention and control crowd Bh is badly in need of wanting
Strengthen the detection infected pet cat Bh.
At present, the common test in laboratory method of Bh infection includes pathogeny detection, Serologic detection and molecular biology
Detection.Very harsh to nutritional requirement due to the particularity of the cause of disease, the time for being separately cultured Bh for the first time is longer, therefore cause of disease
It is relatively difficult to learn detection.
Indirect immunofluorescene assay method (IFA) is to detect the common serological methods of Bh, the detection currently used for Bh infection
Technology has formed commercial kit, but there are still problems in practical applications for IFA diagnostic methods：First, IFA detections need
Want expensive fluorescence microscope；Secondly, the testing result of this method fully relies on artificial interpretation, easy examined technical staff
The influence of experience.
PCR, since its is quick, special and sensitive, has been widely used in Bh as the common method of molecular Biological Detection
The detection of genomic DNA.The PCR detection target genes for being presently used for Bh infection include 16S rRNA, citron synthase genes
(gltA), groEL and pap31 genes etc..However, PCR method is there is also certain shortcoming, if desired for special instrument and equipment
And technology, it limits this method and clinically applies on a large scale.
Recombinase polymeric enzymatic amplification (Recombinase polymerase amplification, RPA) be 2006 by
A kind of nucleic acid constant-temperature amplification technology of TwistDx Inc companies of Britain research and development, the technology can be fast under 25-42 DEG C of constant temperature
Speed completes the amplification of nucleic acid DNA, and amplified production can in real time be monitored by sonde method.RPA effect principle be
During target DNA fragment expands, primer forms compound with recombinase, and is combined with DNA, and primer is found along DNA chain
Homologous sequence, when complete position after, occur Exchange reaction of chain and open 2 single-stranded of DNA hydrogen bond, single-stranded binding albumen
(SSB) it with single stranded DNA chain combination, prevents to form double-strand；Polymerase repetition DNA since the position that Exchange reaction of chain occurs, from
And complete the amplification to target DNA fragment.Compared with Standard PCR, RPA technologies not only have sensibility height, high specificity, behaviour
Work is easy, the reaction time is short, is not required to the advantages that complex instrument equipment, and can be with Sidestream chromatography detection technique (Lateral
Flow assay, LFA) it is combined, it can not only realize and the external constant temperature of DNA or RNA is quickly detected, and can realize detection knot
The visualization of fruit is with a wide range of applications on pathogeny detection field.
The present invention establishes Bh genes by using recombinase polymeric enzymatic amplification-Sidestream chromatography (RPA-LFA) detection technique
The visual rapid detection method of group DNA.The present invention first by the Bh different strains gltA genes to being logged in GenBank into
Row sequence alignment filters out highly conserved genetic fragment as target fragment；3 couples of RPA are devised according to RPA design of primers principles
Specific primer, with digoxigenin labeled sense primer 5' ends, with biotin labeling downstream primer 5' ends, by Bh genomes
DNA carries out RPA amplification experiments, therefrom filters out 1 pair of RPA primer that specificity is high, sensibility is strong, establishes detection Bh genomes
The RPA detection methods of DNA.On this basis, the rabbit-anti DigiTAb compound of colloid gold label is layered on bonding pad, NC
Detection line is coated with Streptavidin on film, and goat anti-rabbit igg is coated on nature controlling line, and cooperation sample-adding pad and absorption pad are assembled into LFA examinations
Paper slip.RPA products are added dropwise in the RPA-LFA visualization inspections on LFA test strips sample-adding pad, establishing detection Bh genomic DNAs
Survey method.Using establish RPA-LFA detection methods respectively to eperythrozoon, bacillus sample Bartonella, quintan Bartonella,
It looks into the various pathogens such as luxuriant and rich with fragrance Eric's body, Escherichia coli, salmonella to be expanded, it was demonstrated that the Bh RPA-LFA established are visual
Changing detection method has very high specificity.It is compared by the detection to clinical sample, and with Standard PCR method, it was demonstrated that
RPA-LFA methods have hypersensitivity, specificity and accuracy, and the diagnosis for pet cat Bh infection provides a quick, letter
Just, accurate visible detection method.
Invention content
The object of the present invention is to provide the kits that a kind of primer of quick detection bartonella henselae and the primer are formed.
Bh senses are established by using recombinase polymeric enzymatic amplification-immune Sidestream chromatography detection technique (RPA-LFA) technology
The visual rapid detection method of dye passes through the detection to clinical sample, it was demonstrated that the Bh RPA-LFA Visual retrieval sides of foundation
Method has very high specificity and sensibility, and the diagnosis for pet cat Bh infection provides a quick, easy, accurate clinic
Detection method.
The present invention establishes Bh genes by using recombinase polymeric enzymatic amplification-Sidestream chromatography (RPA-LFA) detection technique
The visual rapid detection method of group DNA.The present invention first by the Bh different strains gltA genes to being logged in GenBank into
Row sequence alignment filters out highly conserved genetic fragment as target fragment；It is several right to be designed according to RPA design of primers principle
RPA specific primers, with digoxigenin labeled sense primer 5' ends, with biotin labeling downstream primer 5' ends, by Bh genes
Group DNA carries out RPA amplification experiments, therefrom filters out the gene of 1 pair of RPA primer, i.e. sense primer that specificity is high, sensibility is strong
Sequence is<210>2, the gene order of sense primer is<210>2, establish the RPA detection architectures of detection Bh genomic DNAs.
On this basis, the rabbit-anti DigiTAb compound of colloid gold label is layered on bonding pad, is detected on NC films
Line is coated with Streptavidin, and goat anti-rabbit igg is coated on nature controlling line, and cooperation sample-adding pad and absorption pad are assembled into LFA test strips.It will
RPA products are added dropwise on LFA test strips sample-adding pad, establish the RPA-LFA Visual retrieval systems of detection Bh genomic DNAs.
Using establishing RPA-LFA detection methods respectively to eperythrozoon, bacillus sample Bartonella, quintan Ba Ertong
Body is looked into the various pathogens such as luxuriant and rich with fragrance Eric's body, Escherichia coli, salmonella and is expanded, it was demonstrated that the Bh RPA-LFA established
Visible detection method has very high specificity.It is compared, demonstrate,proves by the detection to clinical sample, and with Standard PCR method
Real RPA-LFA methods have hypersensitivity, specificity and accuracy, for pet cat Bh infection diagnosis provide one quickly,
Easy, accurate visible detection method.
Recombinase polymeric enzymatic amplification (RPA) and immune Sidestream chromatography detection technique (LFA) technology are combined by the present invention, are built
The method for visualizing of quick detection Bh infection is found.First by recombinase polymeric enzymatic amplification technology (RPA) to Bh genomic DNAs
It is expanded, due to the sense primer 5' ends digoxigenin labeled of RPA, downstream primer 5' ends biotin labeling, therefore works as RPA
When amplification is positive, RPA products can be combined with the rabbit-anti DigiTAb IgG of colloid gold label, continue after diffusion and with
Coated Avidin combines in detection line, therefore will appear the colloid gold bar of specificity in the detection line (T lines) of NC films
Band；With the migration of colloid gold label rabbit-anti DigiTAb IgG, can be combined with goat anti-rabbit igg coated on nature controlling line, in matter
Control line (C lines) also will appear band.When RPA amplifications are negative, sense primer can be resisted by the anti-digoxin of colloid gold label
Body is absorbed, although downstream primer can be combined with Avidin, without carrying colloid gold particle, therefore in the detection of NC films
Do not occur the band of specificity on line (T lines)；Moving with the rabbit-anti DigiTAb IgG compounds of colloid gold label simultaneously
It moves, can be combined with goat anti-rabbit igg, therefore will appear band on nature controlling line (C lines).
The invention mainly relates to the contents of the following aspects：
1st, the extraction of Bh genomic DNAs
2nd, the design and synthesis of Bh RPA primers
3rd, the preparation of RPA reaction systems and operating procedure
4th, the screening of Bh RPA primers
5th, the foundation of Bh RPA-LFA and operating procedure
6th, Bh RPA-LFA detection methods result judgement
7th, the specific test of Bh RPA-LFA detection methods
8th, the sensitivity tests of Bh RPA-LFA detection methods
9th, the contrast test that Bh RPA-LFA detect clinical sample with conventional PCR method
Detailed process is as follows.
The preparation of 1.Bh genomic DNAs.
Taking Bh exponential phase culture 30mL, 6000r/min centrifugation 15min collect thalline, abandon in 50mL centrifuge tubes
Clearly, after thalline is suspended with TE buffer solutions, genomic DNA is extracted with bacterial genomes DNA extraction kit, measures extraction DNA's
Concentration and purity (A260/A280), for use.
The design and synthesis of 2.Bh RPA primers.
The Bh difference separation strains gltA genes that GenBank is announced are downloaded, by Blast N and DNAMAN softwares to Bh
GltA genes carry out sequence alignment, screen target sequence of the highly conserved sequence as amplification.With reference to the basic of RPA design of primers
Principle, it is several to specific primer using 5.0 Software for Design of Primer, high specific and quick has been provided by experiment sieving
The detection RPA primers of perception.
The preparation of 3.RPA reaction systems and operation sequence.
50 μ L RPA reaction systems are prepared, including RPA-FP and RPA-RP (concentration is 10 μM) each 2.5 μ L,
29.5 μ L, dd H of Rehydration Buffer22.5 μ L of 12.0 μ L of O, 1 μ L, 280mM MgAc of template.By template and MgAc
Except all reagents premix after, be transferred in the 0.2mL PCR reaction tubes of pre- addition exo freeze-drying enzyme preparations, and abundant mixing.It will
1 μ L templates are added in reaction tube, and 2.5 μ L MgAc are added in reaction lid, after covering tightly rear brief centrifugation and being vortexed, are put into
RPA reactions are carried out in 40 DEG C of water-baths.
The optimization of 4.RPA reaction conditions.
4.1. optimum reacting time is determining.
In order to determine RPA optimum reacting times, if 50 μ L RPA reaction systems of main pipe are prepared, using Bh genomic DNAs mould
Plate carries out the RPA amplifications of different time, RPA optimum reacting times is determined according to product amount respectively.
4.2. optimal reaction temperature is determining.
In order to determine RPA optimal reaction temperatures, with 50 μ L RPA reaction systems of tubulation, several water at different temperatures of difference
Amplified reaction is carried out in bath cabinet, a certain amount of amplification liquid is taken from each pipe respectively, RPA optimum response temperature is determined according to product amount
Degree.
4.3.RPA the screening of best primer.
In order to filter out the best primers of RPA, using Bh genomic DNAs template, Bh RPA primers are carried out with several respectively
RPA is expanded, and then carries out 2% agarose gel electrophoresis with to amplified production, is filtered out according to specificity, sensibility and product amount
The best primers of RPA.
5. visualize the foundation of RPA-LFA detection architectures.
5.1. the preparation of colloid gold labeling antibody.
Trisodium citrate reduction method is used to prepare colloidal gold solution of the average particle diameter for 40nm.Draw 1mL colloidal golds
Solution is added in test tube, adds in 5 μ g rabbit-anti DigiTAb IgG, Slow Isothermal oscillation 30min thereto.4℃、13000r/
Min centrifuge 40min, discard supernatant liquid, be precipitated and dissolved in the Tris-HCL buffer solutions of 0.1moL/L (pH=8.0) to get
To the rabbit-anti DigiTAb IgG of colloid gold label, 4 DEG C of the solution prepared is sealed, it is spare.
5.2.RPA-LFA the preparation of kit.
RPA-LFA kits are divided into 5 parts：It is loaded pad, bonding pad, absorption pad, NC films (nitrocellulose filter) [detection
Line (T lines) and nature controlling line (C lines)] and PVC plastic backing strap.
The colloid gold label rabbit-anti DigiTAb IgG of preparation with liquid-transfering gun is dropped evenly and is sprayed onto on NC films, is placed on true
37 DEG C of dry 10min in empty drying box take out, as bonding pad.
On NC films, coating is diluted to 2mg/mL through PBS (0.01moL/L, pH=7.4) buffer solution in detection line (T lines)
Streptavidin (Streptavidin), the goat anti-rabbit igg of 2mg/mL is coated on nature controlling line (C lines), is dried at room temperature
30min.The sequence of assembling is followed successively by：NC films are first sticked in the intermediate region of PVC plastic backing strap, bonding pad is attached to the front area of NC films
Domain, to ensure good contact, bonding pad pressure NC film 2mm, then sample pad is sticked in front of bonding pad, sample pad pressure bonding pad
Water absorption pad is finally attached to the rear of NC films, water absorption pad pressure NC films 2mm by 2mm.Test paper plate is segmented into the test strips of 4mm earnestly.It will
The test strips prepared are placed in the tin case bag for being placed with drier, and 4 DEG C save backup.
5.3.RPA-LFA detection method operating procedure and result judgement.
After RPA is expanded, 5 μ L RPA products are taken with micropipettor, are diluted to 80 μ L, be added dropwise and tried in RPA-LFA
On paper slip sample-adding pad, the device that sample-adding finishes is put into 37 DEG C of water baths, is incubated 10min.RPA-LFA test strips are taken out, are used
It visually observes, if nature controlling line (C lines) and detection line (T lines) develop the color, testing result is judged to positive (Fig. 2)；If only nature controlling line
Colour developing, then testing result is judged to feminine gender；If nature controlling line does not develop the color, testing result is judged in vain.
6.Bh RPA-LFA detection methods obtain specific test.
Respectively by staphylococcus aureus, Escherichia coli, withered apple bacillus, streptococcus uberis, salmonella, bacillus sample
The culture of the cause of diseases such as Bartonella, quintan Bartonella, bartonella henselae, 6000r/min centrifugation 15min, collects bacterium
Body abandons supernatant, after thalline is suspended with TE buffer solutions, extracts genomic DNA with bacterial genomes DNA extraction kit, presses respectively
RPA amplifications are carried out according to RPA operations step, are then detected test strips prepared by RPA products, each bacterial gene
Group DNA sample repeats detection 3 times, analyzes the specificity of RPA-LFA detection methods.Testing result confirmation, only Bh genomic DNAs
Sample RPA-LFA detection methods for the positive, other pathogenic genes group DNA sample RPA-LFA testing results are feminine gender, show with
Other pathogenic genes groups DNA does not have cross reaction, it was demonstrated that the RPA-LFA detection methods established have good specificity.
The sensitivity tests of 7.Bh RPA-LFA detection methods.
The Bh genome DNA samples of extraction are diluted to 100ng/ μ L, the dilution of 10 times of gradients is then carried out, prepares altogether
100th, 10,1,0.1, diluted concentration different 0.01ng/ μ L, then carries out RPA amplifications using it as template, is carried out after amplification
RPA-LFA is detected.Testing result shows, when Bh genomic DNAs diluted concentration is 10ng/ μ L, all to can detect that clear colloid
Golden positive band, the results showed that the sensitivity of the detection method can reach 10ng/ μ L, it was demonstrated that the RPA-LFA detection methods have
The sensibility of height.
The contrast test that 8.RPA-LFA detects clinical sample with Standard PCR detection method.
After 106 parts of vagrant cat blood clinical samples extract genomic DNA with bacterial genomes DNA extraction kit respectively,
Above-mentioned sample is detected with conventional PCR method with the RPA-LFA visible detection methods established respectively, counts two kinds of detections
The testing result of method.Sensibility, specificity and the symbol of RPA-LFA method for visualizing and conventional PCR method are calculated according to formula
Conjunction rate.The RPA-LFA and Standard PCR detection method of 106 parts of vagrant cat blood clinical samples the results are shown in Table 2.Through statistical analysis,
The sensibility and specificity of RPA-LFA methods is respectively 100% and 98.94%, and the coincidence rate with Standard PCR detection method is
99.06%, it was demonstrated that the RPA-LFA detection methods of foundation are a kind of Bh nucleic acid visualization inspections for having specificity height strong with sensibility
Survey method.
The invention has the advantages that：The present invention provides a kind of new visualizations for being used to detect Bh genomic DNAs
RPA-LFA detection methods.Compared with conventional PCR method, RPA-LFA has to low (only one constant temperature of needs of instrument and equipment requirement
Water-bath), detection speed fast (about 40min), the visualization (can directly detect by an unaided eye testing result) etc. of testing result it is excellent
Point, these advantages cause the RPA-LFA methods that the present invention establishes to can be used for the quick of pet clinic cat Bh infection and detect and examine
It is disconnected.
Description of the drawings
Fig. 1 is the assembling schematic diagram of Bh RPA-LFA kit test strips
Fig. 2 is RPA-LFA to Bh genomic DNA testing results
In Fig. 2：1：Using bacillus sample Bartonella genomic DNA as the RPA-LFA negative results of template；2,3：With Bh
Genomic DNA is the RPA-LFA positive test symbols of template；
Fig. 3 is table 1, for the Bh RPA-LFA specific primers used in the present invention
Fig. 4 is.Table 2RPA-LFA is with conventional PCR method to the detection contrast test of Bh
Specific embodiment
1st, the preparation of Bh genomic DNAs
Taking Bh exponential phase culture 30mL, 6000r/min centrifugation 15min collect thalline, abandon in 50mL centrifuge tubes
Clearly, after thalline is suspended with TE buffer solutions, genomic DNA is extracted with bacterial genomes DNA extraction kit, measures extraction DNA's
Concentration and purity (A260/A280), for use.
2nd, the design and synthesis of Bh RPA primers
The Bh difference separation strains gltA genes that GenBank is announced are downloaded, by Blast N and DNAMAN softwares to Bh
GltA genes carry out sequence alignment, screen target sequence of the highly conserved sequence as amplification.With reference to the basic of RPA design of primers
Principle, using 5.0 Software for Design of Primer, 3 pairs of specific primers (table 1), by experiment sieving provided high specific and
The detection RPA primers of sensibility.The RPA primer amplification target fragment sizes of design are about 220bp.Meanwhile synthesize Standard PCR side
The specific primer that method uses.Primer and sequence are shown in Table 1.
3rd, the preparation of RPA reaction systems and operation sequence
50 μ L RPA reaction systems are prepared, including RPA-FP and RPA-RP (concentration is 10 μM) each 2.5 μ L,
29.5 μ L, dd H of Rehydration Buffer22.5 μ L of 12.0 μ L of O, 1 μ L, 280mM MgAc of template.By template and MgAc
Except all reagents premix after, be transferred in the 0.2mL PCR reaction tubes of pre- addition exo freeze-drying enzyme preparations, and abundant mixing.It will
1 μ L templates are added in reaction tube, and 2.5 μ L MgAc are added in reaction lid, after covering tightly rear brief centrifugation and being vortexed, are put into
RPA reactions are carried out in 40 DEG C of water-baths.
4th, the optimization of RPA reaction conditions
4.1 optimum reacting times determine
In order to determine RPA optimum reacting times, 7 pipe, 50 μ L RPA reaction systems are prepared, using Bh genomic DNAs template,
The RPA amplifications of 10min, 15min, 20min, 25min, 30min, 35min, 40min are carried out respectively, are determined according to product amount
RPA optimum reacting times.As a result, it has been found that when the RPA reaction time is 20min at 40 DEG C, you can amplification obtains a size and is
The specific band of 220bp；When RPA reacts 30min, 3 times of band when obtained amplified production amount is about 20min, and it is anti-
RPA product amounts do not dramatically increase when answering 40min.Therefore Bh RPA optimum reacting times are determined as 30min.
4.2 optimal reaction temperatures determine
In order to determine RPA optimal reaction temperatures, prepare 5 pipe, 50 μ L RPA reaction systems, be respectively put into 25 DEG C, 30 DEG C, 35
DEG C, carry out amplified reaction in 40 DEG C and 45 DEG C of water baths, 10 μ L is taken to expand liquid after 15min from each pipe respectively, according to product amount
To determine RPA optimal reaction temperatures.As a result, it has been found that RPA can be carried out effectively within the temperature range of 25~45 DEG C, wherein 40 DEG C
When expanding effect it is best, RPA product amounts are maximum, therefore RPA optimal reaction temperatures are determined as 40 DEG C.
The screening of the best primers of 4.3RPA
In order to filter out the best primers of RPA, using Bh genomic DNAs template, respectively with 3 couples of Bh RPA primers (RPA
FP1-RP1, RPA FP2-RP2, RPA FP3-RP3) RPA amplifications are carried out, then 2% Ago-Gel is carried out with to amplified production
Electrophoresis filters out the best primers of RPA according to specificity, sensibility and product amount.As a result 3 pairs of primers can amplify target gene
Segment, but the specificity of RPA FP3-RP3 primer pairs, sensibility and product amount highest, therefore RPA FP3-RP3 primer pairs determine
For the best primers of Bh RPA (table 1).
5th, the foundation of RPA-LFA detection methods is visualized
The preparation of 5.1 colloid gold labeling antibodies
Trisodium citrate reduction method is used to prepare colloidal gold solution of the average particle diameter for 40nm.Draw 1mL colloidal golds
Solution is added in test tube, adds in 5 μ g rabbit-anti DigiTAb IgG, Slow Isothermal oscillation 30min thereto.4℃、13000r/
Min centrifuge 40min, discard supernatant liquid, be precipitated and dissolved in the Tris-HCL buffer solutions of 0.1moL/L (pH=8.0) to get
To the rabbit-anti DigiTAb IgG of colloid gold label, 4 DEG C of the solution prepared is sealed, it is spare.
The preparation method of 5.2RPA-LFA test strips
RPA-LFA test strips structures are divided into 5 parts：It is loaded pad, bonding pad, absorption pad, nitrocellulose filter (NC films)
[detection line (T lines) and nature controlling line (C lines)] and PVC plastic backing strap (Fig. 1).By the colloid gold label rabbit-anti DigiTAb of preparation
IgG is dropped evenly with liquid-transfering gun to be sprayed onto on NC films, is placed on 37 DEG C of dry 10min in vacuum drying chamber, is taken out, as bonding pad
(gold-labelled pad).On NC films, coating is diluted to 2mg/mL through PBS (0.01moL/L, pH=7.4) buffer solution in detection line (T lines)
Streptavidin (Streptavidin), the goat anti-rabbit igg of 2mg/mL is coated on nature controlling line (C lines), is dried at room temperature
30min.The sequence of assembling is followed successively by：NC films are first sticked in the intermediate region of PVC plastic backing strap, bonding pad is attached to the front area of NC films
Domain, to ensure good contact, bonding pad pressure NC film 2mm, then sample pad is sticked in front of bonding pad, sample pad pressure bonding pad
Water absorption pad is finally attached to the rear of NC films, water absorption pad pressure NC films 2mm by 2mm.Test paper plate is segmented into the test strips of 4mm earnestly.It will
The test strips prepared are placed in the tin case bag for being placed with drier, and 4 DEG C save backup.
5.3RPA-LFA detection methods operating procedure and result judgement
After RPA is expanded, 5 μ L RPA products are taken with micropipettor, are diluted to 80 μ L, be added dropwise and tried in RPA-LFA
On paper slip sample-adding pad, the device that sample-adding finishes is put into 37 DEG C of water baths, is incubated 10min.RPA-LFA test strips are taken out, are used
It visually observes, if nature controlling line (C lines) and detection line (T lines) develop the color, testing result is judged to positive (Fig. 2)；If only nature controlling line
Colour developing, then testing result is judged to feminine gender；If nature controlling line does not develop the color, testing result is judged in vain.
6th, Bh RPA-LFA detection methods obtain specific test
Respectively by staphylococcus aureus, Escherichia coli, withered apple bacillus, streptococcus uberis, salmonella, bacillus sample
The culture of the cause of diseases such as Bartonella, quintan Bartonella, bartonella henselae, 6000r/min centrifugation 15min, collects bacterium
Body abandons supernatant, after thalline is suspended with TE buffer solutions, extracts genomic DNA with bacterial genomes DNA extraction kit, presses respectively
RPA amplifications are carried out according to RPA operations step, are then detected test strips prepared by RPA products, each bacterial gene
Group DNA sample repeats detection 3 times, analyzes the specificity of RPA-LFA detection methods.Testing result confirmation, only Bh genomic DNAs
Sample RPA-LFA detection methods for the positive, other pathogenic genes group DNA sample RPA-LFA testing results are feminine gender, show with
Other pathogenic genes groups DNA does not have cross reaction, it was demonstrated that the RPA-LFA detection methods established have good specificity.
7th, the sensitivity tests of Bh RPA-LFA detection methods
The Bh genome DNA samples of extraction are diluted to 100ng/ μ L, the dilution of 10 times of gradients is then carried out, prepares altogether
100th, 10,1,0.1, diluted concentration different 0.01ng/ μ L, then carries out RPA amplifications using it as template, is carried out after amplification
RPA-LFA is detected.Testing result shows, when Bh genomic DNAs diluted concentration is 10ng/ μ L, all to can detect that clear colloid
Golden positive band, the results showed that the sensitivity of the detection method can reach 10ng/ μ L, it was demonstrated that the RPA-LFA detection methods have
The sensibility of height.
8th, the contrast test that RPA-LFA and Standard PCR detection method detect clinical sample
After 106 parts of vagrant cat blood clinical samples extract genomic DNA with bacterial genomes DNA extraction kit respectively,
Above-mentioned sample is detected with conventional PCR method with the RPA-LFA visible detection methods established respectively, counts two kinds of detections
The testing result of method.Sensibility, specificity and the symbol of RPA-LFA method for visualizing and conventional PCR method are calculated according to formula
Conjunction rate.The RPA-LFA and Standard PCR detection method of 106 parts of vagrant cat blood clinical samples the results are shown in Table 2.Through statistical analysis,
The sensibility and specificity of RPA-LFA methods is respectively 100% and 98.94%, and the coincidence rate with Standard PCR detection method is
99.06%, it was demonstrated that the RPA-LFA detection methods of foundation are a kind of Bh nucleic acid visualization inspections for having specificity height strong with sensibility
Survey method.
It the above is only the preferred embodiment of the present invention, it is noted that above-mentioned preferred embodiment is not construed as pair
The limitation of the present invention, protection scope of the present invention should be subject to claim limited range.For the art
For those of ordinary skill, without departing from the spirit and scope of the present invention, can also make several improvements and modifications should also regard
For protection scope of the present invention.
<110>Shihezi Univ
<120>The primer and preparation method and kit of quick detection bartonella henselae
<141>
<160> 3
<210> 1
<211> 1306
<212> DNA
<213>Bartonella henselae（Bartonella henselae）
<220>
<221> misc_feature
<223> gltA gene
<400> 1
ATGTCTAAGAATAAAGCGCACATTACTGTGAATGATAAAAAAATAGAACTCTCCGTGCGTAAAGGTACACTTG
GTCCTGACGTTATTGAAATTGCTTCTCTCTACAAAGAAACAGATACTTTTACTTATGATCCTGGCTTTACCTCAACT
GCTTCGTGTGAATCGAAAATCACTTATATTGATGGTAATGAAGGAATTTTGCTTTATCGTGGTTATCCTATTGACCA
ATTGGCTGAAAAAGGAGACTTTCTCGAAAGCTGCTATCTTTTGCTTTACGGTGAACTGCCAACAAAACAAGAAAAAA
TTGATTTTGATCGCTGTATTATGCAGCATACGATGGTTCACGAACAGTTTGCAAGATTTTTCCATGGTTTCCGTCGC
GACTCTCATCCTATGGCCGTCATGATTGCATGTCTTGGAGCTATGTCTGCATTCTATCACGACTCTATTGATATTAC
AGATCCTCAACAGAGAATGATCGCTTCTATTCGTCTCATTTCAAAGGTCCCAACTCTTGCCGCTATGGCCTATAAAT
ATAGCATTGGACAAGCATTTGTTTATCCACGTAATGATCTTAGTTACGCTGCAAATTTTCTCCGTATGTGTTTTTCT
GTTCCTTGTGAAGAATATAAAATTAATCCGGTGCTGACTCGAGCTATGGATAGAATCTTTACTCTTCATGCAGATCA
TGAACAAAATGCTTCGACATCCACTGTACGTCTTGCAGGTTCATCAGGTGCTAATCCATTTGCATGTATTGCAGCAG
GTGTTGCATGCCTTTGGGGACCAGCTCATGGTGGAGCTAATGAAGCATGCCTAAAAATGTTACAAGAAATAGGTTCT
GTTGAAAGAATTCCTGAATTCATTGCACGTGCAAAAGATAAAAATGATTCTTTCCGCCTTATGGGTTTTGGTCATCG
AGTCTATAAAAATTATGATCCACGCGCAAAAATCATGCAACAAACCTGCCATGAGGTTTTAAAAGAATTGAACATTC
AAAATGATCCACTTCTTGATATTGCTATCACGCTTGAAAATATTGCTCTAAATGATGAATATTTTATTGAAAAAAAA
CTTTACCCTAATGTCGATTTCTATTCTGGCATTACATTAAAAGCTCTAGGATTTCCAACAGAAATGTTTACTGTTCT
TTTTGCATTAGCACGCAGTGTCGGCTGGGTTGCGCAATGGAAAGAAATGATTGAGGATCCTGCACAAAAAATTAGCC
GACCACGCCAACTCTACACAGGCTACGCTGCGCGTGAATATATCCCTATAGACAAGCGTGTAAACTAAAAATAAAGT
A
<210> 2
<211> 35
<212> DNA
<213>Bartonella henselae（Bartonella henselae）
<220>
<221> misc_feature
<223>RAP FP3 primers
<400> 1
5’-GTATTGCAGCAGGTGTTGCATGCCTTTGGGGACCA-3’
<210> 3
<211> 35
<212>Nucleotide sequence
<213>Bartonella henselae（Bartonella henselae）
<220>
<221> misc_feature
<223>RAP RP3 primers
<400> 1
5’-ATGGCAGGTTTGTTGCATGATTTTTGCGCGTGGAT-3’
Claims (6)
1. a kind of primer of quick detection bartonella henselae, which is characterized in that the gene order of its sense primer is<210>2,
The gene order of downstream primer is<210>3.
2. the primer of quick detection bartonella henselae according to claim 1, which is characterized in that
Mainly prepare through the following steps：
The preparation of Bh genomic DNAs takes Bh exponential phases culture to collect thalline, after thalline is suspended with TE buffer solutions, with thin
Bacterium genome DNA extracting reagent kit extracts genomic DNA, measures the concentration and purity of extraction DNA, for use；
The design and synthesis of Bh RPA primers download the Bh difference separation strains gltA genes that GenBank is announced, pass through Blast N
Sequence alignment is carried out to Bh gltA genes with DNAMAN softwares, screens target sequence of the highly conserved sequence as amplification, design
It is several to specific primer, high specific and the detection RPA primers of sensibility are provided by experiment sieving；
The preparation of RPA reaction systems and operation sequence prepare RPA reaction systems, carry out RPA reactions,
The screening of the best primers of RPA using Bh genomic DNAs template, carries out RPA amplifications with several to Bh RPA primers respectively,
Then with amplified production into row agarose gel electrophoresis, is filtered out RPA and most preferably drawn according to specificity, sensibility and product amount
Object.
3. the primer of quick detection bartonella henselae according to claim 1 or 2, which is characterized in that draw described
Object is prepared into colloid gold labeling antibody：
Colloidal gold solution is prepared using trisodium citrate reduction method, adds in rabbit-anti DigiTAb IgG thereto, Slow Isothermal shakes
Swing and centrifugal treating, discard supernatant liquid, be precipitated and dissolved in Tris-HCL buffer solutions, obtain colloid gold label rabbit-anti it is high
Pungent IgG antibody.
A kind of 4. reagent of quick detection bartonella henselae, which is characterized in that primer system according to claim 1 or 2
It is standby.
5. a kind of kit of quick detection bartonella henselae, which is characterized in that according to claim 3 to colloidal gold
Prepared by the rabbit-anti DigiTAb IgG of label, the kit includes at least following 5 parts：It is loaded pad, bonding pad, absorption
Pad, NC films and PVC plastic backing strap, the NC films are equipped with detection line, that is, T lines and nature controlling line, that is, C lines, preparation process are：
The colloid gold label rabbit-anti DigiTAb IgG of preparation with liquid-transfering gun is dropped evenly and is sprayed onto on NC films, vacuum is placed on and does
In dry case it is dry after take out, as bonding pad,
On NC films, coating is coated with goat-anti rabbit through PBS buffer solution diluted Streptavidin in detection line (T lines) on nature controlling line
IgG, dry, the sequence of assembling is followed successively by：NC films are first sticked in the intermediate region of PVC plastic backing strap, before bonding pad is attached to NC films
Square region, to ensure good contact, bonding pad pressure NC film 1.5-2.5mm, then sample pad is sticked in front of bonding pad, sample
Water absorption pad is finally attached to the rear of NC films, water absorption pad pressure NC film 1.5-2.5mm, by test paper plate by pad pressure bonding pad 1.5-2.5mm
It is segmented into the test strips of 3.5-4.5mm earnestly, the test strips prepared are packed.
6. a kind of primer of quick detection bartonella henselae and the preparation method of the primer, which is characterized in that mainly include down
Row step：
The preparation of Bh genomic DNAs：Taking Bh exponential phases culture, centrifugal treating collects thalline, abandons supernatant in centrifuge tube,
After thalline is suspended with TE buffer solutions, genomic DNA is extracted with bacterial genomes DNA extraction kit, measures the concentration of extraction DNA
And purity, for use；
The design and synthesis of Bh RPA primers：The Bh difference separation strains gltA genes that GenBank is announced are downloaded, pass through Blast N
Sequence alignment is carried out to Bh gltA genes with DNAMAN softwares, screens target sequence of the highly conserved sequence as amplification, reference
The basic principle of RPA design of primers, design is several to specific primer, and high specific and sensibility have been provided by experiment sieving
Detection RPA primers；
RPA reacts：RPA reaction systems are prepared, including RPA-FP, RPA-RPL, Rehydration Buffer μ L, dd H2O, mould
Plate and MgAc after all reagents premix except template and MgAc, are transferred to the PCR reaction tubes of pre- addition exo freeze-drying enzyme preparations
In, and abundant mixing, template is added in reaction tube, and MgAc is added in reaction lid, cover tightly rear brief centrifugation and is vortexed
Afterwards, it is put into 38-42 DEG C of water-bath and carries out RPA reactions 35-45min；
The screening of the best primers of RPA：Using Bh genomic DNAs template, RPA amplifications are carried out to Bh RPA primers with several respectively,
Then with amplified production into row agarose gel electrophoresis, is filtered out RPA and most preferably drawn according to specificity, sensibility and product amount
Object.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810044923.5A CN108165644A (en) | 2018-01-17 | 2018-01-17 | The primer and preparation method and kit of quick detection bartonella henselae |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810044923.5A CN108165644A (en) | 2018-01-17 | 2018-01-17 | The primer and preparation method and kit of quick detection bartonella henselae |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN108165644A true CN108165644A (en) | 2018-06-15 |
Family
ID=62514600
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810044923.5A Pending CN108165644A (en) | 2018-01-17 | 2018-01-17 | The primer and preparation method and kit of quick detection bartonella henselae |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108165644A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110596395A (en) * | 2019-07-30 | 2019-12-20 | 中国疾病预防控制中心传染病预防控制所 | Colloidal gold detection card for rapidly detecting bartonella henselae antibody and kit thereof |
| CN110794130A (en) * | 2019-10-22 | 2020-02-14 | 中科佑隆（杭州）食安标准科技有限公司 | Nucleic acid two-in-one immune gold-labeled rapid detection card, preparation method and detection method thereof |
| CN113025754A (en) * | 2021-03-29 | 2021-06-25 | 上海基灵生物科技有限公司 | Nucleic acid composition, kit and detection method for detecting feline anemia pathogens |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105524989A (en) * | 2015-12-31 | 2016-04-27 | 中国疾病预防控制中心传染病预防控制所 | Lyme disease spirochaete detection RPA primer and probe and detection method thereof |
| CN105586439A (en) * | 2016-01-27 | 2016-05-18 | 中国人民解放军军事医学科学院基础医学研究所 | Kit for detecting B and E type human adenovirus nucleic acid and detection method thereof |
| CN106868181A (en) * | 2017-03-30 | 2017-06-20 | 上海市农业科学院 | A kind of RPA primers of detection T NOS terminators, kit and detection method |
-
2018
- 2018-01-17 CN CN201810044923.5A patent/CN108165644A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105524989A (en) * | 2015-12-31 | 2016-04-27 | 中国疾病预防控制中心传染病预防控制所 | Lyme disease spirochaete detection RPA primer and probe and detection method thereof |
| CN105586439A (en) * | 2016-01-27 | 2016-05-18 | 中国人民解放军军事医学科学院基础医学研究所 | Kit for detecting B and E type human adenovirus nucleic acid and detection method thereof |
| CN106868181A (en) * | 2017-03-30 | 2017-06-20 | 上海市农业科学院 | A kind of RPA primers of detection T NOS terminators, kit and detection method |
Non-Patent Citations (4)
| Title |
|---|
| BEN MARGOLIS等: "Rapid polymerase chain reaction-based confirmation of cat scratch disease and bartonella henselae infection", 《ARCH PATHOL LAB MED.》 * |
| HAI BIN LIU等: "Development of an isothermal amplification-based assay for the rapid visual detection of salmonella bacteria", 《JOURANL OF DAIRY SCIENCE》 * |
| WEI LIU等: "A novel isothermal assay of borrelia burgdorferi by recombinase polymerase amplification with lateral flow detection, international journal of molecular sciences", 《INTERNATIONAL JOURNAL OF MOLECULAR SCIENCES》 * |
| 景志刚 等: "重组酶聚合酶扩增技术研究进展", 《生物技术通报》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110596395A (en) * | 2019-07-30 | 2019-12-20 | 中国疾病预防控制中心传染病预防控制所 | Colloidal gold detection card for rapidly detecting bartonella henselae antibody and kit thereof |
| CN110794130A (en) * | 2019-10-22 | 2020-02-14 | 中科佑隆（杭州）食安标准科技有限公司 | Nucleic acid two-in-one immune gold-labeled rapid detection card, preparation method and detection method thereof |
| CN113025754A (en) * | 2021-03-29 | 2021-06-25 | 上海基灵生物科技有限公司 | Nucleic acid composition, kit and detection method for detecting feline anemia pathogens |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Zumárraga et al. | Use of touch-down polymerase chain reaction to enhance the sensitivity of Mycobacterium bovis detection | |
| CN108165644A (en) | The primer and preparation method and kit of quick detection bartonella henselae | |
| Monteiro et al. | Magnetic immuno-PCR assay with inhibitor removal for direct detection of Helicobacter pylori in human feces | |
| CN105238860A (en) | LAMP (loop-mediated isothermal amplification) kit for detection of mycoplasma pneumoniae and special LAMP primer for detection of mycoplasma pneumoniae | |
| CN105524989A (en) | Lyme disease spirochaete detection RPA primer and probe and detection method thereof | |
| CN108315450A (en) | The quickly primer of the close chlamydiosis of detection miscarriage and the kit constituted | |
| Tsang et al. | Canadian Public Health Laboratory Network laboratory guidelines for the use of direct tests to detect syphilis in Canada | |
| CN104263838A (en) | LAMP-LFD (loop-mediated isothermal amplification and lateral flow dipstick) detection kit and detection method for Listeria monocytogenes | |
| CN108531627A (en) | One kind is for detecting the streptococcic RPA fluorescent quantitations primer pair of B races, probe, kit and detection method | |
| CN104263839A (en) | LAMP-LFD (loop-mediated isothermal amplification and lateral flow dipstick) detection kit and detection method for brucella | |
| WO2020136595A1 (en) | Fast and portable microfluidic detection system as an alternative to salmonella's classical culture method | |
| CN207933458U (en) | A kind of visualization detects the micro-fluidic chip of pathogen nucleic acid immediately | |
| CN104232783A (en) | Quick detection method for cow brucella attenuated vaccine strain A19 | |
| CN107586861A (en) | For detecting suspension chip and the application of serotype clostridium perfringen parting | |
| CN107236793B (en) | Multiple fluorescent quantitative PCR (polymerase chain reaction) primer, probe, kit and detection method for corynebacterium and corynebacterium klebsiella | |
| CN103060447B (en) | Triple real-time fluorescent PCR testing primers of four kinds of bacterium, probe, detection kit and detection method | |
| Karimi et al. | Development of Rose Bengal test against mallein test for rapid diagnosis of equine glanders | |
| CN117143868A (en) | Cryptococcus neoformans detection primer set, kit and application thereof | |
| Hong et al. | Sensitive and specific detection of mycoplasma species by consensus polymerase chain reaction and dot blot hybridization | |
| WO2015020671A1 (en) | Multiplex amplification reaction method for determination of campylobacter jejuni penner/capsule type | |
| CN104711351A (en) | Specific primer combination for detecting streptococcus pyogenes based on loop-mediated isothermal amplification method and application of specific primer combination | |
| CN108048586A (en) | A kind of detection method of ox kind Brucella sp attenuated vaccine strain S19 | |
| CN102146468B (en) | Special primer for assisted identification of Streptococcus suis type 2 and Streptococcus suis type 7 and application thereof | |
| CN1771331B (en) | stn gene oligonucleotide primers for detecting salmonella species and detection process using the same | |
| CN104862418A (en) | Specific primers for detecting European-type porcine reproductive and respiratory syndrome viruses and corresponding detection kit |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20180615 |