CN207933458U - A kind of visualization detects the micro-fluidic chip of pathogen nucleic acid immediately - Google Patents

Abstract

The utility model is related to the micro-fluidic chips that a kind of visualization detects pathogen nucleic acid immediately, it includes the underlying basal for being equipped with the upper substrate of microfluidic channel and being sealed with the upper substrate, and the sample process and DNA that the upper substrate setting is sequentially communicated extract area, fluid control zone and Visual retrieval area；Wherein, the Visual retrieval area includes detection cell, and the detection cell is equipped with coating specific primer or the chromatographic paper of DNA；The fluid control zone setting carries out the screw valve of fluid control.The utility model provides a kind of micro-fluidic chip integrating sample process, pathogen nucleic acid extraction, amplification and Visual retrieval, it can detect pathogen nucleic acid by simple, quick, visualization bed, using the detection method of the micro-fluidic chip have the characteristics that quickly, it is simple, be not necessarily to specific apparatus, can be applied to the real-time test of all kinds of pathogen nucleic acids in respiratory tract, genital tract sample.

Description

A kind of visualization detects the micro-fluidic chip of pathogen nucleic acid immediately

Technical field

The utility model is related to integrated microfluidic chip manufacturing technology and gene diagnosis field more particularly to a kind of visualizations Immediately the micro-fluidic chip of detection pathogen nucleic acid.

Background technology

The development history of human health and medicine is the history struggled against with various infectious diseases.New infections each time Property disease appearance, resulted in that serious society is panic and economic loss.Common disease, multiple of the respiratory tract infection as paediatrics Disease is the first reason for causing 5 years old or less death of child in world wide, and clinical manifestation is easily realized, but causes respiratory tract The cause of disease of infection is but difficult clear.

The test in laboratory of respiratory pathogen can clearly infect the cause of disease, be conducive to make disease and diagnose, control in time It treats, formulates prevention and control strategy, prevent propagation and prevalence.Lower respiratory tract infection is most common respiratory tract infectious disease, wherein with society Area's acquired pneumonia (community-acquired pneumonia, CAP) is common, is the common infection for threatening population health One of property disease.China has millions of people to suffer from CAP every year, in recent years, due to the aging of social population, immune impairment host Reasons, the diagnosis and treatment of CAP such as increase, pathogen transition and the rising of antibiotics resistance rate face many new problems.CAP be outside institute by Bacterium, caused by the multiple-microorganisms such as virus, Chlamydia and mycoplasma.The infection of streptococcus pneumonia and mycoplasma pneumoniae in CAP Rate is respectively 27%, 15%.Therefore, the respiratory pathogen for detecting above-mentioned high infection rate, helps to make CAP and examine in time Break, treatment, formulate prevention and control strategy, prevents propagation and prevalence.Used seaweed (agar) productive culture based method for the first time from 1850 It is introduced into pathogen detection to molecular biology method, microbiologic inhibition tests method changes with each passing day.Test in laboratory at present Method includes mainly pathogen isolation culture, Serologic detection and molecular Biological Detection.Streptococcus pneumonia (Streptococcuspneumonia, Sp) and mycoplasma pneumoniae (Mycoplasma pneumonia, Mp) are although be separately cultured High special, but its sensibility is relatively low, and the period is longer.The antibody test of pathogen serology cannot solve " the window of immunology detection Whether mouth phase " problem can not judge disease in recessive or sub-clinical state.Though the detection of pathogen serum antigen has very high Detection value, but detection is limited to 10^5-7A pathogen, sensitivity is low, limits its extensive development in clinical labororatory.It is based on The nucleic acid detection method of pathogen DNA or RNA have many advantages, such as hypersensitivity, high specific, polymerase chain reaction (PCR) technology Crucial effect is played in laboratory diagnosis, it has also become first-elected important of current all pathogen make a definite diagnosis means it One, still, since the round pcr for clinical labororatory all needs to rely on particular place, equipment, instrument and the trained work being on duty Make personnel, complicated for operation, time-consuming, technology requires high the conventional of unsuitable pathogen detection to carry out.Therefore, Clinical microorganism is tested Room is suddenly yet-to-be developed, converts and promote the technical method of the above-mentioned pathogen nucleic acid of quick, sensitive and accurate identification.Currently, FilmArray respiratory pathogens detector can be used for multiple cause of disease physical examination as a kind of maneuverable multiplex PCR platform It surveys, but still needs to superior instrument and operating process is controlled, and testing cost is expensive, limit its making extensively clinically With.

Ring mediated isothermal amplification (loop-mediated isothermal amplification, LAMP) is a kind of novel External isothermal duplication nucleic acid specific fragment technology.This technology mainly utilizes the primer of two pairs of special designings and has strand displacement Active archaeal dna polymerase, make in reaction template both ends primer junction cycle there is cyclic single strand structure, to ensure primer It can smoothly be combined under isothermal conditions with template and carry out strand displacement amplification reaction.Because which overcome normal PCR reactions to need The shortcomings that single-stranded template being obtained by thermal denaturation process repeatedly, and the time-consuming process to cool down repeatedly is avoided, realize constant temperature Under the conditions of continuous rapid amplifying, 10 can be amplified at 15-60 minutes⁹-10¹⁰Times target sequence copy, has higher sensitive Degree, specificity and amplification efficiency.LAMP is in the quick detection of pathogenic microorganism, genetic diseases diagnosis, SNP calls Equal fields show huge application potential.LAMP has been applied to tumor mutant gene, mycobacterium tuberculosis and virus at present Quickly detection.

LAMP product detection methods include agarose electrophoresis detection, magnesium pyrophosphate Turbidity measurement, fluorogenic quantitative detection and glimmering Light is estimated.The result of LAMP product agarose electrophoresis detection is continuous scalariform electrophoretic band, but due to needing detection of uncapping, is easy It pollutes.Fluorogenic quantitative detection haves the characteristics that relatively complicated and needs special instruments and equipment, of high cost.Magnesium pyrophosphate turbidity is examined Survey is relative ease detection method, but still needs to real-time Turbidity measurement instrument, to limit its extensive use.Fluorescence ocular estimate is mesh Preceding most easy, quick method selects calcein as fluorescence indicator, LAMP reaction systems is added before reacting, a step is anti- The direct bore hole accurate judgement reaction results of Ying Houke are suitable for real-time test (Point of care testing, POCT). POCT be primarily referred to as other than laboratory scene (including patient bedside, emergency treatment section office, doctor clinic, in family) implement it is fast Speed detection.Itself with regard to LAMP technology, the POCT of molecule diagnosis can not be realized.LAMP combinations micro-fluidic chip can then be broken away from Dependence to superior instrument and equipment and accurate temperature, it is expected to realize the POCT to pathogen nucleic acid.Micro-fluidic chip is a kind of The technology platform that manipulation is main feature is carried out to fluid in micro-meter scale space, in terms of micromation, integrated and portability Advantage wide application platform is provided for biomolecule real-time test.With the development of cross discipline, developed in recent years Micro-fluidic chip replaces the materials such as silicon, glass, high polymer using paper, and by various processing technologies, being processed on paper has The parent of certain structure/dredge micro-channel network and correlation analysis device, to be built into " microscale experiment room on paper.(lab-on- paper).Paper chip is cheap, biocompatibility is strong, is capture and the stable good medium for preserving DNA, also allows for storage desiccation Reagent (provides larger response area), becomes the hot spot of current micro-fluidic chip research field.

It is directed to respiratory pathogen detection of nucleic acids at present, DNA or RNA need to be all extracted from clinical sample, and needs corresponding Detecting system, such as PCR analyzers, centrifuge or gel-electrophoretic apparatus are limited by fixed detection place, are not achieved POCT's It is required that.

Utility model content

For the above-mentioned problems in the prior art, the utility model provides a kind of collection sample process, pathogen core Sour extraction, amplification and Visual retrieval can detect pathogen in the micro-fluidic chip of one by simple, quick, visualization bed Nucleic acid, using the detection method of the micro-fluidic chip have the characteristics that quickly, it is simple, be not necessarily to specific apparatus, can be applied to breathe The real-time test of all kinds of pathogen nucleic acids in road, genital tract sample.

To achieve the above object, the utility model adopts the following technical solution：

First purpose of the utility model is to provide a kind of micro-fluidic chip of the instant detection pathogen nucleic acid of visualization, It includes the underlying basal for being equipped with the upper substrate of microfluidic channel and being sealed with the upper substrate, the upper substrate setting Pass sequentially through sample process and DNA extractions area, the fluid control zone and Visual retrieval area of fluid channel connection；Wherein, institute It includes detection cell to state Visual retrieval area, and the detection cell is equipped with coating specific primer or the chromatographic paper of DNA.

In order to advanced optimize above-mentioned micro-fluidic chip, the technical measures that the utility model is taken further include：

Further, the fluid control zone setting carries out the screw valve of fluid control.Micro-fluidic chip valve packet at present Air valve, hydraulic valve and solenoid valve etc. are included, above-mentioned micro-valve makes complicated and superior instrument is needed to accurately control.The present invention is using manual Screw valve is prepared in chip forming process, easy to operate and effectively control fluid, be suitble at the scene, field and family It is operated.

Further, a diameter of 3~8mm of the screw valve, a height of 3~8mm, screw pitch are 0.5~1.0mm；More preferably For diameter 5mm, high 5mm, screw pitch 0.7mm.

Further, the sample process and DNA extraction area be circular channel area, by fluid channel respectively with sample Entrance, sample waste outlet are connected to fluid control zone, and the sample inlet and sample waste outlet may be contained within the fluid The opposite side of control zone, and the sample inlet and sample waste export and its extract what area was connect with sample process and DNA Fluid channel is arranged symmetrically both with respect to the fluid control zone, so that fluid uniformly flow to Visual retrieval area.

Further, reaction reagent entrance is arranged in the inlet in the Visual retrieval area.

Further, at least two detection cell is arranged in the Visual retrieval area, and each detection cell is controlled relative to the fluid Area is arranged symmetrically, and each detection cell is correspondingly arranged a detection waste liquid outlet communicated therewith respectively.

Further, the fluid channel of the fluid control zone is linear type channel.

Further, the fluid channel in the Visual retrieval area includes first passage, second channel, third channel and Four-way；Wherein, the first passage is linear type channel, and one end of the first passage connects the fluid control zone and institute State reaction reagent entrance, the middle part of the other end connection second channel of the first passage；The both ends of the second channel are respectively Connect the third channel for dispensing fluid to corresponding detection cell, the part third channel in the detection cell inlet For waveform channel；The fourth lane is for connecting detection pond and detection waste liquid outlet.Shape, the size of above-mentioned fluid channel And production method is conducive to that fluid evenly distributes and screw micro-valve effectively controls fluid.

Further, the second channel is semicircular arc channel of the recess towards the fluid control zone, it is ensured that extraction DNA and isothermal amplification reaction reagent evenly distribute to monosymmetric each detection cell；Further, the semicircular arc is logical Road radius is equal to the sum of the length of the radius and first passage of reaction reagent entrance.

Further, the quantity of the detection cell is 8, is divided into 2 groups, every group of 4 detection cells, every group of each self-test is not Same pathogen nucleic acid, 2 groups of both sides for being symmetrically positioned in the fluid control zone respectively；Third channel wherein per side is respectively provided with one A subcenter and two branch points, subcenter and time branch point carry out stream stock to point, and branch point is distinguished each time It is connected to 2 detection cells；Wherein, the secondary branch point being connected to each subcenter is both with respect to the symmetrical cloth of the subcenter It sets, the detection cell being connected to each secondary branch point is arranged symmetrically both with respect to the secondary branch point, so that reaction solution flows to The flow resistance of each detection cell is close, and ensures that each detection cell can be full of by reaction solution, to ensure the completeness of reaction And the accuracy of detection.

Further, the sample inlet, sample waste outlet, reaction reagent entrance, detection waste liquid outlet at be respectively provided with Closeouts；Preferably, the closeouts are that silica gel plug or silica gel paste.

Further, the material of the upper substrate is PDMS (dimethyl silicone polymer), the material of the underlying basal Material for glass silicon chip, the screw valve is PMMA (polymethyl methacrylate).

Further, the one kind of the micro-fluidic chip in disc, quadrangle.

Second purpose of the utility model is to provide a kind of preparation method of above-mentioned micro-fluidic chip comprising following step Suddenly：

Step 1) makes micro-fluidic chip formpiston using photoresist；

Step 2) pours mold solution on the micro-fluidic chip formpiston made from step 1), waits for mold solution curing and demolding Obtain the upper substrate with microfluidic channel structure；

Step 3) plasma machine cleans the upper substrate and underlying basal obtained by step 2), and coating Idiotype is drawn The chromatographic paper of object or DNA are respectively placed in each detection cell, then seal upper substrate and underlying basal, are prepared into detectable The micro-fluidic chip of pathogen nucleic acid.

In order to advanced optimize the preparation method of above-mentioned micro-fluidic chip, the technical measures that the utility model is taken also are wrapped It includes：

Further, include the step of making micro-fluidic chip formpiston in the step 1)：It is made of photoresist process Chip microchannel formpiston, laser cutting make diameter PMMA polymethyl methacrylates microtrabeculae (diameter 10mm, high 2mm) and PMMA PMMA microtrabeculaes, are respectively adhered on AZ-50 formpistons using shadowless glue, micro-fluidic chip are made by microtrabeculae (diameter 3mm, high 2mm) Formpiston.

Further, in the step 2), screw valve is embedded in advance in uncured mold solution, the screw valve Bottom and microfluidic channel vertical range be 0.3~0.8mm；After the solidification of mold solution, screw valve is rotated and is taken out, shape At having threaded channel, to realize fluid control；Further, the bottom of the screw valve is vertical with microfluidic channel Distance is 0.5mm.

Further, a diameter of 3~8mm of the screw valve, a height of 3~8mm, screw pitch are 0.5~1.0mm；More into one Step ground, a diameter of 5mm of the screw valve, high 5mm, screw pitch 0.7mm.

Further, the photoresist is AZ-50 photoresists, and the mold solution is PDMS solution, the underlying basal Material for sheet glass, specially glass silicon chip, the screw valve is PMMA, specially water white transparency PMMA.

Further, the coated primer of the chromatographic paper includes mycoplasma pneumoniae isothermal duplication primer and streptococcus pneumonia etc. Warm amplimer, the sequence such as SEQ ID NO of the mycoplasma pneumoniae isothermal duplication primer：1~SEQ ID NO：Shown in 5, institute State the sequence such as SEQ ID NO of streptococcus pneumonia isothermal duplication primer：6~SEQ ID NO：Shown in 10；The chromatographic paper coating DNA include Mycoplasma pneumonia DNA and pneumococcal dna.

Shown in above-mentioned primer sequence table specific as follows：

The third purpose of the utility model is to provide the detection side that pathogen nucleic acid is carried out using above-mentioned micro-fluidic chip Method comprising following steps：

Step A) sample processing：Throat swab sample is acquired, through being obtained after physiology salt dilution, centrifugation in sterile saline Sediment is obtained, by the sediment and lysate and magnetic bead mixing, obtains mixed liquor；

Step B) pathogen nucleic acid extraction：By step A) obtain mixed liquor micro-fluidic core is added to from sample inlet The sample treatment and DNA of piece extract area, block sample inlet and sample waste outlet, close screw valve；Micro-fluidic chip sets heat A period of time is heated on plate under certain temperature；Sample inlet and sample waste outlet are opened, by paramagnetic particle method in micro-fluidic core On piece extracts DNA；

Step C) pathogen nucleic acid detection：Sample inlet and sample are blocked after deionized water is added to sample treatment area Waste liquid outlet, micro-fluidic chip is set heats a period of time under certain temperature on hot plate, unscrew screw valve；DNA sample is in hot gas The lower mean allocation of pressure effect is equipped with coating specific primer or the chromatographic paper of DNA to each detection cell in the detection cell；It closes Screw valve is added LAMP reaction solutions from reaction reagent entrance, then adds mineral oil, blocks reaction reagent entrance and detection is useless Liquid exports；Micro-fluidic chip is placed in hot plate to heat under certain reaction temperature one section of reaction time, records testing result.

In order to advanced optimize above-mentioned detection method, the technical measures that the utility model is taken further include：

Further, the coated primer of the chromatographic paper includes mycoplasma pneumoniae isothermal duplication primer and streptococcus pneumonia etc. Warm amplimer, the sequence such as SEQ ID NO of the mycoplasma pneumoniae isothermal duplication primer：1~SEQ ID NO：Shown in 5, institute State the sequence such as SEQ ID NO of streptococcus pneumonia isothermal duplication primer：6~SEQ ID NO：Shown in 10；The LAMP reaction solutions Including mycoplasma pneumoniae isothermal duplication primer or streptococcus pneumonia isothermal duplication primer, reaction buffer (RM), calcein, Bst DNA and deionized water；

Further, the LAMP reaction solutions for detecting mycoplasma pneumoniae nucleic acid include 5 μm of 1 μ of ol/l F3-MP L, 5 μm of ol/l B3-Mp 1 μ L, 40 μm of ol/l FIP-MP 1 μ L, 40 μm of ol/l BIP-Mp 1 μ L, 80 μm of ol/l LF-Mp1 μ L, 12.5 2 × reaction buffers of μ L (RM), calcein 1 μ L, Bst DNA1 μ L, 3.5 μ L of deionized water, with sample DNA 2 μ L constitute reaction system together.

Further, the LAMP reaction solutions for detecting streptococcus pneumonia nucleic acid include 5 μm of 1 μ of ol/l F3-SP L, 5 μm of ol/l B3-Sp 1 μ L, 40 μm of ol/l FIP-SP 1 μ L, 40 μm of ol/l BIP-Sp 1 μ L, 80 μm of 1 μ of ol/l LF-Sp L, 12.5 2 × reaction buffers of μ L (RM), calcein 1 μ L, Bst DNA1 μ L, 3.5 μ L of deionized water, with sample DNA 2 μ L constitute reaction system together.

Further, the step A) in, the sediment, lysate, magnetic bead volume be respectively：40μL、80μL、1μ L。

Further, the step B) in, the micro-fluidic chip is set and heats 3~8min for 55~65 DEG C on hot plate, more excellent It is selected as 60 DEG C of heating 5min.

Further, the step B) in, include the step of extracting DNA on micro-fluidic chip by paramagnetic particle method：

A) magnetic pole is placed in sample treatment and DNA extracts the top in area, adsorb magnetic bead, pipettor removes waste liquid；

B) magnetic pole is removed, pipettor draws absolute ethyl alcohol and washs magnetic bead repeatedly, then magnetic pole is placed in sample treatment and DNA is carried The top in area, pipettor is taken to remove waste liquid；

C) magnetic pole is removed, pipettor draws 75% ethyl alcohol and washs magnetic bead repeatedly, then magnetic pole will be placed in sample treatment and DNA The top in area is extracted, pipettor removes waste liquid.

Further, the step C) in, the dosage of the LAMP reaction solutions is 58 μ L, and the dosage of mineral oil is 5 μ L.

Further, the step C) in, the reaction temperature is 60~68 DEG C, and the reaction time is 0.5~1.5h, More preferably reaction temperature is 64 DEG C, reaction time 1h.

Further, the step C) in, it records testing result and is as follows：It is irradiated using Ultraluminescence pen, Smart machine (mobile phone, camera, tablet computer etc.) photographs to record result.

Compared with prior art, the utility model has the following advantages and beneficial effect：

The utility model designs and has made integrated sample process, pathogen nucleic acid extraction, isothermal duplication and visualization inspection Dimethyl silicone polymer (PDMS) compound micro-fluidic chip of survey, realizes the streptococcus pneumonia in throat swab sample and pneumonia branch Quick, the synchronous real-time test of substance.It will be coated with specific primer or DNA (such as mycoplasma pneumoniaes in the production process With streptococcus pneumonia Idiotype primer or DNA) chromatographic paper be packaged in the detection cell of chip respectively, be prepared into functionalization miniflow Control chip.By the throat swab sample centrifugation through normal saline dilution, taking precipitation to be added directly into, chip sample is handled and nucleic acid carries It takes in area, DNA is extracted on chip by paramagnetic particle method.Using plastics screw valve controls fluid, hot barometric pressure drives DNA mean allocations To gene magnification pond.Fluorescent dye calcein is added in reaction solution as indicator, single step reaction is not required to any instrument 1 The Visual retrieval to result is realized in hour.

Description of the drawings

Fig. 1 is the structural schematic diagram of the micro-fluidic chip in one embodiment of the utility model；

Fig. 2 is the making schematic diagram of screw valve in one example of the utility model；

Fig. 3 is in one embodiment of the utility model for detecting mycoplasma pneumoniae and the micro-fluidic chip of streptococcus pneumonia Structural schematic diagram；Wherein 1' and 1 " is detection cell (the double pond detection raising detection knots for being coated with mycoplasma pneumoniae isothermal duplication primer Fruit accuracy)；P1 is to be coated with mycoplasma pneumoniae isothermal duplication primer and the detection cell (positive control) of Mycoplasma pneumonia DNA；N1 For the detection cell (negative control) of no coating primer；2' and 2 " is the detection cell for being coated with streptococcus pneumonia isothermal duplication primer (double pond detections improve testing result accuracy)；P2 is coating streptococcus pneumonia isothermal duplication primer and pneumococcal dna Detection cell (positive control)；N1 is the detection cell (negative control) without being coated with primer；

Fig. 4 is the testing result schematic diagram using micro-fluidic chip shown in Fig. 3；Wherein A indicates the inspection of mycoplasma pneumoniae Survey result；B indicates the testing result of streptococcus pneumonia；C indicates sequencer map (the CARDS Toxin of mycoplasma pneumoniae LAMP products Gene Partial conserved sequence)；D indicates the sequencer map (lytA Gene Partials conserved sequence) of streptococcus pneumonia LAMP products.

Reference numeral in figure is：

1, upper substrate；2, underlying basal；3, sample process and DNA treatment regions；31, sample waste exports；32, sample enters Mouthful；4, fluid control zone；41, screw valve；5, Visual retrieval area；51, detection cell；52, chromatographic paper；53, reaction reagent entrance； 54, waste liquid outlet is detected；55, first passage；56, second channel；57, third channel；571, part third channel；58, the 4th Channel；591, subcenter；592, secondary branch point；6, microfluidic channel；D, in manufacturing process screw valve and microfluidic channel it Between vertical range.

Specific implementation mode

The utility model is related to the micro-fluidic chips that a kind of visualization detects pathogen nucleic acid immediately comprising be equipped with miniflow It controls the upper substrate in channel and the sample being sequentially communicated is arranged in the underlying basal with upper substrate sealing, the upper substrate Processing and DNA extractions area, fluid control zone and Visual retrieval area；Wherein, the Visual retrieval area includes detection cell, institute It states detection cell and is equipped with coating specific primer or the chromatographic paper of DNA；The fluid control zone setting carries out the screw of fluid control Valve；The utility model further relates to the preparation method and detection method of above-mentioned micro-fluidic chip.

With reference to embodiment and attached drawing, specific embodiment of the present utility model is further described.Implement below Example is only used for clearly illustrating the technical solution of the utility model, and the protection model of the utility model cannot be limited with this It encloses.

Embodiment one

The present embodiment is the micro-fluidic chip of a preferred versions.

As shown in figures 1 and 3, the micro-fluidic chip described in the present embodiment includes the upper layer base of the PDMS materials mutually sealed The shape of the underlying basal 2 of piece 1 and glass silicon chip material, upper substrate 1 and underlying basal 2 is square.On upper substrate 1 Microfluidic channel 6 is set, it is specific to extract area 3, stream for the sample process for passing sequentially through the fluid channel connection and DNA is arranged Body control zone 4 and Visual retrieval area 5.

Above-mentioned sample process and DNA extraction area 3 be circular channel area, by fluid channel respectively with sample inlet 32, Sample waste outlet 31 is connected to fluid control zone 4, and the sample inlet 32 and sample waste outlet 31 may be contained within the stream The opposite side of body control zone 4, and the sample inlet 32 and sample waste export 31 and its extract area with sample process and DNA The fluid channel of 3 connections is arranged symmetrically both with respect to the fluid control zone 4.

The fluid channel of above-mentioned fluid control zone 4 is linear type channel, is arranged in the fluid control zone 4 and carries out fluid control Screw valve 41, a diameter of 3~8mm, a height of 3~8mm, screw pitch be 0.5~1.0mm.

2 detection cells 51 are arranged in above-mentioned Visual retrieval area 5, and each detection cell 51 is carried out relative to the fluid control zone 4 It is arranged symmetrically, each detection cell 51 is correspondingly arranged a detection waste liquid outlet 54 communicated therewith respectively, wherein in 1 detection cell 51 The chromatographic paper 52 of specific primer equipped with the related pathogen of coating, interior be equipped with of another 1 detection cell 51 are coated with related pathogen The chromatographic paper 52 of specific primer and DNA (as positive control).

Reaction reagent entrance 53, the fluid channel packet in Visual retrieval area 5 is arranged in the inlet in above-mentioned Visual retrieval area 5 Include first passage 55, second channel 56, third channel 57 and fourth lane 58；Wherein, first passage 55 is linear type channel, One end connecting fluid control zone 4 and reaction reagent entrance 53 (being similar to threeway), the other end connects the middle part of second channel 56；It should Second channel 56 is semicircular arc channel of the recess towards the fluid control zone 4, and radius is equal to reaction reagent entrance 53 The both ends of the sum of the length of radius and first passage 55, second channel 56 are respectively connected for dispensing fluid to corresponding inspection The third channel 57 for surveying pond 51, the part third channel 571 in 51 inlet of the detection cell are waveform channel；Fourth lane 58 for connecting detection pond 51 and detection waste liquid outlet 54.

In this embodiment, the sample inlet 32, sample waste outlet 31, reaction reagent entrance 53, detection waste liquid go out Closeouts, such as silica gel plug or silica gel patch are respectively provided at mouth 54.

Embodiment two

The present embodiment is the preparation method of the micro-fluidic chip described in embodiment one comprising following steps：

Step 1) makes micro-fluidic chip formpiston using photoresist：Chip manufacturing uses soft lithography and micro Process skill Art makes chip microchannel formpiston using AZ-50 photoresist process, and laser cutting makes diameter PMMA polymethyl methacrylates PMMA microtrabeculaes, are respectively adhered on by microtrabeculae (diameter 10mm, high 2mm) and PMMA microtrabeculaes (diameter 3mm, high 2mm) using shadowless glue On AZ-50 formpistons, micro-fluidic chip formpiston is made；

Step 2) pours PDMS mold solution on the micro-fluidic chip formpiston made from step 1), by water white transparency PMMA spiral shells Silk valve (diameter 5mm, high 5mm, screw pitch 0.7mm) be embedded in advance in uncured mold solution, the bottom of the screw valve with The vertical range d of microfluidic channel is about 0.5mm；After PDMS mold solution is heating and curing, screw valve is revolved using screwdriver Turn to take out, is formed and have threaded channel, to realize fluid control；Demoulding, which obtains, after mold solution is fully cured has miniflow Control the upper substrate of channel design；

The PDMA upper substrates and underlying basal (glass silicon chip) that the cleaning of step 3) plasma machine is obtained by step 2), The chromatographic paper for being coated with Idiotype primer or DNA is respectively placed in each detection cell, then seals upper substrate and underlying basal It closes, is prepared into the micro-fluidic chip of detectable pathogen nucleic acid.

In the production method, wherein the chromatographic paper coating mycoplasma pneumoniae isothermal duplication primer in 1 detection cell, another 1 Chromatographic paper coating mycoplasma pneumoniae isothermal duplication primer in a detection cell and Mycoplasma pneumonia DNA；Or further, wherein Chromatographic paper in 1 detection cell is coated with streptococcus pneumonia isothermal duplication primer, and the chromatographic paper in another 1 detection cell is coated with pneumonia chain Coccus isothermal duplication primer and pneumococcal dna；Any suitably may be used it will be understood that above-mentioned pathogen can be replaced other The pathogen detected using LAMP constant-temperature amplifications.

Embodiment three

The present embodiment is another preferable micro-fluidic chip, is used to detect mycoplasma pneumoniae and streptococcus pneumonia simultaneously.

Micro-fluidic chip in the embodiment and micro-fluidic chip remaining structure all same in embodiment one, only following Aspect exists different：As shown in Fig. 2, in this embodiment, 8 detection cells 54 are arranged in micro-fluidic chip, are divided into 2 groups, every group 4 A detection cell 54, the different pathogen nucleic acid of every group of each self-test are specially located in 1 group of detection cell in left side and encapsulate respectively It is coated with the detection cell (1' and 1 "), coating mycoplasma pneumoniae special primer and pneumonia of mycoplasma pneumoniae isothermal duplication primer chromatographic paper The detection cell (positive control P1) of mycoplasma DNA chromatographic papers, detection cell (the moon without coating primer and pathogen DNA chromatographic papers Property control N1)；Encapsulate the inspection of coating Diplococcus pneumopniae isothermal duplication primer chromatographic paper respectively in 1 group of detection cell on right side Survey pond (2' and 2 "), coating Diplococcus pneumopniae special primer and Diplococcus pneumopniae DNA chromatographic papers detection cell (positive control P2), It is not coated with the detection cell (negative control N2) of primer and pathogen DNA chromatographic papers.Above-mentioned 2 groups of detection cells 51 are respectively symmetrically located at The both sides of the fluid control zone 4；Third channel 57 wherein per side is respectively provided with a subcenter 591 and two branch points 592, stream stock is carried out flow to point by subcenter 591 and time branch point 592, and branch point 592 is detected with 2 respectively each time Pond 51 is connected to；Wherein, the secondary branch point 592 being connected to each subcenter 591 is both with respect to 591 symmetrical cloth of the subcenter It sets, the detection cell 51 being connected to each secondary branch point 592 is arranged symmetrically both with respect to the secondary branch point 592.

Example IV

The present embodiment is the detection method that pathogen nucleic acid is carried out using the micro-fluidic chip described in embodiment three, is established Streptococcus pneumonia and mycoplasma pneumoniae isothermal amplification method, mainly include the following steps that：

1) streptococcus pneumonia and mycoplasma pneumoniae isothermal amplification method are established

(1) LAMP primer design software PrimerExplorer V5 are used, according to mycoplasma pneumoniae CARDS Toxin bases Because designing isothermal duplication primer.

F3-Mp:CCACCTAGTGATTTGGAAGA(SEQ ID NO：1)；

B3-Mp:GGACAAAGAAGATTTTCGAAGTT(SEQ ID NO：2)；

FIP-Mp:GCTGAACATCAACAAAGAAGGTGCATTGTTGATGAATGTACTACCCA(SEQ ID NO：3)；

BIP-Mp:ATACCCCACAATTAAGTGGTTGATTCATAGAATATCTGTCCATCTGG(SEQ ID NO：4)；

LF-Mp:CTGCACGCATAGTAACAAACTG(SEQ ID NO：5).

(2) LAMP primer design software PrimerExplorer V5 are used, according to streptococcus pneumonia lytA genes design etc. Warm amplimer.

F3-Sp:GCGTGCAACCATATAGGCAA(SEQ ID NO：6)；

B3-Sp:AGCATTCCAACCGCC(SEQ ID NO：7)；

FIP-Sp:CCGCCAGTGATAATCCGCTTCACACTCAACTGGGAATCCGC(SEQ ID NO：8)；

BIP-Sp:TCTCGCACATTGTTGGGAACGGCCAGGCACCATTATCAACAGG(SEQ ID NO：9)；

LB-Sp:TGCATCATGCAGGTAGGA(SEQ ID NO：10).

2) configuration LAMP reaction system optimizations (25 μ L systems)

5μmol/l F3-MP 1μL；5μmol/l B3-Mp 1μL；40μmol/l FIP-MP 1μL；40μmol/l BIP- Mp 1μL；80μmol/l LF-Mp1μL；12.5 2 × reaction buffers of μ L (RM)；1 μ L of calcein；Bst DNA 1μL；It goes 3.5 μ L of ionized water；2 μ L of DNA (come from sample).

5μmol/l F3-SP 1μL；5μmol/l B3-Sp 1μL；40μmol/l FIP-SP 1μL；40μmol/l BIP- Sp 1μL；80μmol/l LF-Sp 1μL；12.5 2 × reaction buffers of μ L (RM)；1 μ L of calcein；Bst DNA 1μL；It goes 3.5 μ L of ionized water；2 μ L of DNA (come from sample).

3) micro-fluidic chip detects pathogen nucleic acid step

(1) sample process

Each patient acquires throat swab sample, washs immediately in 1mL sterile salines (when such as being not required to detect immediately - 20 DEG C of preservations can be set), 3000rpm is centrifuged 5 minutes, abandons supernatant, takes 40 μ L precipitations and 80 μ L lysates and 1 μ L magnetic bead mixings. (bacterial lysate and magnetic bead are provided by Shanghai Haoyuan Biotechnology Co., Ltd.)

(2) pathogen nucleic acid extracts

1. mixed liquor to be added to chip sample processing and DNA extractions area (A) from sample export using pipettor, block The sample inlet and waste liquid outlet in the areas A close screw valve.

2. chip sets 60 DEG C of heating 5min on hot plate.

3. opening sample inlet and waste liquid outlet, magnetic pole is placed in above chip sample treatment region, adsorbs magnetic bead, pipettor Remove waste liquid.

4. removing magnetic pole, pipettor draws absolute ethyl alcohol and washs magnetic bead repeatedly.Magnetic pole is placed in above chip sample treatment region, Pipettor removes waste liquid.

5. removing magnetic pole, pipettor draws 75% ethyl alcohol and washs magnetic bead repeatedly, then magnetic pole will be placed in chip sample processing Above area, pipettor removes waste liquid.

(3) pathogen nucleic acid detects

1. blocking sample inlet after 32 μ L deionized waters are added to sample treatment area and waste liquid outlet, chip being set on hot plate 60 DEG C of heating 5min, unscrew screw valve, DNA sample under hot barometric pressure effect mean allocation to 8 detection cells.Screw valve is closed, 58 μ L LAMP reaction solutions are added from reagent inlet, then add 5 μ L mineral oil.It blocks reagent inlet and remaining 8 micro- pond is useless Liquid exports.

2. chip sets 64 DEG C of heating 1h of hot plate, the irradiation of 365 Ultraluminescence pens, taking photograph of intelligent mobile phone records result.

For above-mentioned testing result as shown in figure 4, wherein part A is mycoplasma pneumoniae testing result figure, part B is pneumonia streptococcus Bacterium testing result figure, and C portion and the parts D are the LAMP product sequencer maps carried out using instrument, wherein C portion is that pneumonia branch is former Body LAMP products sequencer map (CARDS Toxin Gene Partials conserved sequence)；The parts D are streptococcus pneumonia LAMP product sequencer maps (lytA Gene Partials conserved sequence).

By above-described embodiment it is found that the utility model provide a kind of collection sample process, pathogen nucleic acid extraction, amplification and Visual retrieval can detect pathogen nucleic acid in the micro-fluidic chip of one by simple, quick, visualization bed, micro- using this The detection method of fluidic chip have the characteristics that quickly, it is simple, be not necessarily to specific apparatus, can be applied to respiratory tract, genital tract sample In all kinds of pathogen nucleic acids real-time test.

Specific embodiment of the utility model is described in detail above, but it is intended only as example, this practicality is new Type is not restricted to particular embodiments described above.To those skilled in the art, any that the utility model is carried out Equivalent modifications and substitute also all among the scope of the utility model.Therefore, in the spirit and model for not departing from the utility model Impartial conversion and modification made by under enclosing, should all cover in the scope of the utility model.

Claims (10)

1. a kind of visualization detects the micro-fluidic chip of pathogen nucleic acid immediately, which is characterized in that including being equipped with microfluidic channel Upper substrate (1) and underlying basal (2) with the upper substrate (1) sealing, the upper substrate (1) setting passes sequentially through The sample process of fluid channel connection and DNA extractions area (3), fluid control zone (4) and Visual retrieval area (5)；Wherein, institute It includes detection cell (51) to state Visual retrieval area (5), and the detection cell (51) is equipped with coating specific primer or the chromatographic paper of DNA (52)。

2. micro-fluidic chip according to claim 1, which is characterized in that fluid control zone (4) setting carries out fluid The screw valve (41) of control.

3. micro-fluidic chip according to claim 2, which is characterized in that a diameter of 3~8mm of the screw valve (41), A height of 3~8mm, screw pitch are 0.5~1.0mm.

4. micro-fluidic chip according to claim 1, which is characterized in that the sample process and DNA extract area (3) as circle Shape channel region is connected with sample inlet (31), sample waste outlet (32) and fluid control zone (4) respectively by fluid channel Logical, the sample inlet (31) and sample waste export the opposite side that (32) may be contained within the fluid control zone (4), and institute The fluid channel stated sample inlet (31) and sample waste outlet (32) and its connect with sample process and DNA extractions area (3) is equal It is arranged symmetrically relative to the fluid control zone (4).

5. micro-fluidic chip according to claim 4, which is characterized in that the inlet of the Visual retrieval area (5) is set Set reaction reagent entrance (53).

6. micro-fluidic chip according to claim 5, which is characterized in that at least two is arranged in the Visual retrieval area (5) Detection cell (51), the detection cell (51) are arranged symmetrically relative to the fluid control zone (4), each detection cell (51) point It is not correspondingly arranged a detection waste liquid outlet (54) communicated therewith.

7. micro-fluidic chip according to claim 6, which is characterized in that the fluid channel in the Visual retrieval area includes First passage (55), second channel (56), third channel (57) and fourth lane (58)；Wherein, the first passage (55) is The one end in linear type channel, the first passage (55) connects the fluid control zone (4) and the reaction reagent entrance (53), The other end of the first passage (55) connects the middle part of the second channel (56)；The both ends of the second channel (56) are respectively The third channel (57) for dispensing fluid to corresponding detection cell (51) is connected, in the detection cell (51) inlet Part third channel (571) is waveform channel；The fourth lane (58) goes out for connecting detection pond (51) and detection waste liquid Mouth (54).

8. micro-fluidic chip according to claim 6, which is characterized in that the sample inlet (31), sample waste outlet (32), reaction reagent entrance (53), be respectively provided with closeouts at detection waste liquid outlet (54).

9. micro-fluidic chip according to claim 2 or 3, which is characterized in that the material of the upper substrate (1) is The material of PDMS, the underlying basal (2) are glass silicon chip, and the material of the screw valve (41) is PMMA.

10. micro-fluidic chip according to claim 1, which is characterized in that the micro-fluidic chip is selected from disc, four sides One kind in shape.