CN108103171A - The preparation method of vibrio parahemolyticus fingerprint databases - Google Patents
The preparation method of vibrio parahemolyticus fingerprint databases Download PDFInfo
- Publication number
- CN108103171A CN108103171A CN201810003772.9A CN201810003772A CN108103171A CN 108103171 A CN108103171 A CN 108103171A CN 201810003772 A CN201810003772 A CN 201810003772A CN 108103171 A CN108103171 A CN 108103171A
- Authority
- CN
- China
- Prior art keywords
- vibrio parahemolyticus
- seq
- nucleic acid
- mass
- dna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/16—Primer sets for multiplex assays
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Physics & Mathematics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Other Investigation Or Analysis Of Materials By Electrical Means (AREA)
Abstract
The invention discloses a kind of preparation method of vibrio parahemolyticus fingerprint databases, including：The corresponding specific primer of over-designed sequence；Multiplex amplification is carried out to genomic DNA；Multiple PCR products are purified；Purified product is detected by mass spectrograph, obtains the nucleic acids characteristic finger-print of different vibrio parahemolyticus；The nucleic acid fingerprint characteristic collection of illustrative plates for the different separation strains that step is obtained, is summarized and is arranged by computer software, obtains the standard nucleic acid fingerprint characteristic collection of illustrative plates of vibrio parahemolyticus.Based on this method, the nucleic acid fingerprint spectrum database of common vibrio parahemolyticus is established, the vibrio parahemolyticus parting in the fields such as environmental sanitation, food safety detection, public place safety, inlet and outlet inspection and quarantine can be identified, to safeguard public health security.
Description
Technical field
The invention belongs to molecular Biological Detection fields, are related to a kind of molten using ionization time of flight Rapid identification pair
The preparation method of courageous and upright vibrios fingerprint databases.
Background technology
Vibrio parahemolyticus (Vibrio Parahemolyticus) distributed pole is wide, is mainly distributed on seawater and aquatic products
In, the vibrio parahemolyticus recall rate of the seawater of China East China bank is 47.5%~66.5%, and marine fishes and shrimps are averaged
Bacterial bearing rate is 45.6%~48.7%, and summer may be up to more than 90%.In addition, livestock meat, salted vegetables, salted egg, fresh-water fishes etc. all send out
The presence of existing vibrio parahemolyticus.Vibrio parahemolyticus is only second to comma bacillus to mankind's harm, and pathogenic strain can cause people
Class diarrhea, Nausea and vomiting, abdominal cramps, it is serious that stupor, dehydration can be caused even dead.Except clinically needing to strengthen
Outside the detection of vibrio parahemolyticus, in food security (such as meat products processing, barbecue), environmental sanitation (such as organ of school
Logistics place), inlet and outlet inspection and quarantine, public place secure context be also required to carry out Classification Identification to vibrio parahemolyticus, with
Safeguard public health security.
Research finds that the Major Virulence Factors of vibrio parahemolyticus include a variety of hemotoxins, mainly has thermo-labile directly molten
Hemotoxin (TLH), Thermostable direc t hemolysin (TDH) and heat-resisting TDH related hemolysin (TRH), respectively by tlh, tdh and
Trh gene codes.The identification method of usual vibrio parahemolyticus be separately cultured, microscopy observation, biochemical identification, halophagia are tested
Deng, not only take, and it is complicated for operation, sensitivity is limited.Recently as the development of molecular biology, to vibrio parahemolyticus
Research is even more to take especially to the research of its genomic DNA, plasmid, flagellum and virulence factor etc. deeper into a step
Obtained considerable progress.Therefore need using method of the molecule parting technology as auxiliary diagnosis.Secondary haemolysis common in recent years
Property vibrios rapid detection method mainly has ELISA, DNA probe, Standard PCR, real-time PCR etc..Nucleic acid based on multiplex PCR
Detection method, the quick of precise Identification and the infection sources to vibrio parahemolyticus find to be of great significance.And multiplex PCR detects
For multiple genes, false negative rate is reduced than substance PCR.
Matrix-assisted laser desorption ionization (matrix-assisted laser desorption/
Ionization time-of-flight mass spectrometry, abbreviation MALDI-TOF MS) technology is 20th century 80
A kind of analytical technique of mass spectrum that age Mo comes out and develops rapidly.Its mass analyzer is an ion drift tube (ion
Dirft tube), the ion generated by ion source is collected first, and all ion velocities become 0 in collector, use one
Impulse electric field enters field-free drift pipe after accelerating, and flies to ion acceptor with constant speed, and mass of ion is bigger, reaches and receives
The time is longer used in device；Mass of ion is smaller, and it is shorter to reach the time used in receiver.It, can be not homogeneity according to this principle
The ion of amount is separated by mass-to-charge ratio size, accurately detects the molecule of the large biological molecules such as polypeptide, protein, nucleic acid, polysaccharide
Quality and purity have the advantages that accuracy is high, flexibility is strong, flux is big, detection cycle is short, cost-effective.
In recent years, there is mass-spectrometric technique to detect nucleic acid and protein field, wherein mass-spectrometric technique is applied to nucleic acid
The theoretical foundation of detection field is, forms the elementary cell of hereditary material DNA --- there are of poor quality between four kinds of nucleotide
It is different, as the molecular weight of ddAMP, ddCMP, ddGMP, ddTMP are followed successively by 271.2Da, 247.2Da, 287.2Da, 327.1Da (its
Middle ddTMP is by modification), minimum molecular weight difference between them can be differentiated completely by mass spectrum in 16Da.
Using mass spectrum can to base mutation or polymorphic site (SNP), insertion/deletion (InDel), methylation sites, gene quantification, copy
A variety of DNA change types such as shellfish number variation (copy number variation, CNV) are detected.
Have some open source literatures microorganism is classified and identified using mass-spectrometric technique, for example, Chinese patent application
CN102337223A, " penicillium chrysogenum antifungal protein Pc-Arctin and preparation method thereof " disclose a kind of detection penicillium chrysogenum
The MALDI-TOF identification methods of antifungal protein Pc-Arctin, wherein from tablet picking penicillium chrysogenum A096 spore inoculatings in
SGY fluid nutrient medium cultures, pretreatment obtain crude protein solution and isolate and purify on a column, and in carboxymethyl cation exchange
It is isolated and purified in chromatographic column, collects each elution fraction, each component centrifugal ultrafiltration is concentrated into required volume, using paecilomyces varioti to be quick
Impression examination indicator bacteria, tracks antifungal activity component, and definite active ingredient judges to obtain the purity of albumen；Extract SDS-PAGE
Single band on electrophoretogram carries out MALDI-TOF identifications.This method is only applicable to specified microorganisms, and needs multiplexed protein
Purification process, finally with MALDI-TOF identification mark albumen Pc-Arctin, process is cumbersome, and applicable surface is narrow, it is impossible to realize matter
Spectrum classification bacterium or the purpose of microorganism.
Chinese patent application 201110154723, " the single method for increasing listeria spp of MALDI TOF MS auxiliary identifications " and
201110154469th, " method of MALDI TOF MS auxiliary identification vibrio parahemolyticus " discloses a kind of utilization MALDI TOF
The method of MS technologies auxiliary identification bacterium, including：Bacterial cultures is pre-processed, gathers the MALDI TOF MS of all bacterial strain samples
Collection of illustrative plates is prepared bacterium standard diagram according to software, is detected using identical method and gather the collection of illustrative plates of tested bacteria and compare
The two collection of illustrative plates is judged according to matching fraction.Since this method uses conventional processing (to pass through absolute ethyl alcohol, formic acid and second
Nitrile processing, and it is aided with centrifugation, last Aspirate supernatant is detected), although it can characterize the spy of the bacterium to a certain extent
Levy collection of illustrative plates, but due in its determinand contain protein, lipid, lipopolysaccharides and fat oligosaccharides, DNA, polypeptide and it is other can be by ion
The molecule of change, obtained collection of illustrative plates are substantially the collection of illustrative plates set of above-mentioned various molecules, therefore both need the figure for handling and comparing
Spectrum information amount is excessive, and causes its TuPu method relatively low due to molecule to be checked is excessively huge, is only applicable to certain specific bacterium
And it can not be generalized in other substantial amounts of Bacteria Detections.
Chinese patent application 201210272533.6 " method for establishing helicobacter pylori nucleic acid fingerprint spectrum and products thereof ",
A kind of method based on mass-spectrometric technique Rapid identification helicobacter pylori is disclosed, including PCR amplification, SAP enzymic digestions, transcription and core
Sour digestion, purifying, mass spectrograph detection and etc..This method utilizes ionization time of flight, different to molecular weight and abundance
Nucleic acid fragment is detected, and forms spectrogram.But this method center acid fragment also needs to disappear by SAP enzymes after PCR amplification
Change, transcription and nucleic acid digestion, are only capable of identifying the variation of single base, can not detect the DNA long fragment of characteristic sequence.
In addition, based on MALDI-TOF MS, develop some nucleic acid detection methods, as Agena companies of the U.S. hME and
IPLEX methods, the GOOD assay methods of German Bruker companies, the RFMP methods of GeneMatrix companies of South Korea.Each company
In order to improve mass spectrometric resolution ratio, target site is detected and tends to the smaller oligonucleotide fragment of detection molecules amount,
If RFMP methods to the multiple PCR products for containing single nucleotide polymorphism (SNP) site by carrying out restricted digestion, 2000 are generated
The oligonucleotide fragment of~4000Da or so is detected, and GOOD assay methods pass through phosphodiesterase
Oligonucleotide fragment containing SNP site is cut into the small pieces of 1000~2000Da or so by (Phosphodiesterase, PDE)
Section is detected.However, above method, complicated for operation, the problems such as time-consuming is all inevitably present.
In addition, ([J] .PLoS One, 2007,2 (5) such as U.S. Sampath:E489) report RT-PCR and electron spray
Technology (the reverse transcription PCR/electrospray-ionization mass that chromatography is combined
Spectrometry, RT-PCR/ESI-MS).This method can quickly detect 92 kinds of mammals and birds influenza separation strains,
It is inferred to 30 kinds of different H and N-type is viral (including 29 kinds of AIV H5N1 separation strains), accuracy rate is up to 97%, and the time is only
Want short a few houres.The technology can detect the viral sample of mixed infection and available for each hypotype and unknown of virus simultaneously
The extensive detection of the new variant of nucleotide sequence virus.But the mass spectrograph needed for the technology is expensive, is also confined at present
It is used in a small number of research institutions.
Chinese patent application 200880121570, denomination of invention are " for diagnosing and monitoring the method and biology of mental illness
Marker ", which reports, to detect nearly hundred kinds and mental illness including influenza virus by MALDI-TOF mass-spectrometric techniques
Relevant biology peptide.However, this method only various possible technologies of simplified summary, both without report concrete scheme,
The specific target spot of influenza virus is not reported, therefore, it is difficult to researcher is instructed to pass through MALDI-TOF mass-spectrometric techniques to detect influenza
Virus.
Therefore, it is quick, accurate, cheap, just to realize to need identification and the analysis method of new vibrio parahemolyticus at present
Prompt classification results.Multiplex PCR is combined by the present invention with ionization time of flight, can be straight after multiple PCR products are purified
Row Mass Spectrometer Method is tapped into, overcoming multitube increases the probability of pollution, simplifies operation, shortens detection time, high specificity, inspection
Sensitivity is surveyed far above traditional bacteria distribution culture and serological Identification, suitable for the detection of high-volume sample, is had in clinic
Have broad application prospects.
The content of the invention
The principle of the invention is：Form hereditary material DNA elementary cell --- there are of poor quality between four kinds of nucleotide
It is different, after certain several segment carries out multiplex PCR on vibrio parahemolyticus genomic DNA, molecular weight will be generated and abundance is different
Segment can generate nucleic acid fingerprint spectrum using Mass Spectrometer Method, and the genomic DNA between the different serotypes of vibrio parahemolyticus is deposited
In difference, different nucleic acid fingerprint spectrums will be generated.After establishing database, by vibrio parahemolyticus in experimental result and database
Standard diagram information is compared, you can completes identification, parting, classification to vibrio parahemolyticus etc..The method has special
Property strong, high sensitivity, at low cost, easy to operate, the advantages such as the used time is few.
One of principle of the invention is, since the genomic DNA between the different serotypes of vibrio parahemolyticus is in the presence of poor
It is different, the nucleotide of gene is caused to form there are nuance, i.e. there are quality differences between four kinds of nucleotide.Therefore by MALDI-
TOF mass spectrums are combined with multiplex PCR, by optimizing multiplex PCR system, after obtaining target spot amplified production, you can directly produce amplification
Object carries out MALDI-TOF MS detections.More specifically, this method specifically expanded using multiplex PCR it is multiple of different sizes
Oligonucleotide fragment, the different nucleic acid fingerprint spectrums generated using different oligonucleotide fragments during mass spectrum parting,
After establishing database, experimental result is compared with vibrio parahemolyticus standard diagram information in database, you can completion pair
Identification, parting, classification of vibrio parahemolyticus etc..The method has high specificity, and high sensitivity is at low cost, easy to operate, uses
When the advantages such as few.
The two of the principle of the invention are, during multiplex PCR system optimization, are carried out by the complete sequence to target nucleic acid
Analysis chooses conserved sequence design primer and carries out multiplexed PCR amplification, and primer is improved for PCR amplification result, most
It is selected for the effective primer sequence of specific amplification eventually；In order to distinguish PCR product similar in size, not shadow is introduced in primer
Ring the tag sequences of PCR amplification；By multiple PCR products it is purified after directly carry out MALDI-TOF MS analyses, so as to successfully realize
The quick detection of target nucleic acid.
Therefore, an object of the present disclosure is to provide the primer for identifying the multiple PCR products of vibrio parahemolyticus parting
Combination, the wherein primer combination include,
Primer is SEQ ID NO.1 and the SEQ ID of the specific primer of the tlh segments of amplification vibrio parahemolyticus
NO.2, the mass spectrogram peaks of amplified production are 33708Da；
SEQ ID NO.3 and SEQ the ID NO.4 of the specific primer of the tdh segments of vibrio parahemolyticus are expanded, are expanded
The mass spectrogram peaks for increasing production object are 37250Da；
SEQ ID NO.5 and SEQ the ID NO.6 of the specific primer of the trh segments of vibrio parahemolyticus are expanded, are expanded
The mass spectrogram peaks for increasing production object are 42702Da.
In any of the above-described embodiment, wherein primer sets conjunction can add in tag sequences as needed, produce multiplex PCR
Object is sized to easily be distinguished by MALDI-TOF MS.In a specific embodiment, the tag sequences are
ACGTTGGATG。
Second purpose of the invention is to provide for above-mentioned mass spectrography (MALDI-TOF MS) identification vibrio parahemolyticus point
The mass spectrometry kit of the multiple PCR products of type, the wherein kit include the above-mentioned specific primer for being used to expand above-mentioned virus
Combination, the special point sample matrix of mass spectrum.
In one embodiment, the composition of the point sample matrix is 3-HPA: DHC: formic acid=4: 2: 1.
In another embodiment, primer is the SEQ ID of the specific primer of the tlh segments of amplification vibrio parahemolyticus
NO.1 and SEQ ID NO.2, the mass spectrogram peaks of amplified production are 33708Da；
SEQ ID NO.3 and SEQ the ID NO.4 of the specific primer of the tdh segments of vibrio parahemolyticus are expanded, are expanded
The mass spectrogram peaks for increasing production object are 37250Da；
SEQ ID NO.5 and SEQ the ID NO.6 of the specific primer of the trh segments of vibrio parahemolyticus are expanded, are expanded
The mass spectrogram peaks for increasing production object are 42702Da.
In any of the above-described embodiment, wherein primer sets conjunction can add in tag sequences as needed, produce multiplex PCR
Object is sized to easily be distinguished by MALDI-TOF MS.In a specific embodiment, the tag sequences are
ACGTTGGATG。
In any of the above-described embodiment, wherein containing in the 30 μ l of reaction system of the PCR amplification：
In a preferred embodiment, wherein the concentration of every group of primer pair is controlled between 10-20 μM.
In another preferred embodiment of the present, wherein being in pcr amplification reaction program：94-95 DEG C of pre-degeneration 5min；94-95
DEG C denaturation 30s, 55-60 DEG C annealing 30s, 72-75 DEG C extension 40-60s, carry out 35-45 cycle；Then, 72-75 DEG C of extension
5min。
In any of the above-described embodiment, the kit further includes the special micro-array chip of mass spectrum, mass spectrum internal standard standard
Product, mass spectrum external standard standard items.
In one embodiment, the nucleic acid fingerprint characteristic for comparative analysis isolated strains is also included in the kit
The software of collection of illustrative plates.In in a preferred embodiment, the software is that the BioExplore that inventor voluntarily researchs and develops is soft
Part, copyright number step on word the 136879th, registration number 2009SR10700 for soft work.
Third object of the present invention is to provide a kind of method for identifying vibrio parahemolyticus parting, and step includes
Multiplexed PCR amplification is carried out to the characteristic fragment of vibrio parahemolyticus to be measured using specific primer combination；
Multiple PCR products are purified by adsorption column；
By multiple PCR products point sample after purification in matrix crystallization, pass through the segments of Mass Spectrometer Method multiple PCR products
Size；
By mass spectral results compared with vibrio parahemolyticus fingerprint databases, to determine specific point of vibrio parahemolyticus to be checked
Type；
Wherein,
The primer is SEQ the ID NO.1 and SEQ of the specific primer of the tlh genetic fragments of amplification vibrio parahemolyticus
ID NO.2, the mass spectrogram peaks of amplified production are 33708Da；
SEQ ID NO.3 and SEQ the ID NO.4 of the specific primer of the tdh genetic fragments of vibrio parahemolyticus are expanded,
The mass spectrogram peaks of its amplified production are 37250Da；
SEQ ID NO.5 and SEQ the ID NO.6 of the specific primer of the trh genetic fragments of vibrio parahemolyticus are expanded,
The mass spectrogram peaks of its amplified production are 42702Da.
In any of the above-described embodiment, wherein containing in the 30 μ l of reaction system of the PCR amplification：
In a preferred embodiment, wherein the concentration of every group of primer pair is controlled between 10-20 μM.
In another preferred embodiment of the present, wherein being in pcr amplification reaction program：95 DEG C of pre-degeneration 5min, 95 DEG C of denaturation
30s, 56 DEG C of annealing 30s, 72 DEG C of extension 30s, carries out 45 Xun Huans, last 72 DEG C of extensions 5min.
In any of the above-described embodiment, wherein the MALDI-TOF MS detection used in point sample matrix in contain
There is formic acid.In a specific embodiment, the composition of point sample matrix used in MALDI-TOF MS detections is,
3-HPA: DHC: formic acid=4: 2: 1.
In any of the above-described embodiment, this method can as the application of non-diagnostic purpose, be widely used in environmental sanitation,
The vibrio parahemolyticus parting in the fields such as food safety detection, public place safety, inlet and outlet inspection and quarantine is identified, with dimension
Protect public health security.
4th purpose of the invention is to provide a kind of multiple PCR products as above-mentioned Mass Spectrometric Identification vibrio parahemolyticus parting
Vibrio parahemolyticus fingerprint databases preparation method, include the following steps：
(1) plasmid of vibrio parahemolyticus DNA fragmentation conserved sequence is synthesized, and designs its corresponding specific primer；
Wherein, conserved sequence is respectively selected from tlh segments (SEQ ID NO.7), the tdh segments of vibrio parahemolyticus DNA
(SEQ ID NO.8), trh segments (SEQ ID NO.9), the specific primer sequence of the segment is respectively selected from：SEQ ID
NO.1 and SEQ ID NO.2, SEQ ID NO.3 and SEQ ID NO.4, SEQ ID NO.5 and SEQ ID NO.6；
(2) multiplex amplification is carried out to genomic DNA with the primer combination in step (1)；
(3) PCR product is detected, checks PCR amplification quality；
(4) multiple PCR products are purified using DNA adsorption columns；
(5) purified product forms crystalline mixture with matrix, and point sample is on chip；
(6) mass spectrograph detects, and obtains the nucleic acids characteristic finger-print of different vibrio parahemolyticus；
(7) the nucleic acid fingerprint characteristic collection of illustrative plates for the different separation strains for obtaining step (6), is summarized by computer software
And arrangement, obtain the standard nucleic acid fingerprint characteristic collection of illustrative plates of vibrio parahemolyticus.
In one embodiment, PCR reacts expanded bacterial nucleic acid sequences, including but not limited to parahemolyticas arc
A region on bacterium DNA genomes.
In a specific embodiment, the solid support of the DNA adsorption columns include but not limited to gel, resin,
Tripoli, silica gel, magnetic bead, glass dust, bead etc..In a specific embodiment, the matrix is to contain acid ingredient
Composite interstitial substance, the acid ingredient include but not limited to formic acid, acetic acid and citric acid.In another specific embodiment, institute
Chip is stated as the special micro-array chip of flight time mass spectrum, material includes but not limited to stainless steel, diamond, monocrystalline silicon, stone
English crystal.
In a specific embodiment, the mass spectrograph is MALDI TOF MS mass spectrographs.
In any of the above-described scheme, the vibrio parahemolyticus includes but not limited to O1 groups and O139 groups.
In one embodiment, the software is the BioExplore softwares that inventor voluntarily researchs and develops, copyright
Number for it is soft work step on word the 136879th, registration number 2009SR10700.
Technique effect
1st, the present invention is based on mass spectrum detection, due to the high sensitivity of Mass Spectrometer Method, using this programme to parahemolyticas
The Monitoring lower-cut of vibrios presence or absence can be far beyond other technologies scheme.
2nd, nucleic acid amplification product can carry out Mass Spectrometer Method after purification, compared with the prior art, overall process only a few hours
Interior completion, easy to operate, high specificity, as a result accurately, flux are high.
3rd, the detection that the present invention is implemented is completed in same PCR system, has saved sample DNA and PCR amplification system
In each reagent, particularly Taq usage amount, greatly reduce testing cost, can be widely applied to clinical a variety of infectiousness diseases
The quick diagnosis of disease.
4th, for different samples, the present invention can compare the nucleic acid fingerprint spectrum that they are generated, and will test the nucleic acid of generation
The collection of illustrative plates of finger-print and vibrio parahemolyticus reference culture in database is compared, and through bioinformatic analysis, can be sentenced
Whether the disconnected bacterium is vibrio parahemolyticus separation strains.
5th, the classification and identification of vibrio parahemolyticus can be rapidly and accurately carried out using this programme, and available for clinical inspection
Test etc., avoid clinically because diagnose not in time due to delay treatment.
6th, the vibrio parahemolyticus parting in the fields such as environmental sanitation, public place can be identified using the present invention, with
Safeguard public health security.
7th, database of the invention is open, and new separation strains, constantly improve and expansion database can be continuously replenished,
So as to the more accurate identification for completing vibrio parahemolyticus.
Description of the drawings
Fig. 1：The Multina electrophoretic bands of vibrio parahemolyticus nucleic acid fragment multiple PCR products.
Fig. 2：The MALDI-TOF MS test maps of vibrio parahemolyticus nucleic acid fragment multiple PCR products.
Specific embodiment
In order to further appreciate that the technical characteristic of the present invention, detailed explain is carried out to the present invention with reference to specific embodiment
It states.Embodiment only has the present invention illustrative effect, without the effect of any restrictions, those skilled in the art
The modification of any unsubstantiality is made on the basis of the present invention, should all be belonged to the scope of protection of the present invention.
Unless otherwise specified, the conventional means that technological means used in embodiment is well known to those skilled in the art.
Embodiment 1：The foundation of vibrio parahemolyticus nucleic acid fingerprint spectrum.
1st, sequences match
By retrieving ncbi database, the conserved sequence of vibrio parahemolyticus DNA is respectively selected from tlh segments,>
JQ929914.1Vibrio parahaemolyticus strain C1Tlh (tlh) gene, partial cds, sequence are
SEQ ID NO.7：
ACGAAAGCGCCTCAGTTTAAGTACTCAACACAAGAAGAGATCGACAAAATTCGTGCGAAAGTGCTTGAGATGAACGA GTTCATCAAGGCACAAGCGATGTACTACAAAGCGCAAGGTTACAACATCACGTTGTTTGATACTCACGCCTTGTTCG
AGACGCTAACTTCTGCGCCAGAAGAGCACGGTTTCGTGAACG；
Tdh segments,>JX453039.1Vibrio parahaemolyticus strain J-M2-8a
Thermostable direct hemolysin (tdh) gene, partial cds, sequence are SEQ ID NO.8：
TGTAAAGGTCTCTGACTTTTGGACAAACCGTAATGTAAAAAGAAAACCGTACAAAGATGTTTATGGTCA
ATCAGTATTCACAACGTCTGGTACTAAATGGCTGACATCCTACATGACTGTGAACATTAATGATAAAGACTATACAA
TGGCAGCGGTGTCTGGCTATAAGCACGGTCATTCTGCTGTGTTCGTAAAATCAGATCAAGTACAG
Trh segments>AY742213.1Vibrio parahaemolyticus isolate VP8 thermostable
Direct haemolysin-related haemolysin (trh) gene, complete cds, sequence are SEQ ID
NO.9：
TACACATAACAAACATATGCCCATTTCCGCTCTCATATGCTTCGACATTGACGAAATATTCTGGCGTTT
CATCCAAATACGTTACACTTGGCAATGATTCTTCATTTTCACCAACGAAATCACTAACAGAAGAATAGTTCTGATTT
AGGCTTGTTTTTTCTGATTTTGTGAAGACCGTTGAAAGGCCATCTTTATAGCCAGAAAG
2nd, design of primers
3 pairs of specific primers are designed to vibrio parahemolyticus, are all synthesized by Shanghai Jierui Biology Engineering Co., Ltd：
| Number | Primer (5' → 3') |
| SEQ ID No：1 | ACGTTGGATGGAACGAGTTCATCAAGGCAC |
| SEQ ID No：2 | ACGTTGGATGTCTTCTGGCGCAGAAGTTAG |
| SEQ ID No：3 | ACGTTGGATGCGTCTGGTACTAAATGGCTG |
| SEQ ID No：4 | ACGTTGGATGACGAACACAGCAGAATGACC |
| SEQ ID No：5 | ACGTTGGATGCCAAATACGTTACACTTGGC |
| SEQ ID No：6 | ACGTTGGATGATGGCCTTTCAACGGTCTTC |
3rd, PCR amplification：
(1) PCR reaction systems：
(2) amplified reaction program：95 DEG C of pre-degenerations 5min, 95 DEG C of denaturation 30s, 56 DEG C of annealing 30s, 72 DEG C of extension 30s, into
45 Xun Huans of row, last 72 DEG C of extensions 5min.
4th, Multina electrophoresis detections：PCR product is detected using the Multina electrophoresis apparatuses of Shimadzu, is amplified
The expression of tri- band of 128bp, 129bp and 137bp expands successfully (Fig. 1).
5th, multiple PCR products purify：(1) according to DNA Binding Buffer：PCR product=5：1 volume ratio is toward PCR
Mixing after addition Binding Buffer in product；(2) above-mentioned mixed liquor is transferred to adsorption column, adsorption column in collecting pipe,
10,000g centrifugation 30s, discard waste liquid；(3) plus 200 μ L DNA Wash Buffer are in adsorption column, 10,000g centrifugation 30s,
Repeat the washing 1 time；(4) ddH of >=6 μ L is added2O is transferred to new 1.5mL centrifuge tubes in adsorption column after being placed at room temperature for 1min
In 10,000g centrifugation 30s, obtain product after purification.
6th, chip point sample：(1) a special micro-array chip of flight time mass spectrum is taken with tweezers, puts down gently and be placed on target holder；
(2) according to sampfe order successively point sample, each sample 0.5-1.0 μ L；(3) room temperature is dried (10-15min) or is used and adds
Hot device heat drying.
7th, Mass Spectrometer Method：Peak-to-peak signal is detected using Clin-ToF II (MALDI-TOF principles) mass spectrograph, referring to Fig. 2.
8th, testing result is analyzed using flight time mass spectrum signal processing system (MALDI MS).
As a result as shown in Fig. 2 and analysis result, mass-spectrogram detects spy at 33708Da, 37250Da and 42702Da
Peak value is levied, respectively tlh segments, tdh segments, the trh segments of characterization amplification vibrio parahemolyticus.Three feature peak bases are put down
Sliding, abundance is big, and signal-to-noise ratio is high, and separating degree is high between adjacent signals peak, graph-spectrum quality be improved significantly, be capable of providing more
Information helps to improve the accuracy and repeatability of qualification result.
Claims (8)
1. a kind of vibrio parahemolyticus fingerprint databases of the multiple PCR products as Mass Spectrometric Identification vibrio parahemolyticus parting
Preparation method includes the following steps：
(1) plasmid of vibrio parahemolyticus DNA fragmentation conserved sequence is synthesized, and designs its corresponding specific primer；
Wherein, conserved sequence is respectively selected from the tlh segments (SEQ ID NO.7) of vibrio parahemolyticus DNA, tdh segments (SEQ ID
NO.8), trh segments (SEQ ID NO.9), the specific primer sequence of the segment is respectively selected from：SEQ ID NO.1 and SEQ
ID NO.2, SEQ ID NO.3 and SEQ ID NO.4, SEQ ID NO.5 and SEQ ID NO.6；
(2) multiplex amplification is carried out to genomic DNA with the primer combination in step (1)；
(3) PCR product is detected, checks PCR amplification quality；
(4) multiple PCR products are purified using DNA adsorption columns；
(5) purified product forms crystalline mixture with matrix, and point sample is on chip；
(6) detected by MALDI TOF mass spectrographs, obtain the nucleic acids characteristic finger-print of different vibrio parahemolyticus；
(7) the nucleic acid fingerprint characteristic collection of illustrative plates for the different separation strains for obtaining step (6), by computer software summarized with it is whole
Reason, obtains the standard nucleic acid fingerprint characteristic collection of illustrative plates of vibrio parahemolyticus.
2. the preparation method of claim 1, wherein PCR react expanded bacterial nucleic acid sequences, including but not limited to secondary molten
A region on courageous and upright vibrios DNA genomes.
3. the method for claim 1 or 2, wherein the solid support of the DNA adsorption columns include but not limited to gel, resin,
Tripoli, silica gel, magnetic bead, glass dust, bead etc..
4. the method for claim 3, wherein the matrix is the composite interstitial substance containing acid ingredient, which is included but not
It is limited to formic acid, acetic acid and citric acid.
5. the method for claim 1 or 2, wherein the chip is the special micro-array chip of flight time mass spectrum, material includes
But it is not limited to stainless steel, diamond, monocrystalline silicon, quartz crystal.
6. the method for claim 1-5, wherein the mass spectrograph is MALDI TOF MS mass spectrographs.
7. the method for claim 1-6, wherein the vibrio parahemolyticus includes but not limited to O1 groups and O139 groups.
8. the method for claim 1-7, wherein the software is BioExplore softwares, copyright number steps on word for soft work
No. 136879, registration number 2009SR10700.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810003772.9A CN108103171B (en) | 2018-01-03 | 2018-01-03 | Preparation method of vibrio parahaemolyticus fingerprint atlas database |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810003772.9A CN108103171B (en) | 2018-01-03 | 2018-01-03 | Preparation method of vibrio parahaemolyticus fingerprint atlas database |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108103171A true CN108103171A (en) | 2018-06-01 |
| CN108103171B CN108103171B (en) | 2021-05-21 |
Family
ID=62219438
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810003772.9A Active CN108103171B (en) | 2018-01-03 | 2018-01-03 | Preparation method of vibrio parahaemolyticus fingerprint atlas database |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108103171B (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102808223A (en) * | 2012-08-02 | 2012-12-05 | 向华 | Nucleic acid fingerprint feature spectrum database of mycobacterium tuberculosis and usage of nucleic acid fingerprint feature spectrum database |
| WO2015190107A1 (en) * | 2014-06-11 | 2015-12-17 | 東洋製罐グループホールディングス株式会社 | Method for detecting vibrio parahaemolyticus, and carrier for detecting vibrio parahaemolyticus |
-
2018
- 2018-01-03 CN CN201810003772.9A patent/CN108103171B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102808223A (en) * | 2012-08-02 | 2012-12-05 | 向华 | Nucleic acid fingerprint feature spectrum database of mycobacterium tuberculosis and usage of nucleic acid fingerprint feature spectrum database |
| WO2015190107A1 (en) * | 2014-06-11 | 2015-12-17 | 東洋製罐グループホールディングス株式会社 | Method for detecting vibrio parahaemolyticus, and carrier for detecting vibrio parahaemolyticus |
Non-Patent Citations (4)
| Title |
|---|
| GUANHUA XUAN等: "Strain-level visualized analysis of cold-stressed Vibrio parahaemolyticus based on MALDI-TOF mass fingerprinting", 《MICROBIAL PATHOGENESIS》 * |
| 刘伟等: "对引起食物中毒的副溶血性弧菌的PCR毒力基因检测和PFGE 同源性分析", 《中国卫生检验杂志》 * |
| 孙永等: "2015年安徽地区副溶血性弧菌生物学特征及分子分型溯源分析", 《中国病原生物学杂志》 * |
| 裘丹红等: "2008 年－2010年台州市食源性副溶血性弧菌分子特征研究", 《中国卫生检验杂志》 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108103171B (en) | 2021-05-21 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Gaia et al. | Rapid identification of Legionella spp. by MALDI-TOF MS based protein mass fingerprinting | |
| CN111876524A (en) | Primer, probe combination and kit for detecting 34 respiratory pathogenic microorganisms based on multiple PCR-time-of-flight mass spectrometry | |
| CN112094948B (en) | Application of target gene combination in African swine fever virus detection and kit | |
| CN102803512A (en) | Methods and kits for detecting pathogens of respiratory tract | |
| CN107034316B (en) | System for simultaneously detecting 6 porcine viruses and LAMP primer special for system | |
| CN110669870A (en) | Real-time fluorescent quantitative RT-PCR (reverse transcription-polymerase chain reaction) detection primer, probe and detection kit for serotype of Palima serogroup virus | |
| CN113718045A (en) | DNA fragment, primer, probe and kit for detecting 4 kinds of Bordetella pertussis and specifically detecting Bordetella pertussis and application | |
| CN113817871B (en) | Coronavirus detection method and kit | |
| CN103210093B (en) | Method for detecting digestive tract pathogens | |
| CN102851362B (en) | Method for quickly identifying Brucella based on mass spectrum technology and application thereof | |
| CN107988341B (en) | The method and product of Mass Spectrometric Identification Typing of Vibrio Cholerae | |
| CN107988342A (en) | The method and product of Mass Spectrometric Identification vibrio parahemolyticus parting | |
| WO2022247284A1 (en) | Detection product for detecting reproductive tract pathogens using maldi-tof ms, and use thereof | |
| CN110804677A (en) | Nested duplex PCR (polymerase chain reaction) detection primer and kit for distinguishing African swine fever virus wild strain and gene deletion strain | |
| CN113355456B (en) | Preparation method of nucleic acid fingerprint spectrum library for detecting genital tract pathogens by MALDI TOF-MS | |
| CN113215322B (en) | Primer composition for detecting genital tract pathogen by MALDI-TOF MS and application | |
| CN113151608B (en) | PCR target sequence, primer and probe for detecting infectious SARS-CoV-2 and application | |
| CN108103171A (en) | The preparation method of vibrio parahemolyticus fingerprint databases | |
| CN107988402A (en) | The kit of Mass Spectrometric Identification vibrio parahemolyticus parting | |
| CN108034770A (en) | Method of mass spectrography detection influenza A virus H7N9 multiple PCR products and products thereof | |
| CN107988403A (en) | The kit of the multiple PCR products of Mass Spectrometric Identification Typing of Vibrio Cholerae | |
| CN108048540A (en) | The method for preparing the fingerprint databases of detection Typing of Vibrio Cholerae | |
| CN102808223B (en) | Nucleic acid fingerprint feature spectrum database of mycobacterium tuberculosis and usage of nucleic acid fingerprint feature spectrum database | |
| CN102827930B (en) | Method for building helicobacter pylori nucleic acid fingerprint spectrum and product thereof | |
| CN107312869B (en) | Kit for detecting silkworm microsporidian by PCR-ELISA method and detection method thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |