CN107988403A - The kit of the multiple PCR products of Mass Spectrometric Identification Typing of Vibrio Cholerae - Google Patents
The kit of the multiple PCR products of Mass Spectrometric Identification Typing of Vibrio Cholerae Download PDFInfo
- Publication number
- CN107988403A CN107988403A CN201810003358.8A CN201810003358A CN107988403A CN 107988403 A CN107988403 A CN 107988403A CN 201810003358 A CN201810003358 A CN 201810003358A CN 107988403 A CN107988403 A CN 107988403A
- Authority
- CN
- China
- Prior art keywords
- kit
- seq
- mass spectrum
- comma bacillus
- primer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/16—Primer sets for multiplex assays
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Abstract
The invention discloses a kind of kit for the multiple PCR products for identifying Typing of Vibrio Cholerae, including for expanding the ctxA fragments of comma bacillus, ctxB fragments, the specific primer of ompW fragments, the special point sample matrix of mass spectrum, the special micro-array chip of mass spectrum, mass spectrum internal standard standard items, mass spectrum external standard standard items.The kit of the present invention is by the way that nucleic acid fingerprint characteristic collection of illustrative plates is compared with the nucleic acid fingerprint spectrum of comma bacillus in storehouse by obtained by, so as to judge the kind of tested bacteria.Based on mass spectrum peak figure caused by the kit, the comma bacillus in measuring samples can be classified and be identified, as a result can be widely used in parting and the classification of comma bacillus, and the field such as environmental sanitation and public safety quarantine.
Description
Technical field
The invention belongs to molecular Biological Detection field, is related to one kind and utilizes ionization time of flight Rapid identification cholera
The product of vibrios.
Background technology
Cholera is a kind of strong infection caused by comma bacillus (Vibrio cholerae) using diarrhea as cardinal symptom
Disease, category A infectious disease is listed in China.Comma bacillus enters alimentary canal and reaches small intestine, simultaneously rapid numerous in intestinal mucosa adsorption
Grow, the cholera enterotoxin of generation acts on small intestinal mucosa, causes intestinal fluid excessive secretion.Severe patient suffers from vomiting and diarrhoea, and causes
Dehydration and metabolic acidosis, circulatory failure, or even produce shock and death.Inspection except clinically needing reinforcement comma bacillus
Outside survey, in food security (such as meat products processing, barbecue), environmental sanitation (the logistics place of such as organ of school), inlet and outlet
Inspection and quarantine, public place secure context are also required to carry out Classification Identification to comma bacillus, to safeguard public health security.
Research finds that comma bacillus is Gram-negative bacteria, is divided into 139 sero-groups, and wherein O1 groups and O139 groups can draw
Play cholera.The virulence factor of comma bacillus mainly has CTX Genetic elements (ctx gene codes cholera enterotoxin therein), TCP to cause
3 kinds of sick island (coding TCP pili) and toxR (virulence adjusts gene, the gene of regulation and control coding CT and TCP).Cholera enterotoxin
(cholera toxin, CT) is also referred to as cholera toxin, is a kind of exotoxin, has very strong antigenicity, and cholera toxin gene
(ctx) conservative is at a relatively high.
In order to prevent the generation of cholera and prevalence, take measures rapidly, effectively control the developmenting spread of epidemic situation, comma bacillus
Quick detection it is particularly important that.For a long time, the identification to comma bacillus all uses traditional microbiological test method, i.e. shape
State, physiological and biochemical property and serological Identification.Although the method accuracy is high, required time is too long, wants more than ten at the soonest
It could complete within a hour, it is difficult to adapt to the requirement quickly detected.Nucleic acid detection method based on multiplex PCR, to cholera
Early diagnosis and the discovery of the infection sources are of great significance.And multiplex PCR detection is directed to multiple genes, false negative rate compares substance
PCR is reduced.
Matrix-assisted laser desorption ionization (matrix-assisted laser desorption/
Ionization time-of-flight mass spectrometry, abbreviation MALDI-TOF MS) technology is 20th century 80
A kind of analytical technique of mass spectrum that age Mo comes out and develops rapidly.Its mass analyzer is an ion drift tube (ion
Dirft tube), the ion produced by ion gun is collected first, and all ion velocities are changed into 0 in collector, use one
Impulse electric field enters field-free drift pipe after accelerating, and flies to ion acceptor with constant speed, and mass of ion is bigger, reaches and receives
The time is longer used in device；Mass of ion is smaller, and it is shorter to reach the time used in receiver., can be not homogeneity according to this principle
The ion of amount is separated by mass-to-charge ratio size, accurately detects the molecule of the large biological molecules such as polypeptide, protein, nucleic acid, polysaccharide
Quality and purity, have the advantages that accuracy is high, flexibility is strong, flux is big, detection cycle is short, cost-effective.
In recent years, there is mass-spectrometric technique to detect nucleic acid and protein field, wherein mass-spectrometric technique is applied to nucleic acid
The theoretical foundation of detection field is, forms the elementary cell of hereditary material DNA --- there are of poor quality between four kinds of nucleotide
It is different, as the molecular weight of ddAMP, ddCMP, ddGMP, ddTMP are followed successively by 271.2Da, 247.2Da, 287.2Da, 327.1Da (its
Middle ddTMP is by modification), minimum molecular weight difference between them can be differentiated by mass spectrum in 16Da completely.
Using mass spectrum can to base mutation or polymorphic site (SNP), insertion/deletion (InDel), methylation sites, gene quantification, copy
A variety of DNA change types such as shellfish number change (copy number variation, CNV) are detected.
Some existing open source literatures are classified and are identified to microorganism using mass-spectrometric technique, for example, Chinese patent application
CN102337223A, " penicillium chrysogenum antifungal protein Pc-Arctin and preparation method thereof ", discloses a kind of detection penicillium chrysogenum
The MALDI-TOF identification methods of antifungal protein Pc-Arctin, wherein from tablet picking penicillium chrysogenum A096 spore inoculatings in
SGY fluid nutrient medium cultures, pretreatment obtain crude protein solution and isolate and purify on a column, and in carboxymethyl cation exchange
Isolated and purified in chromatographic column, collect each elution fraction, each component centrifugal ultrafiltration is concentrated into required volume, using paecilomyces varioti to be quick
Impression examination indicator bacteria, follows the trail of antifungal activity component, and definite active ingredient judges to obtain the purity of albumen；Extract SDS-PAGE
Single band on electrophoretogram, carries out MALDI-TOF identifications.This method is only applicable to specified microorganisms, and needs multiplexed protein
Purge process, finally uses MALDI-TOF identification mark albumen Pc-Arctin, its process is cumbersome, and applicable surface is narrow, it is impossible to realizes matter
Spectrum classification bacterium or the purpose of microorganism.
Chinese patent application 201110154723, " the single method for increasing listeria spp of MALDI TOF MS auxiliary identifications " and
201110154469th, " method of MALDI TOF MS auxiliary identification comma bacillus " discloses one kind and utilizes MALDI TOF MS skills
The method of art auxiliary identification bacterium, including：Bacterial cultures is pre-processed, gathers the MALDI TOF MS figures of all bacterial strain samples
Spectrum, is prepared bacterium standard diagram according to software, is detected using identical method and gather the collection of illustrative plates of tested bacteria, and compare two
Person's collection of illustrative plates, is judged according to matching fraction.Since this method uses conventional processing (to pass through absolute ethyl alcohol, formic acid and acetonitrile
Processing, and it is aided with centrifugation, last Aspirate supernatant is detected), although it can characterize the feature of the bacterium to a certain extent
Collection of illustrative plates, but due to containing protein, lipid, lipopolysaccharides and fat oligosaccharides, DNA, polypeptide in its determinand and other can be ionized
Molecule, its obtained collection of illustrative plates is substantially the collection of illustrative plates set of above-mentioned various molecules, therefore both needs the collection of illustrative plates for handling and comparing
Information content is excessive, and causes its TuPu method relatively low because molecule to be checked is excessively huge, be only applicable to certain specific bacterium and
It can not be generalized in other substantial amounts of Bacteria Detections.
Chinese patent application 201210272533.6 " method for establishing helicobacter pylori nucleic acid fingerprint spectrum and products thereof ",
Disclose a kind of method based on mass-spectrometric technique Rapid identification helicobacter pylori, including PCR amplification, SAP enzymic digestions, transcription and core
Sour digestion, purifying, mass spectrograph detection and etc..This method utilizes ionization time of flight, different to molecular weight and abundance
Nucleic acid fragment is detected, and forms spectrogram.But this method center acid fragment also needs to disappear by SAP enzymes after PCR amplification
Change, transcription and nucleic acid digestion, are only capable of identifying the change of single base, can not detect the DNA long fragment of characteristic sequence.
In addition, being based on MALDI-TOF MS, develop some nucleic acid detection methods, as Agena companies of the U.S. hME and
IPLEX methods, the GOOD assay methods of German Bruker companies, the RFMP methods of GeneMatrix companies of South Korea.Each company
In order to improve mass spectrometric resolution ratio, target site is detected and tends to the less oligonucleotide fragment of detection molecules amount,
If RFMP methods are by carrying out the multiple PCR products containing single nucleotide polymorphism (SNP) site restricted digestion, generation 2000
The oligonucleotide fragment of~4000Da or so is detected, and GOOD assay methods pass through phosphodiesterase
Oligonucleotide fragment containing SNP site is cut into the small pieces of 1000~2000Da or so by (Phosphodiesterase, PDE)
Section is detected.However, above method, complicated, the problems such as time-consuming is all inevitably present.
In addition, ([J] .PLoS One, 2007,2 (5) such as U.S. Sampath:E489) report RT-PCR and electron spray
Technology (the reverse transcription PCR/electrospray-ionization mass that chromatography is combined
Spectrometry, RT-PCR/ESI-MS).This method can quickly detect 92 kinds of mammals and birds influenza separation strains,
It is inferred to 30 kinds of different H and N-type is viral (including 29 kinds of AIV H5N1 separation strains), accuracy rate is up to 97%, and the time is only
Want short a few houres.The technology can detect the viral sample of mixed infection and available for each hypotype and unknown of virus at the same time
The extensive detection of the new variant of nucleotide sequence virus.But the mass spectrograph needed for the technology is expensive, is also confined at present
Used in a small number of research institutions.
Chinese patent application 200880121570, denomination of invention " are used for the method and biology for diagnosing and monitoring mental illness
Marker ", which reports, to detect nearly hundred kinds and mental illness including influenza virus by MALDI-TOF mass-spectrometric techniques
Relevant biology peptide.However, this method only various possible technologies of simplified summary, its both without report concrete scheme,
The specific target spot of influenza virus is not reported, therefore, it is difficult to instruct researcher to pass through MALDI-TOF mass-spectrometric techniques to detect influenza
Virus.
Therefore, it is quick, accurate, cheap, easily to realize to need identification and the analysis method of new comma bacillus at present
Classification results.The present invention multiplex PCR is combined with ionization time of flight, after multiple PCR products are purified can directly into
Row Mass Spectrometer Method, overcomes the probability of multitube increase pollution, simplifies operation, shortens detection time, high specificity, detection spirit
Sensitivity is far above traditional bacteria distribution culture and serological Identification, suitable for the detection of high-volume sample, has in clinic wide
Wealthy application prospect.
The content of the invention
The principle of the invention is：Form hereditary material DNA elementary cell --- there are of poor quality between four kinds of nucleotide
It is different, after certain several fragment carries out multiplex PCRs on cholera vibrio gene group DNA, molecular weight and the different fragment of abundance will be produced,
Nucleic acid fingerprint spectrum can be produced using Mass Spectrometer Method, and the genomic DNA between the different serotypes of comma bacillus has differences, will
Produce different nucleic acid fingerprint spectrums.After establishing database, by comma bacillus standard diagram information in experimental result and database
It is compared, you can complete identification to comma bacillus, parting, classification etc..The method has a high specificity, high sensitivity, into
This is low, easy to operate, the advantages such as the used time is few.
One of principle of the invention is, since the genomic DNA between the different serotypes of comma bacillus has differences, leads
Causing the nucleotide composition of gene, there are quality difference between i.e. four kinds of nucleotide there are nuance.Therefore by MALDI-TOF matter
Spectrum is combined with multiplex PCR, by optimizing multiplex PCR system, after obtaining target spot amplified production, you can directly carry out amplified production
MALDI-TOF MS are detected.More specifically, this method specifically expands multiple few nucleosides of different sizes using multiplex PCR
Acid fragment, the different nucleic acid fingerprint spectrums generated using different oligonucleotide fragments during mass spectrum parting, establishes number
Behind storehouse, experimental result is compared with comma bacillus standard diagram information in database, you can complete to comma bacillus
Identification, parting, classification etc..The method has high specificity, and high sensitivity, cost is low, easy to operate, the advantages such as the used time is few.
The two of the principle of the invention are, during multiplex PCR system optimization, by being carried out to the complete sequence of target nucleic acid
Analysis, chooses conserved sequence design primer and carries out multiplexed PCR amplification, and primer is improved for PCR amplification result, most
It is selected for the effective primer sequence of specific amplification eventually；In order to distinguish PCR product similar in size, not shadow is introduced in primer
Ring the tag sequences of PCR amplification；By multiple PCR products it is purified after directly progress MALDI-TOF MS analyses, so as to successfully realize
The quick detection of target nucleic acid.
Therefore, an object of the present disclosure is to provide the primer combination of the multiple PCR products for identifying Typing of Vibrio Cholerae,
Wherein primer combination includes,
The primer is SEQ ID NO.1 and the SEQ ID of the specific primer of the ctxA fragments of amplification comma bacillus
NO.2, the mass spectrogram peaks of its amplified production are 22115Da；
SEQ ID NO.3 and SEQ the ID NO.4 of the specific primer of the ctxB fragments of comma bacillus are expanded, it expands production
The mass spectrogram peaks of thing are 30010Da；
SEQ ID NO.5 and SEQ the ID NO.6 of the specific primer of the ompW fragments of comma bacillus are expanded, it expands production
The mass spectrogram peaks of thing are 34874Da.
In any of the above-described embodiment, wherein the primer sets, which are closed, can add tag sequences as needed, produce multiplex PCR
Thing is sized to easily be distinguished by MALDI-TOF MS.In a specific embodiment, the tag sequences are
ACGTTGGATG。
Second purpose of the invention is to provide for above-mentioned mass spectrography (MALDI-TOF MS) identification Typing of Vibrio Cholerae
The mass spectrometry kit of multiple PCR products, the wherein kit include it is above-mentioned be used for expand above-mentioned viral specific primer sets,
The special point sample matrix of mass spectrum.
In one embodiment, the composition of the point sample matrix is 3-HPA: DHC: formic acid=4: 2: 1.
In another embodiment, the primer is the SEQ ID of the specific primer of the ctxA fragments of amplification comma bacillus
NO.1 and SEQ ID NO.2, the mass spectrogram peaks of its amplified production are 22115Da；
SEQ ID NO.3 and SEQ the ID NO.4 of the specific primer of the ctxB fragments of comma bacillus are expanded, it expands production
The mass spectrogram peaks of thing are 30010Da；
SEQ ID NO.5 and SEQ the ID NO.6 of the specific primer of the ompW fragments of comma bacillus are expanded, it expands production
The mass spectrogram peaks of thing are 34874Da.
In any of the above-described embodiment, wherein the primer sets, which are closed, can add tag sequences as needed, produce multiplex PCR
Thing is sized to easily be distinguished by MALDI-TOF MS.In a specific embodiment, the tag sequences are
ACGTTGGATG。
In any of the above-described embodiment, wherein containing in the 30 μ l of reaction system of the PCR amplification：
In a preferred embodiment, wherein the concentration of every group of primer pair is controlled between 10-20 μM.
In another preferred embodiment of the present, wherein being in pcr amplification reaction program：94-95 DEG C of pre-degeneration 5min；94-95
DEG C denaturation 30s, 55-60 DEG C annealing 30s, 72-75 DEG C extension 40-60s, carry out 35-45 circulate；Then, 72-75 DEG C of extension
5min。
In any of the above-described embodiment, the kit further includes the special micro-array chip of mass spectrum, mass spectrum internal standard standard
Product, mass spectrum external standard standard items.
In one embodiment, the nucleic acid fingerprint characteristic for comparative analysis isolated strains is also included in the kit
The software of collection of illustrative plates.In in a preferred embodiment, the software is that the BioExplore that inventor voluntarily researchs and develops is soft
Part, its copyright number step on word the 136879th, registration number 2009SR10700 for soft work.
Third object of the present invention is to provide a kind of method for identifying Typing of Vibrio Cholerae, and step includes
Multiplexed PCR amplification is carried out to the characteristic fragment of comma bacillus to be measured using specific primer combination；
Multiple PCR products are purified by adsorption column；
By multiple PCR products point sample after purification in matrix crystallization, pass through the fragments of Mass Spectrometer Method multiple PCR products
Size；
By mass spectral results compared with comma bacillus fingerprint databases, to determine the specific parting of comma bacillus to be checked；
Wherein,
The primer is SEQ ID NO.1 and the SEQ ID of the specific primer of the ctxA fragments of amplification comma bacillus
NO.2, the mass spectrogram peaks of its amplified production are 22115Da；
SEQ ID NO.3 and SEQ the ID NO.4 of the specific primer of the ctxB fragments of comma bacillus are expanded, it expands production
The mass spectrogram peaks of thing are 30010Da；
SEQ ID NO.5 and SEQ the ID NO.6 of the specific primer of the ompW fragments of comma bacillus are expanded, it expands production
The mass spectrogram peaks of thing are 34874Da.
In any of the above-described embodiment, the comma bacillus is O1 groups and/or O139 groups.
In any of the above-described embodiment, wherein containing in the 30 μ l of reaction system of the PCR amplification：
In a preferred embodiment, wherein the concentration of every group of primer pair is controlled between 10-20 μM.
In another preferred embodiment of the present, wherein being in pcr amplification reaction program：95 DEG C of pre-degeneration 5min, 95 DEG C of denaturation
30s, 56 DEG C of annealing 30s, 72 DEG C of extension 30s, carries out 45 circulations, last 72 DEG C of extensions 5min.
In any of the above-described embodiment, wherein the MALDI-TOF MS detection used in point sample matrix in contain
There is formic acid.In a specific embodiment, the composition of point sample matrix used in MALDI-TOF MS detections is,
3-HPA: DHC: formic acid=4: 2: 1.
In any of the above-described embodiment, this method can as the application of non-diagnostic purpose, be widely used in environmental sanitation,
The Typing of Vibrio Cholerae in the fields such as food safety detection, public place safety, inlet and outlet inspection and quarantine is identified, to safeguard public affairs
It is safe and healthy altogether.
4th purpose of the invention is to provide a kind of multiple PCR products as above-mentioned Mass Spectrometric Identification Typing of Vibrio Cholerae suddenly
The preparation method of random vibrios fingerprint databases, includes the following steps：
(1) plasmid of comma bacillus DNA fragmentation conserved sequence is synthesized, and designs its corresponding specific primer；
Wherein, conserved sequence is respectively selected from the ctxA fragments (SEQ ID NO.7) of comma bacillus DNA, ctxB fragments (SEQ
ID NO.8), ompW fragments (SEQ ID NO.9), the specific primer sequence of the fragment is respectively selected from：SEQ ID NO.1 and
SEQ ID NO.2, SEQ ID NO.3 and SEQ ID NO.4, SEQ ID NO.5 and SEQ ID NO.6；
(2) multiplex amplification is carried out to genomic DNA with the primer combination in step (1)；
(3) PCR product is detected, checks PCR amplification quality；
(4) multiple PCR products are purified using DNA adsorption columns；
(5) purified product forms crystalline mixture with matrix, and point sample is on chip；
(6) mass spectrograph detects, and obtains the nucleic acids characteristic finger-print of different comma bacillus；
(7) the nucleic acid fingerprint characteristic collection of illustrative plates for the different separation strains for obtaining step (6), is collected by computer software
And arrangement, obtain the standard nucleic acid fingerprint characteristic collection of illustrative plates of comma bacillus.
In one embodiment, PCR reacts expanded bacterial nucleic acid sequences, including but not limited to comma bacillus
A region on DNA genomes.
In a specific embodiment, the solid support of the DNA adsorption columns include but not limited to gel, resin,
Tripoli, silica gel, magnetic bead, glass dust, bead etc..In a specific embodiment, the matrix is to contain acid ingredient
Composite interstitial substance, the acid ingredient include but not limited to formic acid, acetic acid and citric acid.In another specific embodiment, institute
It is the special micro-array chip of flight time mass spectrum to state chip, its material includes but not limited to stainless steel, diamond, monocrystalline silicon, stone
English crystal.
In a specific embodiment, the mass spectrograph is MALDI TOF MS mass spectrographs.
In any of the above-described scheme, the comma bacillus includes but not limited to O1 groups and O139 groups.
In one embodiment, the software is the BioExplore softwares that inventor voluntarily researchs and develops, its copyright
Number for it is soft work step on word the 136879th, registration number 2009SR10700.
Technique effect
1st, the present invention is based on mass spectrum detection, due to the high sensitivity of Mass Spectrometer Method, using this programme to comma bacillus
The Monitoring lower-cut of presence or absence can be far beyond other technologies scheme.
2nd, nucleic acid amplification product can carry out Mass Spectrometer Method after purification, relative to the prior art, overall process only a few hours
Interior completion, easy to operate, high sensitivity, high specificity, as a result accurately, flux are high.
3rd, the detection that the present invention is implemented is completed in same PCR system, has saved sample DNA and PCR amplification system
In each reagent, particularly Taq usage amount, greatly reduce testing cost, can be widely applied to clinical a variety of infectiousness diseases
The quick diagnosis of disease.
4th, for different samples, the present invention can compare the nucleic acid fingerprint spectrum that they are produced, and will test the nucleic acid of generation
The collection of illustrative plates of finger-print and comma bacillus reference culture in database is contrasted, through bioinformatic analysis, it can be determined that should
Whether bacterium is Vibrio cholerae strains isolated.
5th, the classification and identification of comma bacillus can be rapidly and accurately carried out using this programme, and available for clinical examination etc.
Aspect, avoids clinically because diagnosing delay treatment not in time.
6th, the Typing of Vibrio Cholerae in the fields such as environmental sanitation, public place can be identified using the present invention, to safeguard
Public health security.
7th, database of the invention is open, and new separation strains, constantly improve and expansion database can be continuously replenished,
So as to the more accurate identification for completing comma bacillus.
8th, in short, the present invention can be used for the change for detecting the DNA long fragment for having characteristic sequence and non-identifying single base, make
Mass Spectrometer Method macromolecular nucleic acid samples are obtained to be possibly realized.Meanwhile the probability of multitube increase pollution is the method overcome, simplify behaviour
Make, multiple samples can be detected at the same time, detection time is shortened, maintain detection sensitivity and specificity, have in clinic higher
Application prospect.
Brief description of the drawings
Fig. 1：The Multina electrophoretic bands of comma bacillus nucleic acid fragment multiple PCR products.
Fig. 2：The MALDI-TOF MS test maps of comma bacillus nucleic acid fragment multiple PCR products.
Embodiment
In order to further appreciate that the technical characteristic of the present invention, detailed explain is carried out to the present invention with reference to specific embodiment
State.Embodiment only to the present invention have the function that it is exemplary, without the effect of any restrictions, those skilled in the art
The modification of any unsubstantiality is made on the basis of the present invention, should all belong to protection scope of the present invention.
Unless otherwise specified, the conventional means that technological means used in embodiment is well known to those skilled in the art.
Embodiment 1：The foundation of comma bacillus nucleic acid fingerprint spectrum.
1st, sequences match
By retrieving ncbi database, the conserved sequence of comma bacillus DNA is respectively selected from ctxA fragments,>
KX584736.1Vibrio cholerae strain R-18588cholera toxin A-subunit, its sequence is SEQ
ID NO.7：
GATATTACAGTAACTTAGATATTGCTCCAGCAGCAGATGGTTATGGATTGGCAGGTTTCCCTCCGGAGCATAGAGCT TGGAGGGAAGAGCCGTGGATTCATCATGCACCGCCGGGTTGTGGGAATGCTCCAAGATCATCGATGAGTAATACTTG
CGATGAAAAAACCCA；
CtxB fragments,>KX584736.1Vibrio cholerae strain R-18588cholera toxin B-
Subunit, its sequence are SEQ ID NO.8：
TCACAAAAAAAAGCGATTGAAAGGATGAAGGATACCCTGAGGATTGCATATCTTACTGAAGCTAAAGTCGAAAAGTT
ATGTGTATGGAATAATAAAACGCCTCATGCGATTGCCGCAATTAGTATGGCAAATTAAGATATAAAAAAGCCCACCT
CAGTGGGCTTTTTTGTG；
OmpW fragments,>KJ722608.1Vibrio cholerae O1strain N16961OmpW(ompW)gene,
Complete cds, its sequence are SEQ ID NO.9：
TTCTACCTCTGGTGGTGAGTTAGGTAGCCTTGGTGATATTGGTGAAACAAAACATTTGCCACCTACCTT
TATGGTCCAATACTACTTTGGTGAAGCTAATTCGACTTTCCGTCCATATGTTGGTGCGGGTTTGAATTACACCACTT
TCTTTGATGAAAGCTTTAATGGTACG
2nd, design of primers
3 pairs of specific primers are designed to comma bacillus, are all synthesized by Shanghai Jierui Biology Engineering Co., Ltd：
| Numbering | Primer (5' → 3') |
| SEQ ID No：1 | ACGTTGGATGATAGAGCTTGGAGGGAAGAG |
| SEQ ID No：2 | ACGTTGGATGGATGATCTTGGAGCATTCCC |
| SEQ ID No：3 | ACGTTGGATGCATGAGGCGTTTTATTATTCC |
| SEQ ID No：4 | ACGTTGGATGAGCGATTGAAAGGATGAAGG |
| SEQ ID No：5 | ACGTTGGATGGGACGGAAAGTCGAATTAGC |
| SEQ ID No：6 | ACGTTGGATGTACCTCTGGTGGTGAGTTAG |
3rd, PCR amplification：
(1) PCR reaction systems：
(2) amplified reaction program：95 DEG C of pre-degenerations 5min, 95 DEG C of denaturation 30s, 56 DEG C of annealing 30s, 72 DEG C of extension 30s, into
45 circulations of row, last 72 DEG C of extensions 5min.
4th, Multina electrophoresis detections：PCR product is detected using the Multina electrophoresis apparatuses of Shimadzu, is amplified
Tri- band of 128bp, 129bp and 137bp represents to expand successfully (Fig. 1).
5th, multiple PCR products purify：(1) according to DNA Binding Buffer：PCR product=5：1 volume ratio is toward PCR
Mixed after adding Binding Buffer in product；(2) above-mentioned mixed liquor is transferred to adsorption column, adsorption column in collecting pipe,
10,000g centrifugation 30s, discard waste liquid；(3) plus 200 μ L DNA Wash Buffer are in adsorption column, 10,000g centrifugation 30s,
Repeat the washing 1 time；(4) ddH of >=6 μ L is added2For O in adsorption column, room temperature is transferred to new 1.5mL centrifuge tubes after placing 1min
In 10,000g centrifugation 30s, obtain product after purification.
6th, chip point sample：(1) a special micro-array chip of flight time mass spectrum is taken with tweezers, puts down gently and be placed on target holder；
(2) according to sampfe order successively point sample, each sample 0.5-1.0 μ L；(3) room temperature is dried (10-15min) or is used and adds
Hot device heat drying.
7th, Mass Spectrometer Method：Peak-to-peak signal is detected using Clin-ToF II (MALDI-TOF principles) mass spectrograph, referring to Fig. 2.
8th, testing result is analyzed using flight time mass spectrum signal processing system (MALDI MS).
As a result as shown in Fig. 2 and analysis result, mass-spectrogram detects spy at 22115Da, 30010Da and 34874Da
Peak value is levied, respectively ctxA fragments, ctxB fragments, the ompW fragments of characterization amplification comma bacillus.Three feature peak bases are smooth,
Abundance is big, and signal-to-noise ratio is high, and separating degree is high between adjacent signals peak, graph-spectrum quality be improved significantly, using the teaching of the invention it is possible to provide more letters
Breath, helps to improve the accuracy and repeatability of qualification result.
Claims (10)
1. a kind of primer combination of multiple PCR products for being used to identify Typing of Vibrio Cholerae, wherein primer combination include,
The primer is SEQ ID NO.1 and SEQ the ID NO.2 of the specific primer of the ctxA fragments of amplification comma bacillus, its
The mass spectrogram peaks of amplified production are 22115Da；
SEQ ID NO.3 and SEQ the ID NO.4 of the specific primer of the ctxB fragments of comma bacillus are expanded, its amplified production
Mass spectrogram peaks are 30010Da；
SEQ ID NO.5 and SEQ the ID NO.6 of the specific primer of the ompW fragments of comma bacillus are expanded, its amplified production
Mass spectrogram peaks are 34874Da.
2. the composition of claim 1, wherein the primer sets, which are closed, can add tag sequences as needed, makes multiple PCR products
It is sized to easily be distinguished by MALDI-TOF MS.
3. the composition of claim 2, wherein the tag sequences are ACGTTGGATG.
4. the mass spectrum examination of the Primer composition comprising claim 1-3 and the multiple PCR products for identifying Typing of Vibrio Cholerae
Agent box, the wherein kit include above-mentioned for expanding the special point sample matrix of above-mentioned viral specific primer sets, mass spectrum.
5. the kit of claim 4, wherein the composition of the point sample matrix is 3-HPA: DHC: formic acid=4: 2: 1.
6. the kit of claim 5, wherein containing in the 30 μ l of reaction system of the PCR amplification：
7. the kit of claim 6, wherein the concentration of every group of primer pair is controlled between 10-20 μM.
8. the kit of claim 7, wherein being in pcr amplification reaction program：94-95 DEG C of pre-degeneration 5min；94-95 DEG C of denaturation
30s, 55-60 DEG C of annealing 30s, 72-75 DEG C of extension 40-60s, carries out 35-45 circulation；Then, 72-75 DEG C of extension 5min.
9. the kit of claim 8, wherein the kit further includes the special micro-array chip of mass spectrum, mass spectrum internal standard standard
Product, mass spectrum external standard standard items, and for analyzing the software for the nucleic acid fingerprint characteristic collection of illustrative plates for comparing isolated strains.
10. the kit of claim 9, wherein the software is BioExplore softwares, its copyright number steps on word for soft work
No. 136879, registration number 2009SR10700.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810003358.8A CN107988403B (en) | 2018-01-03 | 2018-01-03 | Kit for identifying multiple PCR products of vibrio cholerae typing by mass spectrum |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810003358.8A CN107988403B (en) | 2018-01-03 | 2018-01-03 | Kit for identifying multiple PCR products of vibrio cholerae typing by mass spectrum |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN107988403A true CN107988403A (en) | 2018-05-04 |
| CN107988403B CN107988403B (en) | 2021-04-27 |
Family
ID=62040727
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810003358.8A Active CN107988403B (en) | 2018-01-03 | 2018-01-03 | Kit for identifying multiple PCR products of vibrio cholerae typing by mass spectrum |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107988403B (en) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102253110A (en) * | 2011-06-09 | 2011-11-23 | 曹际娟 | Method for auxiliary identification of comma bacillus by matrix-assisted laser desorption ionisation-time-of-flight mass spectrometry (MALDI-TOF MS) |
| CN102253111A (en) * | 2011-06-09 | 2011-11-23 | 曹际娟 | MALDI-TOF MS (Matrix-assisted Laser Desorption/Ionization Time of Flight Mass Spectrometry)-assisted identification method for listeria monocytogenes |
| CN103667490A (en) * | 2013-12-12 | 2014-03-26 | 向华 | Preparation method for nucleic acid mass spectrum for detecting mutation of colorectal cancer K-ras gene and product for detecting mutation of colorectal cancer K-ras gene |
| CN103868876A (en) * | 2014-03-25 | 2014-06-18 | 麻丽丹 | Method for detecting pathogenic vibrios by MALDI-TOF-MS (Matrix Assisted Laser Desorption Ionization-Time-Of-Flight-Mass Spectrometry) |
-
2018
- 2018-01-03 CN CN201810003358.8A patent/CN107988403B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102253110A (en) * | 2011-06-09 | 2011-11-23 | 曹际娟 | Method for auxiliary identification of comma bacillus by matrix-assisted laser desorption ionisation-time-of-flight mass spectrometry (MALDI-TOF MS) |
| CN102253111A (en) * | 2011-06-09 | 2011-11-23 | 曹际娟 | MALDI-TOF MS (Matrix-assisted Laser Desorption/Ionization Time of Flight Mass Spectrometry)-assisted identification method for listeria monocytogenes |
| CN103667490A (en) * | 2013-12-12 | 2014-03-26 | 向华 | Preparation method for nucleic acid mass spectrum for detecting mutation of colorectal cancer K-ras gene and product for detecting mutation of colorectal cancer K-ras gene |
| CN103868876A (en) * | 2014-03-25 | 2014-06-18 | 麻丽丹 | Method for detecting pathogenic vibrios by MALDI-TOF-MS (Matrix Assisted Laser Desorption Ionization-Time-Of-Flight-Mass Spectrometry) |
Non-Patent Citations (4)
| Title |
|---|
| M. ZEINODDINI ET AL.: "Simple and Accurate Detection of Vibrio Cholera Using Triplex Dot Blotting Assay", 《BIOMACROMOLAR JOURNAL》 * |
| V ZAGO等: "Virulence-associated factors in Vibrio cholerae non-O1/non-O139 and V. mimicus strains isolated in ornamental fish species", 《JOURNAL OF FISH DISEASES》 * |
| 张勤主编: "《动物重要经济性状基因的分离与应用》", 28 February 2012 * |
| 谭贵良等: "《现代分子生物学及组学技术在食品安全检测中的应用》", 30 June 2014 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN107988403B (en) | 2021-04-27 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Gaia et al. | Rapid identification of Legionella spp. by MALDI-TOF MS based protein mass fingerprinting | |
| Krásný et al. | Identification of bacteria using mass spectrometry techniques | |
| CN112094948B (en) | Application of target gene combination in African swine fever virus detection and kit | |
| CN102803512A (en) | Methods and kits for detecting pathogens of respiratory tract | |
| CN107034316B (en) | System for simultaneously detecting 6 porcine viruses and LAMP primer special for system | |
| CN110241257A (en) | A kind of while 11 kinds of related microorganisms that spread through sex intercourse of detection and identification methods | |
| CN103210093B (en) | Method for detecting digestive tract pathogens | |
| CN113817871B (en) | Coronavirus detection method and kit | |
| CN105907890A (en) | Primers, probe and method for rapidly distinguishing HP-PRRS (High pathogenic porcine reproductive and respiratory syndrome) vaccine strain GDr180 from HP-PRRS wild strain | |
| Bacanelli et al. | Matrix assisted laser desorption ionization-time-of-flight mass spectrometry identification of Mycobacterium bovis in Bovinae | |
| CN102851362B (en) | Method for quickly identifying Brucella based on mass spectrum technology and application thereof | |
| Bernhard et al. | Towards proteomic species barcoding of fungi–An example using Scedosporium/Pseudallescheria complex isolates | |
| CN107988341B (en) | The method and product of Mass Spectrometric Identification Typing of Vibrio Cholerae | |
| CN111295713B (en) | Method for quantifying nucleic acid using stable isotope-labeled nucleic acid as internal standard and use thereof | |
| CN107988342A (en) | The method and product of Mass Spectrometric Identification vibrio parahemolyticus parting | |
| CN113215321B (en) | Detection product for detecting genital tract pathogen by MALDI-TOF MS and application | |
| CN113355456B (en) | Preparation method of nucleic acid fingerprint spectrum library for detecting genital tract pathogens by MALDI TOF-MS | |
| CN113215322B (en) | Primer composition for detecting genital tract pathogen by MALDI-TOF MS and application | |
| CN107988403A (en) | The kit of the multiple PCR products of Mass Spectrometric Identification Typing of Vibrio Cholerae | |
| CN108048540A (en) | The method for preparing the fingerprint databases of detection Typing of Vibrio Cholerae | |
| CN108034770A (en) | Method of mass spectrography detection influenza A virus H7N9 multiple PCR products and products thereof | |
| CN109234461A (en) | The multiple RT-PCR detection kit and detection method of peach virus | |
| CN108103171A (en) | The preparation method of vibrio parahemolyticus fingerprint databases | |
| CN107988402A (en) | The kit of Mass Spectrometric Identification vibrio parahemolyticus parting | |
| CN102808223B (en) | Nucleic acid fingerprint feature spectrum database of mycobacterium tuberculosis and usage of nucleic acid fingerprint feature spectrum database |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |