CN108070615B

CN108070615B - Vector for regulating and controlling secretion of parathyroid PTH and application thereof

Info

Publication number: CN108070615B
Application number: CN201711422048.1A
Authority: CN
Inventors: 刘运辉; 杨帆; 张路; 胡楠
Original assignee: Shenzhen Institute of Advanced Technology of CAS; University of Chinese Academy of Sciences; Shenzhen Peoples Hospital
Current assignee: Shenzhen Institute of Advanced Technology of CAS; University of Chinese Academy of Sciences; Shenzhen Peoples Hospital
Priority date: 2017-12-25
Filing date: 2017-12-25
Publication date: 2021-11-05
Anticipated expiration: 2037-12-25
Also published as: CN108070615A

Abstract

The invention provides a vector for regulating and controlling parathyroid PTH secretion and application thereof, wherein the vector comprises a photosensitive gene and/or a PTH promoter for specifically recognizing parathyroid chief cells, and the nucleic acid sequence of the PTH promoter is shown as SEQ ID NO. 1; the carrier is used for preparing medicines and forms a system for regulating parathyroid gland with blue light with specific wavelength and frequency; the specific promoter is used for identifying the parathyroid cells, and the secretion of parathyroid hormone is regulated and controlled by blue light with specific wavelength and frequency, so that the kit is high in space-time, high in precision, good in specificity, excellent in effect and wide in application prospect and market value.

Description

Vector for regulating and controlling secretion of parathyroid PTH and application thereof

Technical Field

The invention relates to the field of biotechnology, in particular to a vector for regulating and controlling parathyroid PTH secretion and application thereof.

Background

Parathyroid gland is a very important gland in endocrine system, and parathyroid hormone (PTH) secreted from parathyroid major cell is an important calcium-phosphorus homeostasis regulator, playing an important role in maintaining calcium-phosphorus balance and bone metabolism balance in body blood. PTH is involved in regulation of bone metabolism, and by acting on osteoblasts, PTH promotes bone resorption and brings bone calcium into the blood, thereby increasing the blood calcium concentration. The entire synthetic secretion process of PTH is mediated by calcium, vitamin D and growth factors, with blood calcium concentrations being directly related to PTH concentrations. When parathyroid gland is diseased or secondary hyperplasia, tumor or even canceration caused by other diseases of the body, PTH synthesis and secretion are increased explosively, and the concentration of PTH in blood is increased abnormally; the abnormal rise can promote bone absorption, cause more rapid and serious osteoporosis, and greatly improve the risk of fracture and even paralysis; meanwhile, high concentration PTH directly causes hypercalcemia, and in addition, the release of bone matrix and the change of pH value of urine often cause recurrent lithangiuria, which leads to the gradual decline of renal function, even renal failure and uremia. Hypercalcemia caused by PTH accumulation may also damage other various systems of the body, such as the cardiovascular system, the neuromuscular system, the digestive system, the central system, etc., and may lead to blood sugar, dyslipidemia, dysregulation of blood pressure, and even neuropsychiatric diseases.

At present, methods for treating hyperthyroidism mainly comprise drug intervention and surgical excision. The pharmaceutical intervention mainly comprises oral phosphorus, estrogen, calcium-like agent, active vitamin D and the like. Oral administration of phosphorus reduces PTH-induced hypercalcemia, but oral administration of phosphorus adversely causes PTH elevation and is therefore rarely selected. The administration of estrogen can effectively reduce osteolysis, increase bone mass, and antagonize bone resorption of PTH. However, the estrogen has wide action range and poor specificity, is easy to cause cell proliferation, and even long-term administration of the estrogen is reported to be easy to cause gynecological tumors and other serious complications. The calcimimetic is a recently discovered calcium-related receptor based on the regulation of main cells, and has a new potential drug for treating hyperthyroidism, which simulates the rise of calcium and inhibits the secretion of PTH by negative feedback; however, the medicine is still in the development stage, and has no enough clinical data. In addition, active vitamin D, taken in large doses over a long period of time, inhibits PTH secretion but often causes hyperphosphatemia. In conclusion, the existing medicine for intervening the hyperthyroidism has the defects of poor specificity, wide action range and easy complication generation, and no particularly effective medicine intervening means is available at present. The currently clinically common treatment means is parathyroid resection-concurrent autograft, and because transplanted tissues are not innervated by the body, PTH secretion rhythm disorder can occur in a short period, and the concentration may still be higher than the normal value, but parathyroid resection can cause sudden hypocalcemia, and the autoparathyroid tissue transplant needs to be implemented to maintain the blood calcium concentration stable, the PTH concentration after transplantation is difficult to control, and a certain tumor risk exists.

Because the commonly used drugs have poor specificity and unobvious effect, the current clinical main treatment means is parathyroidectomy parallel autografting, and because the transplanted tissues are not innervated, the PTH secretion rhythm disorder can occur in a short time, and the concentration can still be higher than the normal value. If a method for specifically inhibiting PTH secretion of parathyroid chief cells can be found, parathyroid tissues can be regulated in situ in vivo or after transplantation, abnormal secretion of PTH is inhibited, and a series of symptoms caused by hypercalcemia are effectively reduced.

The optogenetic regulation and control technology is a new technology which appears at the beginning of the century and is developed rapidly; the principle is that different photosensitive genes are transferred into mammalian cells based on a gene therapy method, and the activity of specific cell types is regulated and controlled by light with different wavelengths. At the beginning of the advent of the optogenetic technique, which was mainly applied in the field of neuroscience, focused on the regulation of neuronal activity; with the progress and popularization of the technology, the technology is gradually applied to research in other fields, such as: the light gene regulates myocardial cells, the light genetic technology regulates insulin secretion and the like. However, reports of regulation of parathyroid gland major cells by optogenetic technology have not been found so far.

In conclusion, the research and development of the regulation and control vector based on high space-time selectivity and cell specificity and the related technology for regulating the cell function of the endocrine gland have wide market value and application prospect.

Disclosure of Invention

Aiming at the defects and actual requirements of the prior art, the invention provides a vector for regulating parathyroid hormone secretion and application thereof, wherein the vector carries a photosensitive gene and a PTH promoter for specifically identifying parathyroid hormone, the vector is used for preparing a medicament and forms a system for regulating parathyroid hormone with blue light with specific frequency and wavelength, the parathyroid hormone is identified in a targeting way through the PTH promoter, and the blue light with specific frequency and wavelength stimulates and regulates the photosensitive gene, so that the function of regulating parathyroid hormone secretion with high space-time precision and specificity is achieved, and the vector has wide application prospect and market value.

In order to achieve the purpose, the invention adopts the following technical scheme:

in one aspect, the present invention provides a vector for regulating secretion of parathyroid PTH, said vector comprising a light sensitive gene and/or a PTH promoter that specifically recognizes parathyroid chief cells;

the nucleic acid sequence of the PTH promoter is shown as SEQ ID NO. 1, and the nucleic acid sequence shown as SEQ ID NO. 1 is as follows:

CTGGAGTTCAAAGAAGGGCTGTATTTCTAGGCAGAAACTGAGGTAGTAAGAATCTGGTGTCATAAAGACCTTTGTTGAATTCCATCTTTTCTGCTTTCCAAGCCTAAGTTTCCTCATGTAAAAATGGGGATAAGCACTTAACTTTAGTACTTTAAGTACTAACTTTAAAGGACTGCTGTGAAGATCTAGTGGGATAATATATGTAGTTAGGCATGCAGTTAGTGCTTATCAAATGTTATTATTATAGATTAAGATGCACAAATAAAATATAAGTTAAATAAATTTTAAAATAATTTCACTTTTGAAGCTTTTAAAGTAATTATGTACTAAGAGCATTTTCTCAAATTATTCTTAACACTTCCTTTAAGAAAAGGGCTATATCTGTTTTTTGAAAGATGACCAGAAGTGACATGGATTGGTTGAAAATGGCTTGTAAAGTAAGCCTAACATTTATGATTTATTACCATAAAAACTGTACCAACAGTACGGTTATAACAAATACACTTATTTTTGGGTTTTATTTTCAAGTAAGATAATGACTTTATCATAAACCTTTGAAATCAGTCTTTTTACAGTATAAATTCAGATTCATTAATCCACATAGAATTTTTCTCGATGGTATAATTCTGTATTTGTTAAAAGTCTTTGCATAAGCCCCTTGTCAAGCCAAATGCTGTTTTCCTTTTAGTATCCAATTATCTGAAACTTAAGAAGAGTGTGCACCGCCCAATGGGTGTGTGTATGTGCTGCTTTGAACCTATAGTTGAGATCCAGAGAATTGGGAGTGACATCATCTGTAACAATAAAAGAGCCTCTCTTGGTAAGCAGAAGACCTATATATAAAAGTCACCATTTAAGGGGTCTGCAGTCCAATTCATCAGTTGTCTTTAGTTTACTCAGCATCAGCTACTAACATACCTGAACG；

the photosensitive gene is a gene capable of expressing cell membrane channel protein sensitive to blue light, and the photosensitive protein can open a channel under the irradiation of specific wavelength (such as 470nm) so that cations (sodium ions, calcium ions and the like) enter cytoplasm to cause the cell membrane potential to rise, thereby realizing the activity regulation and control of cells. The optogenetic regulation technology is to transfer different photosensitive genes into mammalian cells and regulate the activity of specific cell types by light with different wavelengths.

After the prior art for regulating the parathyroid gland is fully researched, the advantages and the disadvantages of the parathyroid gland are summarized, in order to avoid the defects of wide action range, poor specificity and unobvious effect of a medicament and the problem of PTH secretion disorder after surgical excision, a optogenetic regulation and control technology is creatively selected, a PTH promoter of a parathyroid gland main cell can be specifically identified by utilizing a specific promoter, the parathyroid gland main cell is identified, PTH secretion of the parathyroid gland main cell is regulated and controlled through blue light irradiation with specific wavelength and frequency, and the purpose of specifically regulating the parathyroid gland main cell in a high space-time precision manner is achieved.

Preferably, the light sensitive gene is ChR2, the nucleic acid sequence of the ChR2 is shown as SEQ ID NO. 2, and the nucleic acid sequence shown as SEQ ID NO. 2 is as follows:

ATGGACTATGGCGGCGCTTTGTCTGCCGTCGGACGCGAACTTTTGTTCGTTACTAATCCTGTGGTGGTGAACGGGTCCGTCCTGGTCCCTGAGGATCAATGTTACTGTGCCGGATGGATTGAATCTCGCGGCACGAACGGCGCTCAGACCGCGTCAAATGTCCTGCAGTGGCTTGCAGCAGGATTCAGCATTTTGCTGCTGATGTTCTATGCCTACCAAACCTGGAAATCTACATGCGGCTGGGAGGAGATCTATGTGTGCGCCATTGAAATGGTTAAGGTGATTCTCGAGTTCTTTTTTGAGTTTAAGAATCCCTCTATGCTCTACCTTGCCACAGGACACCGGGTGCAGTGGCTGCGCTATGCAGAGTGGCTGCTCACTTGTCCTGTCATCCTTATCCGCCTGAGCAACCTCACCGGCCTGAGCAACGACTACAGCAGGAGAACCATGGGACTCCTTGTCTCAGACATCGGGACTATCGTGTGGGGGGCTACCAGCGCCATGGCAACCGGCTATGTTAAAGTCATCTTCTTTTGTCTTGGATTGTGCTATGGCGCGAACACATTTTTTCACGCCGCCAAAGCATATATCGAGGGTTATCATACTGTGCCAAAGGGTCGGTGCCGCCAGGTCGTGACCGGCATGGCATGGCTGTTTTTCGTGAGCTGGGGTATGTTCCCAATTCTCTTCATTTTGGGGCCCGAAGGTTTTGGCGTCCTGAGCGTCTATGGCTCCACCGTAGGTCACACGATTATTGATCTGATGAGTAAAAATTGTTGGGGGTTGTTGGGACACTACCTGCGCGTCCTGATCCACGAGCACATATTGATTCACGGAGATATCCGCAAAACCACCAAACTGAACATCGGCGGAACGGAGATCGAGGTCGAGACTCTCGTCGAAGACGAAGCCGAGGCCGGAGCCGTGCCAGCGGCCGCC；

in the invention, the ChR2(Channelrhodopsin-2) codes cation channel protein, and after being illuminated by blue light with the wavelength of 470nm, cations enter cells to excite the activity of the cells; by utilizing the electric conductivity and the rapid kinetic property of the light sensing gene ChR2, the neuron can be induced to generate action potential by light; it also can regulate excitability of nervous system and transferability of synapse.

In a second aspect, the present invention provides a recombinant adeno-associated virus obtained by co-transfecting a mammalian cell with the vector of the first aspect, together with a liposome and a packaging helper plasmid;

preferably, the liposome comprises calcium phosphate, Lipofectamine 2000 or FuGENE, preferably FuGENE.

Preferably, the mammalian cells are 293FT cells.

Preferably, the packaging helper plasmid comprises pAAV-RC and/or pHepler.

In a third aspect, the present invention provides a vector as described in the first aspect for use in the preparation of a medicament for regulating parathyroid gland.

In a fourth aspect, the present invention provides a medicament comprising the recombinant adeno-associated virus according to the second aspect.

In a fifth aspect, the present invention provides a system for regulating parathyroid gland comprising a medicament as described in the fourth aspect and blue light.

Preferably, the wavelength of the blue light is 450-500nm, such as 450nm, 460nm, 470nm, 480nm, 490nm or 500nm, preferably 460-480 nm.

Preferably, the frequency of the blue light is 15-25Hz, which may be, for example, 15Hz, 16Hz, 17Hz, 18Hz, 19Hz, 20Hz, 21Hz, 22Hz, 23Hz, 24Hz or 25Hz, preferably 18-22 Hz.

Preferably, the average illumination intensity of the blue light is 8-12mW/mm²For example, it may be 8mW/mm²、9mW/mm²、10mW/mm²、11mW/mm²Or 12mW/mm²Preferably 9-11mW/mm²。

In a sixth aspect, the present invention provides a method for regulating parathyroid gland for non-therapeutic purposes, comprising the steps of:

(1) constructing a lentivirus carrying a CMV promoter, a photosensitive gene and a fluorescent gene;

(2) infecting human parathyroid chief cells with the lentivirus of the step (1) and carrying out a verification experiment;

(3) stimulating the infected cells in the step (2) by adopting blue light, and collecting a conditioned medium to detect PTH change;

(4) constructing the recombinant adeno-associated virus of the second aspect and infecting rat parathyroid gland, adopting blue light to stimulate parathyroid gland, collecting serum, and detecting PTH concentration, blood calcium and blood phosphorus concentration change;

optionally, the method further comprises after step (3) constructing glandular associated virus infected rat parathyroid tissue according to the second aspect, stimulating the tissue with blue light, collecting the culture medium to detect the PTH concentration.

Preferably, the stimulation time in step (3) is 20-40min, such as 20min, 22min, 24min, 25min, 26min, 28min, 30min, 32min or 35min, preferably 25-35 min.

Preferably, the infection in step (4) is carried out by injecting the virus into rat parathyroid gland at a dose of 0.2-0.5 microliter per side, such as 0.2 microliter, 0.3 microliter, 0.4 microliter or 0.5 microliter.

Preferably, the time point of the stimulation in step (4) is 18 to 22 days after infection, for example, 18, 19, 20, 21 or 22 days.

Preferably, the method of detection is ELISA.

Firstly, the inventor uses lentivirus (lenti-CMV-ChETA-eYFP, CMV is used as a promoter, the promoter belongs to a broad-spectrum promoter and can infect all cells, and the promoter is not selective) to infect parathyroid gland main cells of human origin, and after light regulation, the parathyroid gland main cells can effectively and reversibly inhibit PTH secretion at a cellular level. In order to realize cell selectivity, an adeno-associated virus vector of a PTH promoter is designed, parathyroid glands of rats are infected after being packaged into viruses, and the fact that parathyroid glands which express the viruses of the rats and are taken out by operation can inhibit PTH secretion of the rats after in vitro stimulation is found, and functions of the parathyroid glands can be recovered. Directly after in vivo photostimulation of rats, the compound also can reversibly inhibit PTH secretion and simultaneously regulate the calcium-phosphorus balance in blood.

As a preferred technical scheme, the invention provides a method for regulating parathyroid gland, which comprises the following steps:

(2) infecting the virus obtained in the step (1) with human parathyroid chief cells, and performing a verification experiment;

(4) constructing the recombinant adeno-associated virus of the second aspect, injecting rat parathyroid gland with each side injecting 0.2-0.5 microliter, adopting separated parathyroid gland tissue stimulated by blue light 18-22 days after infection, collecting culture medium to detect PTH concentration;

(5) injecting the recombinant adeno-associated virus obtained in the step (4) into rat parathyroid gland, injecting 0.2-0.5 microliter on each side, stimulating the parathyroid gland by adopting blue light 18-22 days after infection, collecting serum, and detecting PTH concentration, blood calcium and blood phosphorus concentration changes;

wherein, the wavelength of the blue light in the step (3), the step (4) and the step (5) is 450-500nm, the frequency is 15-25Hz, and the average intensity of illumination isThe degree is 8-12mW/mm²The time is 20-40 min.

Compared with the prior art, the invention has the following beneficial effects:

the vector provided by the invention can be used for preparing recombinant adenovirus and a parathyroid regulation system containing the recombinant adenovirus and blue light, can be used for specifically regulating and controlling parathyroid gland primary cells at high time and space accuracy and regulating the release of PTH of the parathyroid gland primary cells; the in-vivo specific PTH regulation system and method can avoid the defects of wide action range, poor specificity and unobvious effect of the medicament and can effectively maintain the calcium-phosphorus balance of serum.

Drawings

FIG. 1 is a drawing of the identification of immunostaining of primary human parathyroid chief cell culture system in example 2 of the present invention, in which FIG. 1(A) is a drawing of unstained cells, FIG. 1(B) is a drawing of PTH staining, FIG. 1(C) is a drawing of CasR calcium ion receptor staining, and FIG. 1(D) is a drawing of VDR vitamin D receptor staining;

FIG. 2 is a graph showing the result of staining of virus-infected cells according to example 2 of the present invention, wherein FIG. 2(A) is a fluorescence graph of a lentivirus-infected cell carrying a light-sensitive gene, and FIG. 2(B) is a fluorescence graph of a lentivirus-infected cell not carrying a light-sensitive gene;

FIG. 3 is a flowchart of an experiment in example 3 of the present invention, in which FIG. 3(A) is a diagram of an experiment step, FIG. 3(B) is a diagram of an experiment for irradiating cells with blue light, and FIG. 3(C) is a diagram of a principle of irradiating cells with blue light;

FIG. 4 is a graph showing the results of example 3 of the present invention, wherein FIG. 4(A) is the results of the assay before stimulation, FIG. 4(B) is the results of the assay after 1 hour of stimulation, and FIG. 4(C) is the results of the assay after 6 hours of stimulation;

FIG. 5 is a view showing the experimental procedure of example 4 of the present invention, in which FIG. 5(A) is an anatomical view of a rat, FIG. 5(B) is a schematic view of a parathyroid-expressing virus, FIG. 5(C) is a schematic view of a rat periungual gland tissue taken out by surgery, and FIG. 5(D) is a blue-light irradiation view;

FIG. 6 is a graph showing the results of example 4 of the present invention, wherein FIG. 6(A) is a histogram of PTH, FIG. 6(B) is a histogram of total protein, and FIG. 6(C) is a sequence diagram of rAAV-PTH-hCHR2(H134R) -mcherry-WPRE-pA plasmid;

FIG. 7 is a view showing the experimental procedure of example 5 of the present invention, in which FIG. 7(A) is an anatomical view of a rat, FIG. 7(B) is a schematic view showing light stimulation, and FIG. 7(C) is a schematic view showing viral expression of the rat after injecting a virus into the paraungual gland;

FIG. 8 is a graph showing the results of example 5 of the present invention, in which FIG. 8(A) is a PTH concentration chart, FIG. 8(B) is a calcium ion concentration chart, and FIG. 8(C) is a phosphorus ion concentration chart.

Detailed Description

To further illustrate the technical means and effects of the present invention, the following further describes the technical solutions of the present invention by way of specific embodiments with reference to the drawings, but the present invention is not limited to the scope of the embodiments.

Example 1

Constructing and packaging adeno-associated virus carrying CMV promoter lentivirus and PTH promoter of photosensitive gene: packaging lentivirus (target gene, P delta and VSVG) and adeno-associated virus (target gene, pAAV-RC and pHelper) by adopting a three-plasmid method; for the lentivirus packaging example, the general procedure is as follows: mixing P delta (15 mu g), VSVG (7 mu g) and a target gene plasmid (22 mu g) carrying a light sensation gene, a green fluorescence gene and a corresponding promoter, transfecting the mixture into 293FT cells by utilizing liposome FuGENE, packaging, continuously culturing for 24h by using a virus production medium (DMEM containing 5mM sodium pyruvate), collecting the culture medium supernatant after 24h, centrifuging at 1000rpm for five minutes, and taking the supernatant; filtering cell residue with 0.45 μm filter membrane, transferring filtrate into centrifuge tube, spreading 20% sucrose filter column at bottom, depositing virus particles at 4 deg.C and 20000rpm for 2h by low-temperature ultra-high speed centrifuge, pouring out supernatant, and re-suspending virus particles at bottom of centrifuge tube with sterile PBS at volume ratio of 1:1000 to obtain virus titer of 3 × 10⁸Tm/mL or more.

Example 2

Establishing a primary human parathyroid gland master cell culture system and performing immunostaining identification, wherein the result is shown in figures 1(A) -1 (D);

as can be seen from FIGS. 1(A) to 1(D), the culture system of human parathyroid chief cells was successfully established and stained;

mixing the obtained virus solution of the lentivirus into serum-free dual-antibody-free DMEM according to the volume ratio of 1:200, and using the mixture to infect human parathyroid gland main cells; after 12 hours, the virus-containing culture medium was replaced with fresh DMEM containing 10% fetal bovine serum and 1% double antibody, and the culture was continued for 48 hours, followed by observation under a fluorescent microscope, and the results are shown in FIG. 2(A) and FIG. 2 (B);

as can be seen from FIGS. 2(A) and 2(B), a green fluorescence-labeled protein was observed, indicating that the light-sensitive gene labeled parathyroid chief cell was successful.

Example 3

At 470nm, 20Hz and 10mW/mm²The blue light stimulates the cells for 30 minutes, the conditioned medium is collected at 1h, 2h, 4h, 6h and 24h after stimulation respectively, and the ELISA detects the secretion change of PTH, the experimental flow is shown in figure 3(A) -figure 3(C), and the experimental result is shown in figure 4(A) -figure 4 (C);

as can be seen from fig. 4(a) -4 (C), the culture medium PTH concentration of the photogenome 1 hour after the light stimulation was significantly lower than that of the fluorescent protein-only control group of the empty-shell virus, and then the normal level was restored at 6 hours.

Example 4

The rat parathyroid gland tissue is infected by the constructed adeno-associated virus of the PTH promoter, and the light gene is expressed on the main cell. Injecting parathyroid gland of rat with virus vector carrying light sensitive gene (0.4 microliter each side), and monitoring virus expression condition by observing fluorescence expression condition 21 days after injection; the isolated parathyroid gland is stimulated by blue light, and culture media are collected at various time points to detect the PTH concentration, the experimental process is shown in FIG. 5, the results are shown in FIGS. 6(A) and 6(B), and the plasmid map of the adeno-associated virus is shown in FIG. 6 (C);

as can be seen from FIGS. 6(A) and 6(B), the results of ELISA test showed that light stimulation could effectively inhibit PTH release in a short time and return to normal after 6 hours.

Example 5

At the animal body level, stimulating the PTH promoter AAV virus at the parathyroid gland position by blue light after injecting rat parathyroid gland for three weeks, wherein the light average intensity is 10mW/mm2, collecting serum before stimulation, 5 minutes after stimulation and 15 minutes after stimulation respectively, analyzing PTH concentration, blood calcium and blood phosphorus concentration change by ELISA, and the experimental process is shown in figure 7, and the results are shown in figure 8(A) -figure 8 (C);

as can be seen from FIGS. 8(A) to 8(C), stimulation of rat parathyroid gland in vivo is effective in inhibiting short-term secretion of PTH and has a calcium-phosphorus modulating effect.

In conclusion, the vector and the prepared recombinant adeno-associated virus can form a parathyroid regulation system together with a cyanobacteria, achieve the function of high-space-time high-precision specific regulation of parathyroid hormone secretion, and have wide application prospect and market value.

The applicant states that the present invention is illustrated in detail by the above examples, but the present invention is not limited to the above detailed methods, i.e. it is not meant that the present invention must rely on the above detailed methods for its implementation. It should be understood by those skilled in the art that any modification of the present invention, equivalent substitutions of the raw materials of the product of the present invention, addition of auxiliary components, selection of specific modes, etc., are within the scope and disclosure of the present invention.

Sequence listing

<110> Shenzhen advanced technology research institute of Chinese academy of sciences

<120> vector for regulating secretion of parathyroid PTH and application thereof

<130> 2017

<141> 2017-12-25

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 925

<212> DNA

<213> Artificial Synthesis ()

<400> 1

ctggagttca aagaagggct gtatttctag gcagaaactg aggtagtaag aatctggtgt 60

cataaagacc tttgttgaat tccatctttt ctgctttcca agcctaagtt tcctcatgta 120

aaaatgggga taagcactta actttagtac tttaagtact aactttaaag gactgctgtg 180

aagatctagt gggataatat atgtagttag gcatgcagtt agtgcttatc aaatgttatt 240

attatagatt aagatgcaca aataaaatat aagttaaata aattttaaaa taatttcact 300

tttgaagctt ttaaagtaat tatgtactaa gagcattttc tcaaattatt cttaacactt 360

cctttaagaa aagggctata tctgtttttt gaaagatgac cagaagtgac atggattggt 420

tgaaaatggc ttgtaaagta agcctaacat ttatgattta ttaccataaa aactgtacca 480

acagtacggt tataacaaat acacttattt ttgggtttta ttttcaagta agataatgac 540

tttatcataa acctttgaaa tcagtctttt tacagtataa attcagattc attaatccac 600

atagaatttt tctcgatggt ataattctgt atttgttaaa agtctttgca taagcccctt 660

gtcaagccaa atgctgtttt ccttttagta tccaattatc tgaaacttaa gaagagtgtg 720

caccgcccaa tgggtgtgtg tatgtgctgc tttgaaccta tagttgagat ccagagaatt 780

gggagtgaca tcatctgtaa caataaaaga gcctctcttg gtaagcagaa gacctatata 840

taaaagtcac catttaaggg gtctgcagtc caattcatca gttgtcttta gtttactcag 900

catcagctac taacatacct gaacg 925

<210> 2

<211> 939

<212> DNA

<213> Artificial Synthesis ()

<400> 2

atggactatg gcggcgcttt gtctgccgtc ggacgcgaac ttttgttcgt tactaatcct 60

gtggtggtga acgggtccgt cctggtccct gaggatcaat gttactgtgc cggatggatt 120

gaatctcgcg gcacgaacgg cgctcagacc gcgtcaaatg tcctgcagtg gcttgcagca 180

ggattcagca ttttgctgct gatgttctat gcctaccaaa cctggaaatc tacatgcggc 240

tgggaggaga tctatgtgtg cgccattgaa atggttaagg tgattctcga gttctttttt 300

gagtttaaga atccctctat gctctacctt gccacaggac accgggtgca gtggctgcgc 360

tatgcagagt ggctgctcac ttgtcctgtc atccttatcc gcctgagcaa cctcaccggc 420

ctgagcaacg actacagcag gagaaccatg ggactccttg tctcagacat cgggactatc 480

gtgtgggggg ctaccagcgc catggcaacc ggctatgtta aagtcatctt cttttgtctt 540

ggattgtgct atggcgcgaa cacatttttt cacgccgcca aagcatatat cgagggttat 600

catactgtgc caaagggtcg gtgccgccag gtcgtgaccg gcatggcatg gctgtttttc 660

gtgagctggg gtatgttccc aattctcttc attttggggc ccgaaggttt tggcgtcctg 720

agcgtctatg gctccaccgt aggtcacacg attattgatc tgatgagtaa aaattgttgg 780

gggttgttgg gacactacct gcgcgtcctg atccacgagc acatattgat tcacggagat 840

atccgcaaaa ccaccaaact gaacatcggc ggaacggaga tcgaggtcga gactctcgtc 900

gaagacgaag ccgaggccgg agccgtgcca gcggccgcc 939

Claims

1. A vector for regulating parathyroid hormone secretion from parathyroid glands, said vector comprising a light sensitive gene and a PTH promoter that specifically recognizes parathyroid chief cells;

the nucleic acid sequence of the PTH promoter is shown as SEQ ID NO. 1;

the photosensitive gene is ChR 2;

the nucleic acid sequence of the ChR2 is shown as SEQ ID NO. 2.

2. A recombinant adeno-associated virus, wherein the vector of claim 1 is co-transfected with liposomes and a packaging helper plasmid to obtain a recombinant adeno-associated virus;

the liposome comprises calcium phosphate, Lipofectamine 2000 or FuGENE;

the mammalian cells are 293FT cells;

the packaging helper plasmids include pAAV-RC and/or pHelper.

3. Use of the vector of claim 1 or the recombinant adeno-associated virus of claim 2 in the manufacture of a medicament for inhibiting secretion of parathyroid hormone by a parathyroid gland.

4. A medicament comprising the vector of claim 1 or the recombinant adeno-associated virus of claim 2.

5. A method of regulating parathyroid gland for non-therapeutic purposes comprising administering a medicament according to claim 4 and blue light;

the wavelength of the blue light is 450-500 nm;

the frequency of the blue light is 15-25 Hz;

the average illumination intensity of the blue light is 8-12mW/mm²。

6. The method of modulating parathyroid gland according to claim 5, wherein the wavelength of blue light is 460-480 nm;

the frequency of the blue light is 18-22 Hz;

the average illumination intensity of the blue light is 9-11mW/mm²。