CN108070615A - A kind of carrier of regulation and control parathyroid gland PTH secretions and its application - Google Patents

Abstract

Carrier and its application, the carrier the present invention provides a kind of regulation and control parathyroid gland PTH secretions include the PTH promoters of photosensitizing effect and/or specific recognition chief cell, the nucleotide sequence such as SEQ ID NO of the PTH promoters:Shown in 1；The carrier is used to prepare drug and the system for adjusting parathyroid gland is formed with specific wavelength and the blue light of frequency；The present invention identifies parathyroid cells using specificity promoter, and the secretion of parathormone is regulated and controled by specific wavelength and the blue light of frequency, and high space-time, high-precision, specificity is good, and effect is remarkable, has broad application prospects and market value.

Description

A kind of carrier of regulation and control parathyroid gland PTH secretions and its application

Technical field

The present invention relates to the carriers and its application of biological technical field more particularly to a kind of regulation and control parathyroid gland PTH secretions.

Background technology

Parathyroid gland is very important body of gland in internal system, the parathormone (parathyroid of secretion Hormone, PTH) it is a kind of important calcium phosphorus steady-state adjustment factor secreted by chief cell, maintaining body blood It plays a significant role in calcium phosphorus balance and bone metabolism equilibrium process.PTH participates in bone metabolism and adjusts, thin by acting on skeletonization Born of the same parents, PTH can promote bone resorption, bone calcium be brought into blood, so as to improve blood calcium concentration.The entire synthesis secretion process of PTH It is subject to calcium, vitamin D and growth factor are reconciled jointly, and wherein blood calcium concentration is directly related with PTH concentration.When parathyroid gland from The secondary hyperplasia that lesion or body other diseases trigger occurs for body, when knurl becomes even canceration, can trigger that PTH is synthesized and secretion is in Burst increases, concentration abnormality rise in blood；This abnormal rise can promote bone information, trigger faster more serious bone The generation of matter osteoporosis substantially increases the fracture even risk of paralysis；Meanwhile high concentration PTH directly triggers hypercalcinemia, adds The release of upper bone matrix and the change of urine acid-base value often result in repeatability lithangiuria, and renal function is caused progressively to decline or even kidney It declines and uremia.The hypercalcemia that PTH accumulations trigger is also possible to endanger body other multiple systems, such as cardiocirculatory, nerve Motoric system, digestive system and cental system etc., can cause blood glucose, and Dyslipidemia and blood pressure control are disorderly or even refreshing Through mental illness.

At present, treating the method for hyperparathyroidism mainly includes pharmaceutical intervention and surgery excision.Pharmaceutical intervention mainly includes oral Phosphorus, estrogen, Sensipar, activated vitamin D etc..Oral phosphorus can reduce the hypercalcinemia of PTH initiations, but oral phosphorus again can be anti- Come over to trigger the rise of PTH, therefore be seldom selected.Bone dissolving can effectively be reduced by taking estrogen, increase bone amount, antagonism PTH Bone resorption.But estrogen action is in extensive range, poor specificity, easily causes hyperplasia or even it has been reported that long-term It takes estrogen and easily triggers gynecological tumor and other serious complication.Sensipar is found in the recent period based on regulation and control chief cell Calcium associated receptor has simulation calcium rise, the drug of the new potential treatment hyperparathyroidism of negative feedback inhibition PTH secretions；But The drug still in development phase, there is no enough clinical datas.It can press down in addition, heavy dose takes activated vitamin D for long periods of time PTH secretions processed, but often trigger hyperphospheremia symptom.In general, existing pharmaceutical intervention hyperparathyroidism is because poor specificity, effect Scope is wide, and easy the shortcomings that triggering complication, there is no particularly effective pharmaceutical intervention means at present.It is clinically common at present to control Treatment means are the parallel autoplasties of parathyroidectomy, because transplanting tissue from body innervation, therefore in a short time Can occur the disorder of PTH Secretion Rhymes, concentration still it is possible that higher than normal value situation, but parathyroidectomy is except can lead Rapid hair property hypocalcemia is caused, it is necessary to implement self Parathyroid Tissue transplantation so that blood calcium concentration to be maintained to stablize, the PTH after transplanting Concentration is difficult to control, and there are certain knurl risks.

Since common drug specificity is poor, effect unobvious, clinically main treatment means are first shapes at present Other gland cuts off parallel autoplasty, because the tissue of transplanting is not subject to innervation, therefore PTH Secretion Rhymes can occur in a short time Disorder, concentration can may still be higher than normal value.If the PTH secretions that a species specificity inhibits chief cell can be found Method, then Parathyroid Tissue can be regulated and controled after body or transplanting in situ, inhibit the abnormal secretion of PTH, effectively reduced high A series of symptoms caused by blood calcium.

Light genetic regulation technology is that occur the beginning of this century, a kind of fast-developing emerging technology；Its principle is based on base Because the method for the treatment of is transferred to different photosensitizing effects to mammalian cell, lived by the light of different wave length to particular cell types Property is regulated and controled.At the beginning of light genetic technique occurs, which is applied primarily to neuroscience field, concentrates on to neuron The adjusting of activity；It with advances in technology and promotes, which is gradually applied to the research of other field, such as：Photogene tune Control cardiac muscle cell, the regulation and control insulin secretion of light genetics technology etc..But so far, there is not yet light genetic technique regulates and controls first shape The report of other gland chief cell.

In conclusion research and development a kind of regulation and control carrier and correlation technique based on high space-time selectivity and cell-specific are used for The adjusting of endocrinal glands cell function has a vast market value and application prospect.

The content of the invention

In view of the deficiencies of the prior art and actual demand, the present invention provide a kind of load for adjusting parathyroid gland PTH secretions Body and its application, the carrier carry the PTH promoters of photosensitizing effect and specific recognition parathyroid gland, the carrier are used for It prepares drug simultaneously and the blue light of specific frequency and wavelength forms the system for adjusting parathyroid gland, identified by PTH promoter targetings The blue light of parathyroid gland, specific frequency and wavelength stimulates regulation and control photosensitizing effect, reaches high space-time high-precision specificity and adjusts first shape The function of other parathyrine secretion, has broad application prospects and market value.

For this purpose, the present invention uses following technical scheme：

On the one hand, the present invention provides a kind of carrier of regulation and control parathyroid gland PTH secretions, and the carrier includes photosensitizing effect And/or the PTH promoters of specific recognition chief cell；

The nucleotide sequence of the PTH promoters such as SEQ ID NO:Shown in 1, the SEQ ID NO:Nucleic acid sequence shown in 1 Row are as follows：

CTGGAGTTCAAAGAAGGGCTGTATTTCTAGGCAGAAACTGAGGTAGTAAGAATCTGGTGTCATAAAGACCTTTGTTG AATTCCATCTTTTCTGCTTTCCAAGCCTAAGTTTCCTCATGTAAAAATGGGGATAAGCACTTAACTTTAGTACTTTA AGTACTAACTTTAAAGGACTGCTGTGAAGATCTAGTGGGATAATATATGTAGTTAGGCATGCAGTTAGTGCTTATCA AATGTTATTATTATAGATTAAGATGCACAAATAAAATATAAGTTAAATAAATTTTAAAATAATTTCACTTTTGAAGC TTTTAAAGTAATTATGTACTAAGAGCATTTTCTCAAATTATTCTTAACACTTCCTTTAAGAAAAGGGCTATATCTGT TTTTTGAAAGATGACCAGAAGTGACATGGATTGGTTGAAAATGGCTTGTAAAGTAAGCCTAACATTTATGATTTATT ACCATAAAAACTGTACCAACAGTACGGTTATAACAAATACACTTATTTTTGGGTTTTATTTTCAAGTAAGATAATGA CTTTATCATAAACCTTTGAAATCAGTCTTTTTACAGTATAAATTCAGATTCATTAATCCACATAGAATTTTTCTCGA TGGTATAATTCTGTATTTGTTAAAAGTCTTTGCATAAGCCCCTTGTCAAGCCAAATGCTGTTTTCCTTTTAGTATCC AATTATCTGAAACTTAAGAAGAGTGTGCACCGCCCAATGGGTGTGTGTATGTGCTGCTTTGAACCTATAGTTGAGAT CCAGAGAATTGGGAGTGACATCATCTGTAACAATAAAAGAGCCTCTCTTGGTAAGCAGAAGACCTATATATAAAAGT CACCATTTAAGGGGTCTGCAGTCCAATTCATCAGTTGTCTTTAGTTTACTCAGCATCAGCTACTAACATACCTGAAC G；

The photosensitizing effect is a kind of gene that can be expressed to the cell membrane channels albumen of sensitive to blue light, and photosensitive protein is in spy With open channel cationic (sodium ion, calcium ion etc.) can be made to cause thin into cytoplasm under standing wave length (such as 470nm) irradiation After birth current potential rises, so as to fulfill the activity regulation to cell.Light genetic regulation technology is by being transferred to mammalian cell Different photosensitizing effects regulates and controls particular cell types activity by the light of different wave length.

After the prior art that the present invention is adjusted parathyroid gland in abundant research, respective advantage and disadvantage are summarized, in order to evade medicine Object sphere of action is excessively wide, after poor specificity, the unconspicuous drawback of effect and surgery excision the problem of PTH parasecretions, creative Light science of heredity control technique is selected on ground, and using the promoter of specificity, the PTH of energy specific recognition chief cell starts Son identifies chief cell, regulates and controls the PTH of chief cell points by specific wavelength and the blue light illumination of frequency It secretes, achievees the purpose that the accurate Non-specific adjusting chief cell of high space-time.

Preferably, the photosensitizing effect is ChR2, the nucleotide sequence such as SEQ ID NO of the ChR2:Shown in 2, the SEQ ID NO:Nucleotide sequence shown in 2 is as follows：

ATGGACTATGGCGGCGCTTTGTCTGCCGTCGGACGCGAACTTTTGTTCGTTACTAATCCTGTGGTGGTGAACGGGTC CGTCCTGGTCCCTGAGGATCAATGTTACTGTGCCGGATGGATTGAATCTCGCGGCACGAACGGCGCTCAGACCGCGT CAAATGTCCTGCAGTGGCTTGCAGCAGGATTCAGCATTTTGCTGCTGATGTTCTATGCCTACCAAACCTGGAAATCT ACATGCGGCTGGGAGGAGATCTATGTGTGCGCCATTGAAATGGTTAAGGTGATTCTCGAGTTCTTTTTTGAGTTTAA GAATCCCTCTATGCTCTACCTTGCCACAGGACACCGGGTGCAGTGGCTGCGCTATGCAGAGTGGCTGCTCACTTGTC CTGTCATCCTTATCCGCCTGAGCAACCTCACCGGCCTGAGCAACGACTACAGCAGGAGAACCATGGGACTCCTTGTC TCAGACATCGGGACTATCGTGTGGGGGGCTACCAGCGCCATGGCAACCGGCTATGTTAAAGTCATCTTCTTTTGTCT TGGATTGTGCTATGGCGCGAACACATTTTTTCACGCCGCCAAAGCATATATCGAGGGTTATCATACTGTGCCAAAGG GTCGGTGCCGCCAGGTCGTGACCGGCATGGCATGGCTGTTTTTCGTGAGCTGGGGTATGTTCCCAATTCTCTTCATT TTGGGGCCCGAAGGTTTTGGCGTCCTGAGCGTCTATGGCTCCACCGTAGGTCACACGATTATTGATCTGATGAGTAA AAATTGTTGGGGGTTGTTGGGACACTACCTGCGCGTCCTGATCCACGAGCACATATTGATTCACGGAGATATCCGCA AAACCACCAAACTGAACATCGGCGGAACGGAGATCGAGGTCGAGACTCTCGTCGAAGACGAAGCCGAGGCCGGAGCC GTGCCAGCGGCCGCC；

In the present invention, the ChR2 (Channelrhodopsin-2) encodes cationic channel protein, the indigo plant of 470nm wavelength Make cation after light illumination into cell, and excitatory cells are active；Utilize the electrical conductivity and rapid power of light sensation gene C hR2 Characteristic is learned, can not only realize and action potential is generated come Induction of neuronal by light；The excitability of nervous system can also be regulated and controled With the transitivity of cynapse.

Second aspect, the present invention provide a kind of carrier by described in first aspect and liposome, packaging helper plasmid corotation The recombinant adeno-associated virus that dye mammalian cell obtains；

Preferably, the liposome includes calcium phosphate, Lipofectamine 2000 or FnGENE, is preferably FnGENE.

Preferably, the mammalian cell is 293FT cells.

Preferably, the packaging helper plasmid includes pAAV-RC and/or pHepler.

The third aspect, the present invention provide a kind of carrier as described in relation to the first aspect and are used to prepare the medicine for adjusting parathyroid gland Object.

Fourth aspect, the present invention provide a kind of drug for including recombinant adeno-associated virus described in second aspect.

5th aspect, the present invention provide a kind of drug and blue light including as described in fourth aspect for adjusting parathyroid gland System.

Preferably, the wavelength of the blue light be 450-500nm, such as can be 450nm, 460nm, 470nm, 480nm, 490nm or 500nm is preferably 460-480nm.

Preferably, the frequency of the blue light be 15-25Hz, such as can be 15Hz, 16Hz, 17Hz, 18Hz, 19Hz, 20Hz, 21Hz, 22Hz, 23Hz, 24Hz or 25Hz are preferably 18-22Hz.

Preferably, the illumination mean intensity of the blue light is 8-12mW/mm², such as can be 8mW/mm²、9mW/mm²、 10mW/mm²、11mW/mm²Or 12mW/mm², it is preferably 9-11mW/mm²。

6th aspect, the present invention provides a kind of method of the adjusting parathyroid gland for non-treatment purpose, including walking as follows Suddenly：

(1) structure carries the slow virus of CMV promoter, photosensitizing effect and fluorogene；

(2) by step (1) the slow-virus infection human parathyroid chief cell, confirmatory experiment is carried out；

(3) using blue light stimulation step (2) metainfective cell, the detection PTH variations of collection condition culture medium；

(4) recombinant adeno-associated virus and infected rats parathyroid gland described in second aspect are built, first is stimulated using blue light Gland by shape collects serum, detection PTH concentration, blood calcium and the variation of serium inorganic phosphorus concentration；

Optionally, the method further includes the adeno-associated virus disease infection described in structure second aspect after step (3) Parathyroid Gland In Rat tissue, using blue light stimulate tissue, collect culture medium detection PTH concentration.

Preferably, the time of step (3) described stimulation be 20-40min, such as can be 20min, 22min, 24min, 25min, 26min, 28min, 30min, 32min or 35min are preferably 25-35min.

Preferably, the method for step (4) described infection is by virus injection Parathyroid Gland In Rat, per side injection 0.2-0.5 Microlitre, such as can be 0.2 microlitre, 0.3 microlitre, 0.4 microlitre or 0.5 microlitre.

Preferably, the time point of step (4) described stimulation is 18-22 days after infection, for example, can be 18 days, 19 days, 20 My god, 21 days or 22 days.

Preferably, the method for the detection is ELISA.

First, with slow virus, (lenti-CMV-ChETA-eYFP, promoter CMV belong to broad spectrum activity startup to inventor Son can infect all cells, not have selectivity) infection people source chief cell, light regulation and control after find in cellular water It is flat effectively, reversibly to inhibit PTH secretions.To realize cell selective, and the adeno-associated virus for devising PTH promoters carries Body, and the parathyroid gland of rat is infected after virus by being packaged into, it is found that the first that rat has expressed virus is taken out in operation Gland can inhibit its PTH secretions by shape after stimulating in vitro, and function can be recovered.And after carrying out light stimulus directly in rat body, It was found that inhibition PTH secretions that can also be reversible, meanwhile, also have adjusted calcium phosphorus balance in blood.

As optimal technical scheme, the present invention provides a kind of method for adjusting parathyroid gland, specifically comprises the following steps：

(1) structure carries the slow virus of CMV promoter, photosensitizing effect and fluorogene；

(2) by step (1) the virus infection human parathyroid chief cell, confirmatory experiment is carried out；

(3) using blue light stimulation step (2) metainfective cell, the detection PTH variations of collection condition culture medium；

(4) build recombinant adeno-associated virus described in second aspect and inject Parathyroid Gland In Rat, it is micro- per side injection 0.2-0.5 It rises, the 18-22 days separated Parathyroid Tissues stimulated using blue light after infection, collects culture medium detection PTH concentration；

(5) step (4) recombinant adeno-associated virus is injected into Parathyroid Gland In Rat, per 0.2-0.5 microlitres of side injection, sense Parathyroid gland was stimulated using blue light in 18-22 days after dye, collect serum, detection PTH concentration, blood calcium and the variation of serium inorganic phosphorus concentration；

Wherein, the wavelength of step (3), step (4) and step (5) described blue light be 450-500nm, frequency 15-25Hz, Illumination mean intensity is 8-12mW/mm², time 20-40min.

Compared with prior art, the present invention has the advantages that：

Carrier provided by the invention being capable of Prepare restructuring adenovirus and the adjusting first comprising the recombined adhenovirus and blue light The system of gland by shape, can high space-time accurately specific regulatory control chief cell, adjust the release of its PTH；It is this Body special PTH regulation systems and method, can evade that drug effect scope is excessively wide, and poor specificity, the unconspicuous drawback of effect can Effectively maintain Serum Calcium Phosphorus balance.

Description of the drawings

Fig. 1 is the primary human parathyroid chief cell culture systems immunostaining qualification figure of the embodiment of the present invention 2, wherein scheming 1 (A) is undyed cytological map, and Fig. 1 (B) is PTH colored graphs, and Fig. 1 (C) is CasR calcium ion receptor colored graphs, and Fig. 1 (D) is VDR vitamin D receptor colored graphs；

Fig. 2 is the virus infected cell coloration result figure of the embodiment of the present invention 2, and wherein Fig. 2 (A) is with photosensitizing effect The fluorogram of slow virus infected cell, Fig. 2 (B) are the fluorogram not with the slow virus infected cell of photosensitizing effect；

Fig. 3 is the experiment flow figure of the embodiment of the present invention 3, and wherein Fig. 3 (A) is experimental procedure figure, and Fig. 3 (B) shines for blue light Cell experiment figure is penetrated, Fig. 3 (C) is blue light illumination cell principle figure；

Fig. 4 is the result figure of the embodiment of the present invention 3, and wherein Fig. 4 (A) is testing result before stimulation, and Fig. 4 (B) is small for stimulation 1 When after testing result, Fig. 4 (C) for stimulate 6 it is small when after testing result；

Fig. 5 is the experimentation figure of the embodiment of the present invention 4, and wherein Fig. 5 (A) is rat internal anatomy, and Fig. 5 (B) is by first shape Gland expresses viral schematic diagram, the rat first side glandular tissue schematic diagram that Fig. 5 (C) takes out for operation, Fig. 5 (D) blue light illumination figure；

Fig. 6 is the result figure of the embodiment of the present invention 4, and wherein Fig. 6 (A) is the block diagram of PTH, and Fig. 6 (B) is the column of total protein Shape figure, Fig. 6 (C) are rAAV-PTH-hChR2 (H134R)-mcherry-WPRE-pA plasmid sequence figures；

Fig. 7 is the experimentation figure of the embodiment of the present invention 5, and wherein Fig. 7 (A) is rat internal anatomy, and Fig. 7 (B) is in body light Schematic diagram is stimulated, Fig. 7 (C) expresses schematic diagram for gland injecting virus restrovirus by rat first；

Fig. 8 is the result figure of the embodiment of the present invention 5, and wherein Fig. 8 (A) is PTH concentration maps, and Fig. 8 (B) is calcium ion concentration Figure, Fig. 8 (C) are phosphate ion concentration figure.

Specific embodiment

Further to illustrate the present invention technological means and its effect taken, below in conjunction with attached drawing and pass through specific reality The technical solution for applying mode to further illustrate the present invention, but the present invention is not limited in scope of embodiments.

Embodiment 1

It builds and packs the adeno-associated virus of the CMV promoter slow virus for carrying light responsive gene and PTH promoters：Using Three plasmid methods packaging slow virus (target gene, P Δs and VSVG) and adeno-associated virus (target gene, pAAV-RC and pHelper)；By taking slow virus is packed as an example, general procedure is as follows：By P Δs (15 μ g), VSVG (7 μ g) and carry light sensation gene, Target gene plasmid (the 22 μ g) mixing of green fluorescence gene and corresponding promoter, utilizes liposome FnGENE (Invitrogen) It is transfected together into 293FT cells and is packed, use virus production culture medium (DMEM containing 5mM Sodium Pyruvates) instead afterwards for 24 hours Continue to cultivate, collect culture medium supernatant 1000rpm afterwards for 24 hours and centrifuge five minutes, take supernatant；0.45 μm of membrane filtration cell residue Afterwards, filtrate is transferred in centrifuge tube, and 20% sucrose filter column is spread in bottom, using low temperature Ultracentrifuge at 4 degree, Virion 2h is deposited under 20000rpm rotating speeds, is gone after supernatant with sterile PBS by 1:1000 volume ratio is to centrifuging bottom of the tube Virion is resuspended, and the virus titer of acquisition is up to 3 × 10⁸T Μ/more than mL.

Embodiment 2

It establishes primary human parathyroid chief cell culture systems and carries out immunostaining identification, as a result such as Fig. 1 (A)-Fig. 1 (D) shown in；

From Fig. 1 (A)-Fig. 1 (D), it is successfully established the culture systems of human parathyroid chief cell and dyes success；

The viral solution of the slow virus of acquisition is pressed 1:200 volume ratio is mixed into serum-free without in dual anti-DMEM, for feeling Contaminate human parathyroid chief cell；12 it is small when after, the culture solution containing virus is changed to and fresh contains 10% hyclone and 1% pair Anti- DMEM, continue culture 48 it is small when, fluorescence microscopy Microscopic observation, the result is shown in Fig. 2 (A) and Fig. 2 (B) Suo Shi；

From Fig. 2 (A) and Fig. 2 (B), green fluorescent label albumen is observed, prompt light sensation genetic marker parathyroid gland Chief cell success.

Embodiment 3

With 470nm, 20Hz and 10mW/mm²Blue light stimulate cell 30 minutes, 1h, 2h, 4h after stimulation respectively, 6h and Collection condition culture medium for 24 hours, ELISA detection PTH secretion variations, experiment flow are shown in Fig. 3 (A)-Fig. 3 (C), and experimental result is shown in Fig. 4 (A)-Fig. 4 (C)；

From Fig. 4 (A)-Fig. 4 (C), after light stimulus 1 it is small when photogene group culture medium PTH concentration significantly lower than only table Up to the gutless control group of fluorescin, then recovered normal level at 6 hours.

Embodiment 4

Parathyroid Gland In Rat tissue is infected using the adeno-associated virus of the PTH promoters of structure, by photogene table Reach on chief cell.(0.4 microlitre per side) injects the parathyroid gland of rat by the viral vectors for carrying light sensation gene, After injecting 21 days expressing viral situation is monitored by observing luciferase expression situation；Separated parathyroid gland is carried out using blue light It stimulates, and culture medium detection PTH concentration is collected in Each point in time, experimentation is shown in Fig. 5, and the result is shown in Fig. 6 (A) and Fig. 6 (B) institute Show, shown in plasmid map such as Fig. 6 (C) of adeno-associated virus；

From Fig. 6 (A) and Fig. 6 (B), ELISA testing results show that light stimulus can effectively inhibit PTH and release in a short time It puts, and as a child recovered normal 6.

Embodiment 5

Horizontal in body in animal, PTH promoter AAV viruses are injected in Parathyroid Gland In Rat after three weeks, with blue light in first shape Other gland position is stimulated, and illumination mean intensity is 10mW/mm2, is collected respectively before stimulating, 5 minutes after stimulation, 15 points after stimulation Clock serum, elisa assay PTH concentration, blood calcium and the variation of serium inorganic phosphorus concentration, experimentation are shown in Fig. 7, as a result such as Fig. 8 (A)-Fig. 8 (C) It is shown；

From Fig. 8 (A)-Fig. 8 (C), it can effectively inhibit PTH in body stimulation in rats parathyroid gland and secrete in short-term, and to calcium Phosphorus has adjustment effect.

In conclusion carrier provided by the invention and its recombinant adeno-associated virus of preparation can close composition with indigo plant and adjust first The system of gland by shape reaches the function that high space-time high-precision specificity adjusts parathormone secretion, before having wide application Scape and market value.

Applicant states that the present invention illustrates the method detailed of the present invention, but not office of the invention by above-described embodiment It is limited to above-mentioned method detailed, that is, does not mean that the present invention has to rely on above-mentioned method detailed and could implement.Technical field Technical staff it will be clearly understood that any improvement in the present invention, equivalence replacement and auxiliary element to each raw material of product of the present invention Addition, selection of concrete mode etc., all fall within protection scope of the present invention and the open scope.

Sequence table

<110>Shenzhen Institutes of Advanced Technology, Chinese Academy of Science

<120>A kind of carrier of regulation and control parathyroid gland PTH secretions and its application

<130> 2017

<141> 2017-12-25

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 925

<212> DNA

<213>Artificial synthesized ()

<400> 1

ctggagttca aagaagggct gtatttctag gcagaaactg aggtagtaag aatctggtgt 60

cataaagacc tttgttgaat tccatctttt ctgctttcca agcctaagtt tcctcatgta 120

aaaatgggga taagcactta actttagtac tttaagtact aactttaaag gactgctgtg 180

aagatctagt gggataatat atgtagttag gcatgcagtt agtgcttatc aaatgttatt 240

attatagatt aagatgcaca aataaaatat aagttaaata aattttaaaa taatttcact 300

tttgaagctt ttaaagtaat tatgtactaa gagcattttc tcaaattatt cttaacactt 360

cctttaagaa aagggctata tctgtttttt gaaagatgac cagaagtgac atggattggt 420

tgaaaatggc ttgtaaagta agcctaacat ttatgattta ttaccataaa aactgtacca 480

acagtacggt tataacaaat acacttattt ttgggtttta ttttcaagta agataatgac 540

tttatcataa acctttgaaa tcagtctttt tacagtataa attcagattc attaatccac 600

atagaatttt tctcgatggt ataattctgt atttgttaaa agtctttgca taagcccctt 660

gtcaagccaa atgctgtttt ccttttagta tccaattatc tgaaacttaa gaagagtgtg 720

caccgcccaa tgggtgtgtg tatgtgctgc tttgaaccta tagttgagat ccagagaatt 780

gggagtgaca tcatctgtaa caataaaaga gcctctcttg gtaagcagaa gacctatata 840

taaaagtcac catttaaggg gtctgcagtc caattcatca gttgtcttta gtttactcag 900

catcagctac taacatacct gaacg 925

<210> 2

<211> 939

<212> DNA

<213>Artificial synthesized ()

<400> 2

atggactatg gcggcgcttt gtctgccgtc ggacgcgaac ttttgttcgt tactaatcct 60

gtggtggtga acgggtccgt cctggtccct gaggatcaat gttactgtgc cggatggatt 120

gaatctcgcg gcacgaacgg cgctcagacc gcgtcaaatg tcctgcagtg gcttgcagca 180

ggattcagca ttttgctgct gatgttctat gcctaccaaa cctggaaatc tacatgcggc 240

tgggaggaga tctatgtgtg cgccattgaa atggttaagg tgattctcga gttctttttt 300

gagtttaaga atccctctat gctctacctt gccacaggac accgggtgca gtggctgcgc 360

tatgcagagt ggctgctcac ttgtcctgtc atccttatcc gcctgagcaa cctcaccggc 420

ctgagcaacg actacagcag gagaaccatg ggactccttg tctcagacat cgggactatc 480

gtgtgggggg ctaccagcgc catggcaacc ggctatgtta aagtcatctt cttttgtctt 540

ggattgtgct atggcgcgaa cacatttttt cacgccgcca aagcatatat cgagggttat 600

catactgtgc caaagggtcg gtgccgccag gtcgtgaccg gcatggcatg gctgtttttc 660

gtgagctggg gtatgttccc aattctcttc attttggggc ccgaaggttt tggcgtcctg 720

agcgtctatg gctccaccgt aggtcacacg attattgatc tgatgagtaa aaattgttgg 780

gggttgttgg gacactacct gcgcgtcctg atccacgagc acatattgat tcacggagat 840

atccgcaaaa ccaccaaact gaacatcggc ggaacggaga tcgaggtcga gactctcgtc 900

gaagacgaag ccgaggccgg agccgtgcca gcggccgcc 939

Claims (10)

1. a kind of carrier of regulation and control parathyroid gland PTH secretions, which is characterized in that the carrier is including photosensitizing effect and/or specifically Property identification chief cell PTH promoters；

The nucleotide sequence of the PTH promoters such as SEQ ID NO:Shown in 1.

2. carrier according to claim 1, which is characterized in that the photosensitizing effect is ChR2；

Preferably, the nucleotide sequence of the ChR2 such as SEQ ID NO:Shown in 2.

3. a kind of recombinant adeno-associated virus, which is characterized in that aid in the carrier described in claim 1 or 2 and liposome, packaging The recombinant adeno-associated virus that plasmid co-transfection mammalian cell obtains；

Preferably, the liposome includes calcium phosphate, Lipofectamine 2000 or FnGENE, is preferably FnGENE；

Preferably, the mammalian cell is 293FT cells；

Preferably, the packaging helper plasmid includes pAAV-RC and/or pHelper..

4. a kind of carrier as claimed in claim 1 or 2 is used to prepare the drug for adjusting parathyroid gland.

5. a kind of drug, which is characterized in that the drug includes the recombinant adeno-associated virus described in claim 3.

6. a kind of system for adjusting parathyroid gland, which is characterized in that including drug as claimed in claim 5 and blue light；

Preferably, the wavelength of the blue light is 450-500nm, is preferably 460-480nm；

Preferably, the frequency of the blue light is 15-25Hz, is preferably 18-22Hz；

Preferably, the illumination mean intensity of the blue light is 8-12mW/mm², it is preferably 9-11mW/mm²。

7. a kind of method of adjusting parathyroid gland for non-treatment purpose, which is characterized in that include the following steps：

(1) structure carries the slow virus of CMV promoter, photosensitizing effect and fluorogene；

(2) by step (1) the slow-virus infection human parathyroid chief cell, confirmatory experiment is carried out；

(3) using blue light stimulation step (2) metainfective cell, culture medium detection PTH variations are collected；

Optionally, the method further includes the simultaneously infected rats Parathyroid Tissue of adeno-associated virus described in structure claim 3, adopts Tissue is stimulated with blue light and collects culture medium detection PTH concentration；

(4) recombinant adeno-associated virus and infected rats parathyroid gland described in claim 3 are built, is stimulated using blue light by first shape Gland collects serum, detection PTH concentration, blood calcium and the variation of serium inorganic phosphorus concentration.

8. the method according to the description of claim 7 is characterized in that the time of step (3) described stimulation is 20-40min, preferably For 25-35min.

9. the method according to claim 7 or 8, which is characterized in that the method for step (4) described infection is by virus injection Parathyroid Gland In Rat, per 0.2-0.5 microlitres of side injection；

Preferably, the time point of step (4) described stimulation is 18-22 days after infection；

Preferably, the method for the detection is ELISA.

A kind of 10. method for adjusting parathyroid gland, which is characterized in that specifically comprise the following steps：

(1) structure carries the slow virus of CMV promoter, photosensitizing effect and fluorogene；

(2) by step (1) the virus infection human parathyroid chief cell, confirmatory experiment is carried out；

(3) using blue light stimulation step (2) metainfective cell, culture medium detection PTH variations are collected；

(4) build adeno-associated virus described in claim 3 and inject Parathyroid Gland In Rat, per 0.2-0.5 microlitres of side injection, use Blue light stimulates the separated Parathyroid Tissue of 18-22 days after infection, collects culture medium detection PTH concentration；

(5) step (4) adeno-associated virus is injected into Parathyroid Gland In Rat, per 0.2-0.5 microlitres of side injection, 18- after infection Parathyroid gland was stimulated using blue light in 22 days, collect serum, detection PTH concentration, blood calcium and the variation of serium inorganic phosphorus concentration；

Wherein, the wavelength of step (3), step (4) and step (5) described blue light be 450-500nm, frequency 15-25Hz, illumination Mean intensity is 8-12mW/mm², time 20-40min.