CN108070583B - Application of hydroxypropyl-beta-cyclodextrin in preparation of nucleic acid freeze-drying protective agent - Google Patents
Application of hydroxypropyl-beta-cyclodextrin in preparation of nucleic acid freeze-drying protective agent Download PDFInfo
- Publication number
- CN108070583B CN108070583B CN201610977454.3A CN201610977454A CN108070583B CN 108070583 B CN108070583 B CN 108070583B CN 201610977454 A CN201610977454 A CN 201610977454A CN 108070583 B CN108070583 B CN 108070583B
- Authority
- CN
- China
- Prior art keywords
- beta
- hydroxypropyl
- cyclodextrin
- concentration
- use according
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6806—Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
Abstract
The invention discloses application of hydroxypropyl-beta-cyclodextrin in preparation of a nucleic acid freeze-drying protective agent. The hydroxypropyl-beta-cyclodextrin or the hydroxypropyl-beta-cyclodextrin water solution is used as a DNA freeze-drying protective agent to have a good protection effect on DNA, the composition H and the solution H are used as RNA freeze-drying protective agents to have a good protection effect on RNA, and the method has no influence on operations such as nucleic acid quantitative analysis, subsequent DNA enzyme digestion, PCR/RT-PCR amplification, fluorescent quantitative PCR/RT-PCR amplification and the like. RNA, hydroxypropyl-beta-cyclodextrin and DEPC are mixed and then freeze-dried, the variation coefficient of the RNA is 5.90 percent within 6 months of normal temperature storage, the RNA is obviously superior to the variation coefficient of liquid storage at the temperature of 70 ℃ below zero (the variation coefficient is 13.33 percent), and the storage condition does not need complex equipment such as an ultra-low temperature refrigerator at the temperature of 70 ℃ below zero, and the RNA sample is beneficial to long-distance transportation and storage.
Description
Technical Field
The invention relates to application of hydroxypropyl-beta-cyclodextrin in the field of molecular biology, in particular to application of hydroxypropyl-beta-cyclodextrin in preparing a nucleic acid freeze-drying protective agent.
Background
Nucleic acid, one of the most basic substances of life, is an important object for life science research and biological detection, and is also an important composition of biological nucleic acid products and nucleic acid reagents, and is classified into two categories, ribonucleic acid (RNA) and deoxyribonucleic acid (DNA), according to the difference in chemical composition.
Nucleic acid as biological macromolecule is easy to degrade under natural condition, and its stable storage technology has important effect on developing and producing nucleic acid sample, nucleic acid standard substance, nucleic acid kit and nucleic acid vaccine. Therefore, the advanced nucleic acid preservation technology has wide application prospect in the fields of medical biology diagnosis and detection, animal and plant inspection and quarantine, and the like.
At present, two methods are commonly used for storing DNA at home and abroad, one is ultra-low temperature cryopreservation in a liquid form after dissolving DNA by TE, and the other is storage or transportation after freeze-drying DNA samples into solids. However, the DNA volume is small, the DNA can not be distinguished by naked eyes after freeze drying, and the DNA is easy to lose in use, thereby influencing subsequent tests. As for RNA, since RNase is almost ubiquitous, it is difficult to store RNA after extraction, and a method of storing RNA in the fresh state or in a short period at-70 ℃ is generally used. On one hand, the complex equipment such as a refrigerator with the temperature of 70 ℃ below zero is required to be equipped, on the other hand, the long-distance transportation of nucleic acid is not facilitated, and great inconvenience is brought to experimental operation. There is therefore a need for a lyoprotectant that provides a solid support for nucleic acids while extending the shelf life of the nucleic acids at conventional temperatures without affecting subsequent testing.
Hydroxypropyl-beta-Cyclodextrin (HP-beta-CD), molecular formula of which is C63H112O42CAS number 128446-35-5. Hydroxypropyl-beta-cyclodextrin is an amorphous beta-cyclodextrin derivative obtained by substituting hydrogen atoms of hydroxyl groups at positions 2, 3 and 6 of cyclodextrin with hydroxypropyl. The introduction of hydroxypropyl breaks through intramolecular cyclic hydrogen bonds of beta-cyclodextrin, overcomes the main defect of poor water solubility of the beta-cyclodextrin while maintaining the cavity of the cyclodextrin, is one of the most extensively-applied cyclodextrin derivatives which are the most deeply researched at present, and is mainly applied to the industries of food, medicines and cosmetics as a clathrating agent.
Disclosure of Invention
The invention aims to solve the technical problem of how to store the freeze-dried nucleic acid for a long time at normal temperature, make the microscopic invisible nucleic acid macroscopic and enhance the visibility of experimental operation.
In order to solve the technical problems, the invention provides application of hydroxypropyl-beta-cyclodextrin or hydroxypropyl-beta-cyclodextrin aqueous solution in preparation of a nucleic acid freeze-drying protective agent.
In the above application, the nucleic acid may be DNA and/or RNA.
The application of hydroxypropyl-beta-cyclodextrin or hydroxypropyl-beta-cyclodextrin aqueous solution as a DNA freeze-drying protective agent also belongs to the protective scope of the invention.
In the above two applications, the concentration of the hydroxypropyl-beta-cyclodextrin aqueous solution can be determined by those skilled in the art according to the effect of nucleic acid freeze-drying, and specifically can be 50mg/mL, 1mg/mL-50mg/mL, 5mg/mL-50mg/mL, 10mg/mL-50mg/mL, 20mg/mL-50mg/mL, 1mg/mL-5mg/mL, 5mg/mL-10mg/mL, 5mg/mL-20mg/mL, 10mg/mL-20mg/mL, 50mg/mL-500mg/mL, or 1mg/mL-500 mg/mL.
The invention also provides application of the composition H in preparing the RNA freeze-drying protective agent, wherein the composition H consists of hydroxypropyl-beta-cyclodextrin and diethyl pyrocarbonate (DEPC).
In the composition H, the mass ratio of the hydroxypropyl- β -cyclodextrin to the diethyl pyrocarbonate in the composition H can be determined by those skilled in the art according to the effect of nucleic acid freeze-drying, and specifically can be 50:1, 1-50: 1. 5-50: 1. 10-50: 1. 20-50: 1. 1-5: 1. 5-10: 1. 5-20: 1. 10-20: 1. 50-500:1 or 1-500: 1.
the invention also provides the application of the solution H as an RNA freeze-drying protective agent; the solution H is a solution consisting of a solute and a solvent, wherein the solute is hydroxypropyl-beta-cyclodextrin and DEPC, and the solvent is water.
In the solution H, the concentration of the hydroxypropyl-beta-cyclodextrin and the DEPC can be determined by a person skilled in the art according to the effect of nucleic acid freeze-drying, the concentration of the hydroxypropyl-beta-cyclodextrin can be specifically 50mg/mL, 1mg/mL-50mg/mL, 5mg/mL-50mg/mL, 10mg/mL-50mg/mL, 20mg/mL-50mg/mL, 1mg/mL-5mg/mL, 5mg/mL-10mg/mL, 5mg/mL-20mg/mL, 10mg/mL-20mg/mL, 50mg/mL-500mg/mL or 1mg/mL-500mg/mL, and the concentration of the DEPC can be specifically 1 mg/mL.
The invention also provides an RNA freeze-drying protective agent which is a or b, wherein a is the composition H, and b is the solution H.
Any one of the applications or the application of the nucleic acid freeze-drying protective agent in preparing nucleic acid products also belongs to the protection scope of the invention.
The nucleic acid product is a product containing nucleic acid, such as a nucleic acid sample, a nucleic acid standard substance, a nucleic acid probe, a primer, a nucleic acid detection kit or a nucleic acid molecular diagnosis kit and the like.
The nucleic acid may be an ex vivo (isolated) nucleic acid. The water may be ultrapure water.
The test result shows that the hydroxypropyl-beta-cyclodextrin or the hydroxypropyl-beta-cyclodextrin water solution has good protection effect on DNA by being used as a DNA freeze-drying protective agent, the composition H and the solution H have good protection effect on RNA by being used as an RNA freeze-drying protective agent, and the method has no influence on operations such as nucleic acid quantitative analysis, subsequent DNA enzyme digestion, PCR/RT-PCR amplification, fluorescent quantitative PCR/RT-PCR amplification and the like. RNA, hydroxypropyl-beta-cyclodextrin and DEPC are mixed and then freeze-dried, the variation coefficient of the RNA is 5.90 percent within 6 months of normal temperature storage, the RNA is obviously superior to the variation coefficient of liquid storage at the temperature of 70 ℃ below zero (the variation coefficient is 13.33 percent), and the storage condition does not need complex equipment such as an ultra-low temperature refrigerator at the temperature of 70 ℃ below zero, and the RNA sample is beneficial to long-distance transportation and storage. The hydroxypropyl-beta-cyclodextrin and the DEPC have low price and are easy to obtain, and can be widely applied to production and manufacture of nucleic acid freeze drying and long-term storage and scientific research practice.
Drawings
FIG. 1 shows the states of various hydroxypropyl-beta-cyclodextrin solutions after freeze-drying.
From left to right, 100 ng/. mu.L of DNA solution was lyophilized; 1mg/mL, 5mg/mL, 10mg/mL, 20mg/mL, 50mg/mL, 100mg/mL and 500mg/mL hydroxypropyl-beta-cyclodextrin solutions.
FIG. 2 is a full wavelength scan of a 500mg/mL hydroxypropyl-cyclodextrin solution.
FIG. 3 shows the effect of different concentrations of hydroxypropyl-. beta. -cyclodextrin on plasmid DNA cleavage.
FIG. 4 is a fluorescent quantitative reaction amplification curve of duck tembusu virus containing hydroxypropyl-beta-cyclodextrin at different concentrations and DEPC at 1 mg/ml.
Detailed Description
The present invention is described in further detail below with reference to specific embodiments, which are given for the purpose of illustration only and are not intended to limit the scope of the invention. The experimental procedures in the following examples are conventional unless otherwise specified. Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.
TE buffer in the following examples: the solvent was ultrapure water, and the solutes were 10mmol/L Tris-HCl (pH 8.0) and 1mmol/L EDTA (pH 8.0).
Hydroxypropyl-beta-cyclodextrin (HP-beta-CD) in the examples below is a product of bainwei technologies ltd, beijing.
The duck plague virus (DVEV) strain in the following examples was VR-684, and was the ATCC product.
The duck tembusu virus (DTMUV) strain in the examples described below is jxsp (duck TMUV-jxsp) (DuckTembusu virus exhibits neurovironment in BALB/c micro.li et al virology journal 2013,10:260) publicly available from the applicant, this biomaterial being only used for repeating the experiments related to the present invention, and not for other uses.
Freeze drying, as used herein, is a drying process in which an aqueous material is frozen below freezing to convert water to ice, which is then removed by converting the ice to a vapor under a relatively high vacuum. In the following examples, freeze drying was performed in an atmosphere of a vacuum degree of 0.001 MPa.
Example 1 application of hydroxypropyl-beta-cyclodextrin in preparation of nucleic acid lyophilization protectant
1. Research on volume change of hydroxypropyl-beta-cyclodextrin with different concentrations after freeze drying
Hydroxypropyl-. beta. -cyclodextrin powder was prepared into 1mg/mL, 5mg/mL, 10mg/mL, 20mg/mL, 50mg/mL, 100mg/mL and 500mg/mL solutions with ultrapure water, 0.8mL of each solution was put into a 1.5mL centrifuge tube and freeze-dried at-20 ℃ to observe the form of the solid content of the solution after freeze-drying, and a freeze-dried sample of 100 ng/. mu.L of DNA solution (solvent TE buffer) was used as a control.
The results show that the solid powder formed by directly lyophilizing the DNA solution (the solvent is TE buffer solution) can not be observed by naked eyes, while the hydroxypropyl-beta-cyclodextrin solution has obvious solid form after being lyophilized. When the concentration of the hydroxypropyl-beta-cyclodextrin solution is more than 5mg/mL, namely 5mg/mL to 500mg/mL, the volume of the solid component after freeze drying is basically unchanged, and is not obviously changed from the original volume of 0.8mL solution; when the concentration of the hydroxypropyl-beta-cyclodextrin solution is 1mg/mL, the volume of the solid component after freeze drying is obviously reduced compared with the original 0.8mL solution, but the solid component can still be obviously observed and can be used for subsequent operations such as dissolution and the like (figure 1). 1mg/mL-500mg/mL hydroxypropyl-beta-cyclodextrin solution after being re-dissolved by ultrapure water can be quickly dissolved within 15 seconds.
2. Effect of hydroxypropyl-beta-cyclodextrin on nucleic acid quantitation
Taking hydroxypropyl-beta-cyclodextrin powder, preparing a solution of 500mg/mL by using ultrapure water, and performing full-wavelength scanning by using NanodropND 1000. As shown in FIG. 2, the hydroxypropyl-beta-cyclodextrin has no obvious characteristic absorption peak in the range of 220nm to 750nm, the absorption value is in a descending trend, the absorption value at 260nm is less than 0.1, and the ultraviolet spectrophotometric quantitative influence on nucleic acid is limited.
Each of 1mg/mL DNA solution (solvent is ultrapure water) and 1mg/mL RNA solution (solvent is ultrapure water, using ultrapure water and 500mg/mL hydroxypropyl-. beta. -cyclodextrin solution (solvent is ultrapure water) diluted to 10ng/mL, 50ng/mL and 100ng/mL DNA or RNA solutions, respectively, and OD260 was measured by Nanodrop ND1000, and the results are shown in Table 1.
TABLE 1 measurement results of DNA solution diluted with ultrapure water and hydroxypropyl-beta-cyclodextrin solution, respectively
As can be seen from Table 1, the nucleic acid solutions containing hydroxypropyl- β -cyclodextrin and those without hydroxypropyl- β -cyclodextrin, whether DNA or RNA, did not differ significantly in their concentration when measured (P > 0.05).
3. Effect of hydroxypropyl-beta-Cyclodextrin on DNA restriction enzyme cleavage
In order to understand the influence of hydroxypropyl-beta-cyclodextrin on the enzyme digestion reaction of circular DNA, an upstream primer atcaaaagataacatgcatt and a downstream primer tagatgatttctgcaccatc are adopted to amplify the avian influenza virus NA6 gene by PCR to obtain a target fragment 1360bp with the sequence being the sequence 1 in the sequence table.
The target fragment is recovered and connected to pEASY T3 vector (product of Beijing Quanji Biotechnology Co., Ltd.) to obtain recombinant plasmid pEASY T3-NA6, and the sequence is verified to be correct by sequencing. The plasmid has a total length of 4.4kb and contains two EcoRI (in the T vector) and one BamHI (in the insert) cleavage sites. 4 identical EcoRI digestion reaction systems (first to fourth EcoRI digestion reaction systems) were prepared, each consisting of the following components: 10 XH Buffer 2. mu.l, EcoRI enzyme 0.7. mu.l (product of TaKaRa Co.), sterile purified water 15.3. mu.l, plasmid 2. mu.l. The first EcoRI cleavage reaction was named 0mg/mL HP- β -CD system. Adding hydroxypropyl-beta-cyclodextrin into a second EcoRI enzyme digestion reaction system, wherein the content of the hydroxypropyl-beta-cyclodextrin is 10mg/mL, and the obtained system is named as a 10mg/mL HP-beta-CD system. Adding hydroxypropyl-beta-cyclodextrin into a third EcoRI enzyme digestion reaction system, wherein the content of the hydroxypropyl-beta-cyclodextrin is 50mg/mL, and the obtained system is named as a 50mg/mL HP-beta-CD system. Adding hydroxypropyl-beta-cyclodextrin into a fourth EcoRI enzyme digestion reaction system, wherein the content of the hydroxypropyl-beta-cyclodextrin is 100mg/mL, and the obtained system is named as a 100 mg/mLHP-beta-CD system. The 0mg/mL HP- β -CD system, the 10mg/mL HP- β -CD system, the 50mg/mL HP- β -CD system, and the 100mg/mL HP- β -CD system were all cleaved overnight at 37 ℃. After the reaction was terminated, 5. mu.L of the digested product was subjected to agarose gel electrophoresis. The result shows that the enzyme digestion system contains hydroxypropyl-beta-cyclodextrin which has no influence on the enzyme digestion reaction of the circular DNA (figure 3).
In order to understand the influence of hydroxypropyl-beta-cyclodextrin on linear DNA digestion reaction, the recombinant plasmid pEASY T3-NA6 is digested with BamHI, and after the BamHI digestion product is recovered, 4 identical EcoRI digestion reaction systems (the first to the fourth EcoRI digestion reaction systems) are prepared, wherein each EcoRI digestion reaction system consists of the following components: 10 XH Buffer 2. mu.l, EcoRI enzyme 0.7. mu.l (product of TaKaRa Co.), sterile purified water 15.3. mu.l, and digested product 2. mu.l. The first EcoRI cleavage reaction was named 0mg/mL HP- β -CD system. Adding hydroxypropyl-beta-cyclodextrin into a second EcoRI enzyme digestion reaction system, wherein the content of the hydroxypropyl-beta-cyclodextrin is 10mg/mL, and the obtained system is named as a 10mg/mL HP-beta-CD system. Adding hydroxypropyl-beta-cyclodextrin into a third EcoRI enzyme digestion reaction system, wherein the content of the hydroxypropyl-beta-cyclodextrin is 50mg/mL, and the obtained system is named as a 50mg/mL HP-beta-CD system. Adding hydroxypropyl-beta-cyclodextrin into a fourth EcoRI enzyme digestion reaction system, wherein the content of the hydroxypropyl-beta-cyclodextrin is 100mg/mL, and the obtained system is named as a 100mg/mL HP-beta-CD system. The 0mg/mL HP- β -CD system, the 10mg/mL HP- β -CD system, the 50mg/mL HP- β -CD system, and the 100mg/mLHP- β -CD system were all cleaved overnight at 37 ℃. After the reaction was terminated, 5. mu.L of the EcoRI digested product was subjected to agarose gel electrophoresis. The result shows that the enzyme digestion system contains hydroxypropyl-beta-cyclodextrin, which has no influence on the enzyme digestion reaction of linear DNA.
4. Effect of hydroxypropyl-beta-cyclodextrin on fluorescent quantitative PCR
To understand the effect of hydroxypropyl- β -cyclodextrin on the fluorescent quantitative PCR, the primers and probes of table 2 were used to perform the fluorescent quantitative PCR reaction on duck plague virus (DVEV). The fluorescent quantitative PCR reaction system is as follows: 6.8 mu L of water, 10 mu L of 2 XGoTaqProbe qPCR Master Mix, 0.8 mu L of primer pair, 0.4 mu L of probe, 2 mu L of virus nucleic acid (template) and hydroxypropyl-beta-cyclodextrin, wherein the total reaction volume is 20 mu L.
Four fluorescent quantitative PCR reaction systems are arranged: 0mg/mL HP-beta-CD reaction system, 5mg/mL HP-beta-CD reaction system, 10mg/mL HP-beta-CD reaction system and 50mg/mL HP-beta-CD reaction system. The four fluorescent quantitative PCR reaction systems were identical except for the concentration of hydroxypropyl-. beta. -cyclodextrin (Table 2). The concentrations of hydroxypropyl-beta-cyclodextrin in the 0 mg/mLHP-beta-CD reaction system, the 5mg/mL HP-beta-CD reaction system, the 10mg/mL HP-beta-CD reaction system and the 50mg/mL HP-beta-CD reaction system are 0mg/mL, 5mg/mL, 10mg/mL and 50mg/mL respectively.
And (3) placing the sample in an ABI 7500fast real-time fluorescence quantitative PCR instrument for detection. The fluorescent quantitative PCR reaction program of the fluorescent quantitative PCR detection method is as follows: 2min at 95 ℃; 95 ℃ for 15s, 60 ℃ for 1min, 40 cycles.
TABLE 2 fluorescent quantitative PCR primers, probes, strains and reaction systems
The results show that the addition of the hydroxypropyl-beta-cyclodextrin with the concentrations has no obvious influence on the Ct value and the fluorescence intensity of the fluorescent quantitative PCR reaction, and the coefficient of variation is less than 0.2 percent (Table 3).
TABLE 3 fluorescent quantitative reaction Ct values of duck plague virus containing hydroxypropyl-beta-cyclodextrin at different concentrations
Note: 0. 5, 10 and 50 represent the 0mg/mL HP- β -CD reaction system, the 5mg/mL HP- β -CD reaction system, the 10mg/mL HP- β -CD reaction system and the 50mg/mL HP- β -CD reaction system, respectively.
5. Effect of hydroxypropyl-beta-cyclodextrin on fluorescent quantitation of RT-PCR
To understand the influence of hydroxypropyl-beta-cyclodextrin on the fluorescent quantitative RT-PCR, the primers and probes shown in Table 4 were used to perform the fluorescent quantitative RT-PCR reaction on the duck tembusu virus. The RT-PCR reaction system is as follows: 8.6 μ L of water, dNTP312.5 μmol/L, 5 × Colorless GoTaq Reaction Buffer 4 μ L, 0.7 μ M of upstream primer and downstream primer, 0.35pmol/μ L of probe, 0.075U/μ L of GoTaq DNA polymerase, 0.1U/μ L of AMV, 0.6U/μ L of RNase inhibitor, 2 μ L of viral nucleic acid (template), hydroxypropyl- β -cyclodextrin and 1mg/ml DEPC, and the total Reaction volume is 20 μ L. Four fluorescent quantitative RT-PCR reaction systems are arranged: 0mg/mL HP-beta-CD reaction system, 5mg/mL HP-beta-CD reaction system, 10mg/mL HP-beta-CD reaction system and 50mg/mL HP-beta-CD reaction system. The four fluorescent quantitative RT-PCR reaction systems were identical except for the concentration of hydroxypropyl-. beta. -cyclodextrin (Table 5). The concentrations of hydroxypropyl-beta-cyclodextrin in the 0mg/mL HP-beta-CD reaction system, the 5mg/mL HP-beta-CD reaction system, the 10mg/mL HP-beta-CD reaction system and the 50mg/mL HP-beta-CD reaction system are 0mg/mL, 5mg/mL, 10mg/mL and 50mg/mL respectively.
The reaction system of the fluorescent quantitative RT-PCR detection method is placed in an ABI 7500fast real-time fluorescent quantitative PCR instrument for detection. The fluorescent quantitative RT-PCR reaction program of the fluorescent quantitative RT-PCR detection method is as follows: 10min at 45 ℃; 10min at 95 ℃; 95 ℃ for 15s, 60 ℃ for 45s, 40 cycles.
TABLE 4 fluorescent quantitative RT-PCR primers, probes
| Components | Sequence (5 '-3') |
| Upstream primer | CAGTTTTCATACATGGTTCCACG |
| Downstream primer | CGGTACCATAATCCTCCATCTCAGC |
| Probe needle | FAM-AGCCCAGCAGTCGC-MGB |
TABLE 5 fluorescent quantitative RT-PCR reaction System
As shown in FIG. 4 and Table 6, the above hydroxypropyl- β -cyclodextrin and DEPC at several concentrations had no significant effect on the Ct value and fluorescence intensity of the fluorescent quantitative RT-PCR reaction, and the coefficient of variation was less than 1.6%.
TABLE 6 Duck Tembusu virus fluorescent quantitative reaction Ct values containing hydroxypropyl-beta-cyclodextrin and DEPC at different concentrations and 1mg/ml
Note: 0. 5, 10 and 50 represent the 0mg/mL HP- β -CD reaction system, the 5mg/mL HP- β -CD reaction system, the 10mg/mL HP- β -CD reaction system and the 50mg/mL HP- β -CD reaction system, respectively.
6. Effect of hydroxypropyl-beta-cyclodextrin on the stability of nucleic acid standards
The currently used methods for storing nucleic acid mainly include two methods, one is ultra-low temperature cryopreservation in a liquid form after TE reconstitution, and the other is normal temperature storage or transportation after freeze-drying liquid nucleic acid into solid. However, both of the two methods have certain defects, the nucleic acid is easy to degrade when the nucleic acid is stored in a liquid state for too long time, and particularly, the subsequent test definite value is seriously influenced by an RNA sample; however, the direct freeze-drying of nucleic acid is almost indistinguishable by naked eyes, and is easy to cause a certain loss in subsequent tests, and one tube must be completely redissolved at a time, and each tube of sample cannot be reused. The nucleic acid is re-dissolved by the hydroxypropyl-beta-cyclodextrin solution and then is freeze-dried, and the nucleic acid can be seen by naked eyes due to the solid-phase supporting effect of the hydroxypropyl-beta-cyclodextrin, so that the nucleic acid cannot be lost, and the nucleic acid can be taken at any time by means of quantitative weighing, thereby being beneficial to the smooth development of later tests.
To understand the effect of hydroxypropyl- β -cyclodextrin on the stability of nucleic acid solution, the stability test was performed in the three storage methods of duck plague virus nucleic acid (DNA) solution (with the solvent TE) and duck tembusu virus nucleic acid (RNA) solution (with the solvent TE) in this example. The method comprises the following specific steps:
the experimental groups were as follows:
freeze-drying cyclodextrin at normal temperature: adding hydroxypropyl-beta-cyclodextrin into duck plague virus nucleic acid (DNA) solution until the content of hydroxypropyl-beta-cyclodextrin is 50mg/mL, and vacuum freeze drying (vacuum degree of 0.001MPa) and storing at room temperature (24-26 deg.C);
adding hydroxypropyl-beta-cyclodextrin and DEPC into duck tembusu virus nucleic acid (RNA) solution until the content of hydroxypropyl-beta-cyclodextrin is 50mg/mL and the content of DEPC is 1mg/mL, and performing vacuum freeze drying (vacuum degree of 0.001MPa) and then storing at room temperature (24-26 ℃);
freeze-drying at normal temperature: respectively carrying out vacuum freeze drying (vacuum degree of 0.001MPa) (direct freeze drying) on a duck plague virus nucleic acid (DNA) solution and a duck tembusu virus nucleic acid (RNA) solution, and storing at room temperature (24-26 ℃);
liquid state at-70 ℃: storing duck plague virus nucleic acid (DNA) solution and duck tembusu virus nucleic acid (RNA) solution at-70 deg.C.
Performing DNA content determination on the samples in the three storage forms by adopting the fluorescent quantitative PCR reaction of the duck plague virus in the step 4 when the samples are stored for 3 days, 1 week, 2 weeks, 1 month, 3 months, 6 months and 12 months respectively; and (3) respectively carrying out RNA content determination on the samples in the three storage forms by adopting the fluorescent quantitative RT-PCR reaction of the duck tembusu virus in the step 5 when the samples are stored for 3 days, 1 week, 10 days, 2 weeks, 1 month, 3 months and 6 months. For the assay, three replicates of each sample were designed and averaged for comparison of different storage times, with the results shown in table 7.
The results show that the three storage conditions have little influence on the stability of the DNA, and have no obvious difference, the coefficient of variation within 12 months is within 6.1%, but the DNA containing the cyclodextrin presents an obvious solid form after being freeze-dried, thereby being beneficial to subsequent experimental operation and observation. However, the influence of the three storage conditions on the RNA stability is obviously different, the corresponding target fragment cannot be detected after the RNA is freeze-dried and stored at normal temperature for 3 months, and the variation coefficient exceeds 31% within half a year, which indicates that the conditions are not favorable for the stable storage of the RNA. RNA, hydroxypropyl-beta-cyclodextrin and DEPC are mixed and then freeze-dried, the variation coefficient of the RNA is 5.90 percent within 6 months of normal temperature storage, the RNA is obviously superior to the variation coefficient of liquid storage at the temperature of 70 ℃ below zero (the variation coefficient is 13.33 percent), and the storage condition does not need complex equipment such as an ultra-low temperature refrigerator at the temperature of 70 ℃ below zero, and the RNA sample is beneficial to long-distance transportation and storage.
TABLE 7 Effect of three different storage conditions on the stability of nucleic acid standards
<110> Chinese animal epidemic prevention control center
Application of <120> hydroxypropyl-beta-cyclodextrin in preparation of nucleic acid freeze-drying protective agent
<160> 1
<170> PatentIn version 3.5
<210> 1
<211> 1360
<212> DNA
<213> Artificial sequence
<220>
<223>
<400> 1
atcaaaagat aacatgcatt tcagcaacag gagtaacact atcggtagta agcctgctaa 60
taggaatcgc caatttgggc ctaaatatcg gactacacta caaagtgagt gattcaacaa 120
ctataaacat tccaaacatg aatgagacca acccaacaac aacaaacatc actaacatta 180
tagtgaataa gaacgaagaa agaacatttc tcaacttgac caagccgcta tgtgaagtca 240
actcatggca cattctatcg aaagacaatg caataagaat aggtgaggat gctcatatac 300
tggtcacaag ggaaccttac ttgtcctgtg atccacaagg atgcaggatg tttgctctga 360
gtcaaggcac aacactcaga gggcgacatg cgaatggaac catacatgat aggagcccat 420
ttcgagctct tataagttgg gaaatgggtc aggcacccag tccatataat actagggtcg 480
aatgcatagg atggtcaagc acgtcatgcc atgatggcat atcaaggatg tcaatatgca 540
tatcaggacc gaataacaat gcatcggcag tggtgtggta cagggggaga ccagtaacag 600
aaatcccatc atgggcaggg aacattctta ggactcaaga atcagaatgt gtgtgccata 660
aaggaatctg cccagtggtc atgacagatg gtccagcaaa caacaaggca gcaactaaga 720
taatctactt caaagaggga aagatacaga aaattgaaga actgcaaggg aacgctcaac 780
acatcgaaga gtgttcatgc tacggagcag cagggatgat caaatgtgta tgcagagaca 840
attggaaggg ggcaaataga ccaataatca ctatagatcc cgaaatgatg acccacacaa 900
gcaaatactt gtgttcaaaa atcttaaccg acacaagtcg tcctaatgac cccaccaatg 960
ggaactgcga tgcgccaata acaggaggga gcccagaccc aggggtaaaa gggtttgcat 1020
tcctagacgg ggagagttca tggcttggaa ggacaattag caaagactcc agatcaggct 1080
acgaaatgtt aaaggtccca aatgcagaaa ccgacactca atcagggcca acctcatacc 1140
agctgattgt caacaaccaa aattggtcag ggtactcagg ggcattcata gactactggg 1200
caaccaagga atgcttcaat ccttgttttt atgtggagct aatcagaggg agacccaaag 1260
agagtgatgt actgtggact tccaatagca tggtagctct ctgtggatcc agggagcgat 1320
tgggatcatg gtcctggcat gatggtgcag aaatcatcta 1360
Claims (51)
1. The application of a composition H in preparing an RNA freeze-drying protective agent, wherein the composition H consists of hydroxypropyl-beta-cyclodextrin and diethyl pyrocarbonate.
2. Use according to claim 1, characterized in that: in the composition H, the mass ratio of the hydroxypropyl-beta-cyclodextrin to the diethyl pyrocarbonate is 1-500: 1.
3. use according to claim 2, characterized in that: in the composition H, the mass ratio of the hydroxypropyl-beta-cyclodextrin to the diethyl pyrocarbonate is 50-500: 1.
4. Use according to claim 2, characterized in that: in the composition H, the mass ratio of the hydroxypropyl-beta-cyclodextrin to the diethyl pyrocarbonate is 1-50: 1.
5. use according to claim 4, characterized in that: in the composition H, the mass ratio of the hydroxypropyl-beta-cyclodextrin to the diethyl pyrocarbonate is 5-50: 1.
6. use according to claim 5, characterized in that: in the composition H, the mass ratio of the hydroxypropyl-beta-cyclodextrin to the diethyl pyrocarbonate is 10-50: 1.
7. use according to claim 6, characterized in that: in the composition H, the mass ratio of the hydroxypropyl-beta-cyclodextrin to the diethyl pyrocarbonate is 20-50: 1.
8. use according to claim 7, characterized in that: in the composition H, the mass ratio of the hydroxypropyl-beta-cyclodextrin to the diethyl pyrocarbonate is 50: 1.
9. Use according to claim 5, characterized in that: in the composition H, the mass ratio of the hydroxypropyl-beta-cyclodextrin to the diethyl pyrocarbonate is 5-20: 1.
10. use according to claim 9, characterized in that: in the composition H, the mass ratio of the hydroxypropyl-beta-cyclodextrin to the diethyl pyrocarbonate is 10-20: 1.
11. use according to claim 9, characterized in that: in the composition H, the mass ratio of the hydroxypropyl-beta-cyclodextrin to the diethyl pyrocarbonate is 5-10: 1.
12. use according to claim 2, characterized in that: in the composition H, the mass ratio of the hydroxypropyl-beta-cyclodextrin to the diethyl pyrocarbonate is 1-5: 1.
13. the application of the solution H as an RNA freeze-drying protective agent; the solution H is a solution consisting of a solute and a solvent, wherein the solute is hydroxypropyl-beta-cyclodextrin and diethyl pyrocarbonate, and the solvent is water.
14. Use according to claim 13, characterized in that: in the solution H, the concentration of hydroxypropyl-beta-cyclodextrin is 1mg/mL-500mg/mL, and the concentration of diethyl pyrocarbonate is 1 mg/mL.
15. Use according to claim 14, characterized in that: in the solution H, the concentration of hydroxypropyl-beta-cyclodextrin is 50mg/mL-500mg/mL, and the concentration of diethyl pyrocarbonate is 1 mg/mL.
16. Use according to claim 14, characterized in that: in the solution H, the concentration of hydroxypropyl-beta-cyclodextrin is 1mg/mL-50mg/mL, and the concentration of diethyl pyrocarbonate is 1 mg/mL.
17. Use according to claim 16, characterized in that: in the solution H, the concentration of hydroxypropyl-beta-cyclodextrin is 5mg/mL-50mg/mL, and the concentration of diethyl pyrocarbonate is 1 mg/mL.
18. Use according to claim 17, characterized in that: in the solution H, the concentration of hydroxypropyl-beta-cyclodextrin is 10mg/mL-50mg/mL, and the concentration of diethyl pyrocarbonate is 1 mg/mL.
19. Use according to claim 18, characterized in that: in the solution H, the concentration of hydroxypropyl-beta-cyclodextrin is 20mg/mL-50mg/mL, and the concentration of diethyl pyrocarbonate is 1 mg/mL.
20. Use according to claim 19, characterized in that: in the solution H, the concentration of hydroxypropyl-beta-cyclodextrin is 50mg/mL, and the concentration of diethyl pyrocarbonate is 1 mg/mL.
21. Use according to claim 17, characterized in that: in the solution H, the concentration of hydroxypropyl-beta-cyclodextrin is 5mg/mL-20mg/mL, and the concentration of diethyl pyrocarbonate is 1 mg/mL.
22. Use according to claim 21, characterized in that: in the solution H, the concentration of hydroxypropyl-beta-cyclodextrin is 10mg/mL-20mg/mL, and the concentration of diethyl pyrocarbonate is 1 mg/mL.
23. Use according to claim 21, characterized in that: in the solution H, the concentration of hydroxypropyl-beta-cyclodextrin is 5mg/mL-10mg/mL, and the concentration of diethyl pyrocarbonate is 1 mg/mL.
24. Use according to claim 14, characterized in that: in the solution H, the concentration of hydroxypropyl-beta-cyclodextrin is 1mg/mL-5mg/mL, and the concentration of diethyl pyrocarbonate is 1 mg/mL.
An RNA lyoprotectant being a or b, said a being composition H as described in any of claims 1-12 and said b being solution H as described in any of claims 13-24.
26. The application of hydroxypropyl-beta-cyclodextrin or hydroxypropyl-beta-cyclodextrin water solution in preparing nucleic acid freeze drying protective agent.
27. Use according to claim 26, characterized in that: the nucleic acid is DNA and/or RNA.
28. Use according to claim 26 or 27, characterized in that: the concentration of the hydroxypropyl-beta-cyclodextrin aqueous solution is 1mg/mL-500 mg/mL.
29. Use according to claim 28, characterized in that: the concentration of the hydroxypropyl-beta-cyclodextrin aqueous solution is 50mg/mL-500 mg/mL.
30. Use according to claim 28, characterized in that: the concentration of the hydroxypropyl-beta-cyclodextrin aqueous solution is 1mg/mL-50 mg/mL.
31. Use according to claim 30, characterized in that: the concentration of the hydroxypropyl-beta-cyclodextrin aqueous solution is 5mg/mL-50 mg/mL.
32. Use according to claim 31, characterized in that: the concentration of the hydroxypropyl-beta-cyclodextrin aqueous solution is 10mg/mL-50 mg/mL.
33. Use according to claim 32, characterized in that: the concentration of the hydroxypropyl-beta-cyclodextrin aqueous solution is 20mg/mL-50 mg/mL.
34. Use according to claim 33, characterized in that: the concentration of the hydroxypropyl-beta-cyclodextrin aqueous solution is 50 mg/mL.
35. Use according to claim 31, characterized in that: the concentration of the hydroxypropyl-beta-cyclodextrin aqueous solution is 5mg/mL-20 mg/mL.
36. Use according to claim 35, characterized in that: the concentration of the hydroxypropyl-beta-cyclodextrin aqueous solution is 10mg/mL-20 mg/mL.
37. Use according to claim 35, characterized in that: the concentration of the hydroxypropyl-beta-cyclodextrin aqueous solution is 5mg/mL-10 mg/mL.
38. Use according to claim 28, characterized in that: the concentration of the hydroxypropyl-beta-cyclodextrin aqueous solution is 1mg/mL-5 mg/mL.
39. The application of hydroxypropyl-beta-cyclodextrin or hydroxypropyl-beta-cyclodextrin water solution as DNA freeze drying protective agent.
40. The use according to claim 39, wherein: the concentration of the hydroxypropyl-beta-cyclodextrin aqueous solution is 1mg/mL-500 mg/mL.
41. The use according to claim 40, wherein: the concentration of the hydroxypropyl-beta-cyclodextrin aqueous solution is 50mg/mL-500 mg/mL.
42. The use according to claim 40, wherein: the concentration of the hydroxypropyl-beta-cyclodextrin aqueous solution is 1mg/mL-50 mg/mL.
43. The use according to claim 42, wherein: the concentration of the hydroxypropyl-beta-cyclodextrin aqueous solution is 5mg/mL-50 mg/mL.
44. The use according to claim 43, wherein: the concentration of the hydroxypropyl-beta-cyclodextrin aqueous solution is 10mg/mL-50 mg/mL.
45. The use according to claim 44, wherein: the concentration of the hydroxypropyl-beta-cyclodextrin aqueous solution is 20mg/mL-50 mg/mL.
46. The use according to claim 45, wherein: the concentration of the hydroxypropyl-beta-cyclodextrin aqueous solution is 50 mg/mL.
47. The use according to claim 43, wherein: the concentration of the hydroxypropyl-beta-cyclodextrin aqueous solution is 5mg/mL-20 mg/mL.
48. The use according to claim 47, wherein: the concentration of the hydroxypropyl-beta-cyclodextrin aqueous solution is 10mg/mL-20 mg/mL.
49. The use according to claim 47, wherein: the concentration of the hydroxypropyl-beta-cyclodextrin aqueous solution is 5mg/mL-10 mg/mL.
50. The use according to claim 40, wherein: the concentration of the hydroxypropyl-beta-cyclodextrin aqueous solution is 1mg/mL-5 mg/mL.
51. Use of the RNA lyoprotectant of claim 25 in the preparation of a nucleic acid preparation.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610977454.3A CN108070583B (en) | 2016-11-07 | 2016-11-07 | Application of hydroxypropyl-beta-cyclodextrin in preparation of nucleic acid freeze-drying protective agent |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610977454.3A CN108070583B (en) | 2016-11-07 | 2016-11-07 | Application of hydroxypropyl-beta-cyclodextrin in preparation of nucleic acid freeze-drying protective agent |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108070583A CN108070583A (en) | 2018-05-25 |
| CN108070583B true CN108070583B (en) | 2021-03-30 |
Family
ID=62153806
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610977454.3A Active CN108070583B (en) | 2016-11-07 | 2016-11-07 | Application of hydroxypropyl-beta-cyclodextrin in preparation of nucleic acid freeze-drying protective agent |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108070583B (en) |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111363793A (en) * | 2020-03-27 | 2020-07-03 | 宁波艾捷康宁生物科技有限公司 | PCR amplification reaction system without whole blood taking, amplification kit and amplification method thereof |
| CN111662902A (en) * | 2020-06-29 | 2020-09-15 | 诺迦(杭州)生物工程有限公司 | Freeze-drying protective agent and application thereof in nucleic acid amplification reagent |
| CN111826427B (en) * | 2020-07-24 | 2023-09-26 | 珠海丽珠试剂股份有限公司 | Freeze-drying protective agent and product of PCR amplification reagent, and preparation method and application thereof |
| CN114317700B (en) * | 2021-12-28 | 2024-01-30 | 无锡科智达科技有限公司 | Freeze-drying protective agent for fluorescent PCR (polymerase chain reaction) reagent, freeze-drying method and application |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102317472A (en) * | 2008-12-12 | 2012-01-11 | 欧洲基因技术股份有限公司 | Use Schardinger dextrins to improve specificity, sensitivity and the productive rate of nucleic acid amplification reaction |
| CN105349529A (en) * | 2015-12-09 | 2016-02-24 | 江苏正大天创生物工程有限公司 | Freeze-drying protective agent applied to nucleic acid amplification system |
| CN105463125A (en) * | 2016-02-02 | 2016-04-06 | 江苏正大天创生物工程有限公司 | Nucleic acid amplification system and freeze-drying protective agent thereof |
| WO2016165831A1 (en) * | 2015-04-17 | 2016-10-20 | Curevac Ag | Lyophilization of rna |
-
2016
- 2016-11-07 CN CN201610977454.3A patent/CN108070583B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102317472A (en) * | 2008-12-12 | 2012-01-11 | 欧洲基因技术股份有限公司 | Use Schardinger dextrins to improve specificity, sensitivity and the productive rate of nucleic acid amplification reaction |
| WO2016165831A1 (en) * | 2015-04-17 | 2016-10-20 | Curevac Ag | Lyophilization of rna |
| CN105349529A (en) * | 2015-12-09 | 2016-02-24 | 江苏正大天创生物工程有限公司 | Freeze-drying protective agent applied to nucleic acid amplification system |
| CN105463125A (en) * | 2016-02-02 | 2016-04-06 | 江苏正大天创生物工程有限公司 | Nucleic acid amplification system and freeze-drying protective agent thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108070583A (en) | 2018-05-25 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108070583B (en) | Application of hydroxypropyl-beta-cyclodextrin in preparation of nucleic acid freeze-drying protective agent | |
| CN111560417B (en) | Freeze-drying protective agent and freeze-drying method for RNA amplification reaction reagent | |
| JP5904153B2 (en) | Sample preparation method for nucleic acid amplification reaction, nucleic acid amplification method, reagent for solid phase nucleic acid amplification reaction, and microchip | |
| CN110452972B (en) | Freeze-dried microsphere of nucleic acid amplification reaction reagent and preparation method thereof | |
| CN103911367A (en) | Freeze-drying protective agent of nucleic acid amplification reaction reagents and freeze-drying method | |
| CN109196114A (en) | Isothermal duplication component and technique | |
| US6686460B2 (en) | Method and formulation for lyophilizing cultured human cells to preserve RNA and DNA contained in cells for use in molecular biology experiments | |
| CA2761059C (en) | A dried and stabilized ready-to-use composition containing nucleic acid polymerization enzymes for molecular biology applications | |
| JP5894929B2 (en) | Method for culturing adherent cells | |
| CA2314663A1 (en) | A composition for providing long term stability to cells for diagnostic testing | |
| CN112626175A (en) | Freeze-drying protective agent of SNP detection reagent and application | |
| KR102021605B1 (en) | Lyophilization method of the composition for multi-target nucleic acid sequence amplification reaction | |
| CN111826427A (en) | Freeze-drying protective agent of reagent for PCR amplification, product, preparation method and application thereof | |
| CN116287354A (en) | Method and kit for detecting bacterial fusarium wilt of corn | |
| CN110392581A (en) | For preventing or treating the pharmaceutical composition of hepatitis B | |
| CN114015758B (en) | Freeze-drying protective agent, fluorescent PCR detection kit and freeze-drying process | |
| CN113025757A (en) | Freeze-drying protective agent for 2019-nCov multiplex amplification reaction reagent and application thereof | |
| CN112481253A (en) | Freeze-drying protection prescription for PCR premix | |
| US20160355896A1 (en) | Incoated rna | |
| CN117625758A (en) | Freeze-drying protective agent for PCR (polymerase chain reaction) reagent, application of freeze-drying protective agent, mixed reagent, and freeze-drying method and product of mixed reagent | |
| CN112210593B (en) | Freeze-drying protective agent, freeze-drying PCR reagent and application thereof | |
| CN112210594B (en) | Freeze-drying protective agent for reverse transcription reagent | |
| CN117587108A (en) | Freeze-drying protective agent for RT-PCR detection and preparation method thereof | |
| EP4023753A1 (en) | Rna-free animal serum | |
| CN117143975A (en) | Stabilizer for air-drying preservation of PCR reagent and air-drying preservation method |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |