CN108070583A - Purposes of the hydroxypropyl-β-cyclodextrin in nucleic acid freezing drying protective agent is prepared - Google Patents
Purposes of the hydroxypropyl-β-cyclodextrin in nucleic acid freezing drying protective agent is prepared Download PDFInfo
- Publication number
- CN108070583A CN108070583A CN201610977454.3A CN201610977454A CN108070583A CN 108070583 A CN108070583 A CN 108070583A CN 201610977454 A CN201610977454 A CN 201610977454A CN 108070583 A CN108070583 A CN 108070583A
- Authority
- CN
- China
- Prior art keywords
- hydroxypropyl
- cyclodextrin
- nucleic acid
- rna
- solution
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6806—Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
Abstract
The invention discloses purposes of the hydroxypropyl beta cyclodextrin in nucleic acid freezing drying protective agent is prepared.Using hydroxypropyl beta cyclodextrin or hydroxypropyl beta cyclodextrin aqueous solution as DNA freezing drying protective agents to DNA with good protecting effect, using composition H and Solution H as RNA freezing drying protective agents to RNA with good protecting effect, and to the quantitative analysis of nucleic acids, follow-up DNA enzymatic is cut, the operations such as PCR/RT PCR amplifications, quantitative fluorescent PCR/RT PCR amplifications have no effect.It is freezed after RNA is mixed with hydroxypropyl beta cyclodextrin and DEPC, the coefficient of variation that room temperature preserves in 6 months is 5.90%, it is substantially better than 70 DEG C of liquid storages (coefficient of variation 13.33%), and the preservation condition is conducive to RNA sample long distance transportation with preserving without such as 70 DEG C of ultra low temperature freezer complex devices.
Description
Technical field
The present invention relates to the purposes of hydroxypropyl-β-cyclodextrin in biology field, more particularly to hydroxy propyl-Beta-ring paste
Purposes of the essence in nucleic acid freezing drying protective agent is prepared.
Background technology
Nucleic acid as one of most basic substance of life, be life science and Biological Detection important object and
The important composition of biotinylated nucleic acid product, nucleic acid reagent according to the difference of its chemical composition, is divided into ribonucleic acid (RNA) and deoxidation
Two class of ribonucleic acid (DNA).
Nucleic acid is as large biological molecule, and easily degradation under field conditions (factors), stable Techniques of preserving is for developing and producing
Nucleic acid samples, nucleic acid standard substance, nucleic acid reagent box, nucleic acid vaccine play an important roll.Therefore, advanced nucleic acid preservation technology
Diagnosing the fields such as detection, animals and plants inspection and quarantine in Medical Biology has wide application prospect.
There are mainly two types of the modes for being usually used in storing DNA at present both at home and abroad, and a kind of used after TE dissolving DNAs with liquid
Form Ultra-cryofreezing preservation, another kind are stored or transported after DNA sample is lyophilized into solid.But DNA volumes compared with
Small, naked eyes can not almost be differentiated after freeze-drying, easily cause to lose in use, and then influence follow-up test.As for RNA,
It is not easy to maintain after RNA extractions since RNase is nearly ubiquitous, generally mostly now carried or -70 DEG C short-term are protected using current
The method deposited.This aspect needs to be equipped with the complex device as -70 DEG C of refrigerators, is on the other hand also unfavorable for the remote way of nucleic acid
Transport, great inconvenience is brought to experimental implementation.Therefore a kind of freezing drying protective agent is needed, before follow-up test is not influenced
It puts, solid phase support is being provided simultaneously for nucleic acid, extend the holding time of nucleic acid at conventional temperatures.
Hydroxypropyl-β-cyclodextrin (Hydroxypropyl-β-Cyclodextrin, HP- β-CD), molecular formula is
C63H112O42, CAS 128446-35-5.Hydroxypropyl-β-cyclodextrin is that the hydrogen of 2,3 and 6 hydroxyls of hydroxypropyl substituted cyclodextrin is former
The unformed beta-cyclodextrin derivative of one kind that son obtains.The intra-molecular cyclic hydrogen bond of beta-cyclodextrin has been broken in the introducing of hydroxypropyl,
The major defect of beta-cyclodextrin poorly water-soluble is overcome while cyclodextrin cavity is kept, is that current research is the most deep, it should
With one of widest cyclodextrine derivatives, food, drug, cosmetic industry are mainly used in as inclusion agents.
The content of the invention
The technical problems to be solved by the invention are that the nucleic acid of freeze-drying how to be made to store for a long time at normal temperatures, and are made micro-
See sightless nucleic acid macroscopic viewization, the visuality of Enhancement test operation.
In order to solve the above technical problems, the present invention provides hydroxypropyl-β-cyclodextrin or hydroxypropyl-β-cyclodextrin are water-soluble
Application of the liquid in nucleic acid freezing drying protective agent is prepared.
In above application, the nucleic acid can be DNA and/or RNA.
Hydroxypropyl-β-cyclodextrin or hydroxypropyl-β-cyclodextrin aqueous solution are as the application in DNA freezing drying protective agents
Fall within protection scope of the present invention.
In above two application, concentration those skilled in the art of the hydroxypropyl-β-cyclodextrin aqueous solution can basis
The effect of nucleic acid freeze-drying determines, concretely 50mg/mL, 1mg/mL-50mg/mL, 5mg/mL-50mg/mL, 10mg/mL-
50mg/mL、20mg/mL-50mg/mL、1mg/mL-5mg/mL、5mg/mL-10mg/mL、5mg/mL-20mg/mL、10mg/mL-
20mg/mL, 50mg/mL-500mg/mL or 1mg/mL-500mg/mL.
The present invention also provides applications of the composition H in RNA freezing drying protective agents are prepared, the composition H is by hydroxyl
Propyl-beta-cyclodextrin and pyrocarbonic acid diethyl ester (DEPC) composition.
In the composition H, the quality of the hydroxypropyl-β-cyclodextrin and pyrocarbonic acid diethyl ester compares those skilled in the art
It can be determined according to the effect that nucleic acid is freeze-dried, concretely 50:1、1-50：1、5-50：1、10-50：1、20-50：1、1-
5：1、5-10：1、5-20：1、10-20：1、50-500:1 or 1-500：1.
The present invention also provides Solution H as the application in RNA freezing drying protective agents；The Solution H is by solute
With the solution of solvent composition, the solute is hydroxypropyl-β-cyclodextrin and DEPC, and the solvent is water.
In the Solution H, concentration those skilled in the art of the hydroxypropyl-β-cyclodextrin and DEPC can be according to nucleic acid
The effect of freeze-drying determines, the concentration of hydroxypropyl-β-cyclodextrin concretely 50mg/mL, 1mg/mL-50mg/mL, 5mg/
mL-50mg/mL、10mg/mL-50mg/mL、20mg/mL-50mg/mL、1mg/mL-5mg/mL、5mg/mL-10mg/mL、5mg/
ML-20mg/mL, 10mg/mL-20mg/mL, 50mg/mL-500mg/mL or 1mg/mL-500mg/mL, the concentration of DEPC specifically may be used
For 1mg/ml.
The present invention also provides RNA freezing drying protective agents, are a or b, and a is the composition H, and the b is described
Solution H.
The application of any of the above-described kind of application or above-mentioned nucleic acid freezing drying protective agent in nucleic acid product is prepared falls within this
The protection domain of invention.
The nucleic acid product is the product containing nucleic acid, such as nucleic acid samples, nucleic acid standard substance, nucleic acid probe, primer, core
Acid detection kit or nucleic acid molecules diagnostic kit etc..
The nucleic acid can be in vitro (separated) nucleic acid.The water can be ultra-pure water.
Result of the test shows hydroxypropyl-β-cyclodextrin or hydroxypropyl-β-cyclodextrin aqueous solution being freeze-dried as DNA
Protective agent to DNA with good protecting effect, using composition H and Solution H as RNA freezing drying protective agents to RNA with
Good protecting effect, and to the quantitative analysis of nucleic acids, follow-up DNA enzymatic cut, PCR/RT-PCR amplifications, quantitative fluorescent PCR/RT-PCR
The operations such as amplification have no effect.It is freezed after RNA is mixed with hydroxypropyl-β-cyclodextrin and DEPC, room temperature was preserved in 6 months
The coefficient of variation is 5.90%, hence it is evident that better than -70 DEG C liquid storages (coefficient of variation 13.33%), and also the preservation condition need not
Such as -70 DEG C of ultra low temperature freezer complex devices are conducive to RNA sample long distance transportation with preserving.Hydroxy propyl-Beta-ring of the present invention
Dextrin and DEPC are cheap, are easily obtained, can be widely applied to nucleic acid freeze-drying and the manufacturing that preserves for a long time and
Among research practice.
Description of the drawings
Fig. 1 is the state after the freeze-drying of various concentration hydroxypropyl-β-cyclodextrin solution.
It is respectively from left to right that 100ng/ μ L DNA solutions freeze sample；1mg/mL、5mg/mL、10mg/mL、20mg/mL、
State after the freeze-drying of 50mg/mL, 100mg/mL and 500mg/mL hydroxypropyl-β-cyclodextrin solution.
Fig. 2 is 500mg/mL hydroxypropyl-β-cyclodextrin solution full wavelength scanner figures.
Fig. 3 is the influence that various concentration hydroxypropyl-β-cyclodextrin cuts plasmid DNA enzymatic.
Swimming lane 1, the Plasmid samples without digestion；Swimming lane 2, digestion of the 0mg/mL HP- β-CD systems after EcoRI digestions
Product；Swimming lane 3, digestion products of the 10mg/mL HP- β-CD systems after EcoRI digestions；Swimming lane 4,50mg/mLHP- β-CD bodies
It is the digestion products after EcoRI digestions；Swimming lane 5, digestion products of the 100mg/mL HP- β-CD systems after EcoRI digestions；
Swimming lane M, TAKARA 5K Marker.
Fig. 4 is anti-for the duck tembusu virus fluorescent quantitation containing various concentration hydroxypropyl-β-cyclodextrin and 1mg/ml DEPC
Answer amplification curve.
Specific embodiment
The present invention is further described in detail With reference to embodiment, the embodiment provided is only for explaining
The bright present invention, the scope being not intended to be limiting of the invention.Experimental method in following embodiments unless otherwise specified, is
Conventional method.The materials, reagents and the like used in the following examples is commercially available unless otherwise specified.
TE buffer solutions in following embodiments：Solvent is ultra-pure water, solute be 10mmol/L Tris-HCl (pH 8.0) and
1mmol/L EDTA(pH 8.0)。
Hydroxypropyl-β-cyclodextrin (HP- β-CD) in following embodiments is Beijing lark prestige Science and Technology Ltd. product.
Duck plague virus (DVEV) strain in following embodiments is VR-684, is ATCC products.
Duck tembusu virus (DTMUV) strain in following embodiments is jxsp (duck TMUV-jxsp)
(DuckTembusu virus exhibits neurovirulence in BALB/c mice.Li et
al.VirologyJournal 2013,10:260) public can obtain the biomaterial from applicant, which only attaches most importance to
Used in the related experiment of duplicate invention, it can not be used as other purposes.
In the application, freeze-drying is to be chilled to water-containing materials below freezing, water is made to be changed into ice, then compared with Gao Zhen
The drying means that ice is changed into steam under sky and is removed.In following embodiments, it is 0.001MPa's to be freeze-dried in vacuum degree
It is carried out in environment.
The application of embodiment 1, hydroxypropyl-β-cyclodextrin in nucleic acid freezing drying protective agent is prepared
1st, volume change research after the freeze-drying of various concentration hydroxypropyl-β-cyclodextrin
Take hydroxypropyl-β-cyclodextrin powder, with ultra-pure water be configured to 1mg/mL, 5mg/mL, 10mg/mL, 20mg/mL,
The solution of 50mg/mL, 100mg/mL and 500mg/mL take 0.8mL solution to be fitted into 1.5mL centrifuge tubes respectively, and -20 DEG C of progress are cold
It is lyophilized dry, the form of solid constituent after observation solution freeze-drying, while (solvent is buffered as TE using 100ng/ μ L DNA solutions
Liquid) sample is freezed as control.
The result shows that the solid powder that DNA solution (solvent be TE buffer solutions) is formed after directly lyophilized, visually entirely without
Method is observed, and then has apparent solid forms after the freeze-drying of hydroxypropyl-β-cyclodextrin solution.Work as hydroxypropyl-β-cyclodextrin
When solution concentration is more than 5mg/mL, i.e., in 5mg/mL to 500mg/mL, the solid constituent volume after freeze-drying is basically unchanged,
Volume with former 0.8mL solution is also without significant change；When hydroxypropyl-β-cyclodextrin solution concentration is 1mg/mL, freeze-drying
Solid constituent volume afterwards has apparent diminution compared to the volume of original 0.8mL solution, but still can substantially observe, available for follow-up
The operation such as dissolving (Fig. 1).The 1mg/mL-500mg/mL hydroxypropyl-β-cyclodextrin solution after freezing, equal energy are redissolved with ultra-pure water
It was dissolved rapidly within 15 second time.
2nd, influence of the hydroxypropyl-β-cyclodextrin to nucleic acid quantification
Hydroxypropyl-β-cyclodextrin powder is taken, the solution of 500mg/mL is configured to ultra-pure water, passes through NanodropND1000
Carry out full wavelength scanner.The results are shown in Figure 2, and in the range of 220nm-750nm, hydroxypropyl-β-cyclodextrin does not have obvious characteristic
Absworption peak, absorption value tapers off trend, and the absorption value at 260nm is less than 0.1, is quantified for the uv-spectrophotometric of nucleic acid
It influences limited.
Respectively taking 1mg/mL DNA solutions (solvent is ultra-pure water) and 1mg/mL RNA solutions, (solvent is ultra-pure water, is used respectively
Ultra-pure water and 500mg/mL hydroxypropyl-β-cyclodextrins solution (solvent is ultra-pure water) be diluted to 10ng/mL, 50ng/mL and
The DNA or RNA solution of 100ng/mL measures OD260 by Nanodrop ND1000, and the results are shown in Table 1.
The measurement result after ultra-pure water and hydroxypropyl-β-cyclodextrin solution dilution DNA solution is respectively adopted in table 1
From table 1 it follows that the nucleic acid solution containing hydroxypropyl-β-cyclodextrin and without hydroxypropyl-β-cyclodextrin, no matter
It is DNA or RNA, when measuring its concentration, there were significant differences (P ＞ 0.05).
3rd, influence of the hydroxypropyl-β-cyclodextrin to DNA digestion with restriction enzyme
To understand influence of the hydroxypropyl-β-cyclodextrin to cyclic DNA endonuclease reaction, using sense primer
Atcaaaagataacatgcatt and anti-sense primer tagatgatttctgcaccatc, PCR amplification avian influenza virus NA6 genes,
Target fragment 1360bp is obtained, sequence is the sequence 1 in sequence table.
PEASY T3 carriers (Beijing Quanshijin Biotechnology Co., Ltd's product) are connected to after target fragment is recycled to obtain
Recombinant plasmid pEASY T3-NA6 are obtained, it is errorless through sequencing confirmation sequence.The plasmid overall length is 4.4kb, wherein including two EcoRI
(being located in carrier T) and a BamHI (are located in Insert Fragment) restriction enzyme site.Prepare 4 identical EcoRI endonuclease reaction bodies
It is (first to the 4th EcoRI endonuclease reaction system), each EcoRI endonuclease reaction systems consist of the following compositions：10
2 μ l, EcoRI enzymes of × H Buffer, 0.7 μ l (TaKaRa Products), sterilize 15.3 μ l of pure water, 2 μ l of plasmid.By first
EcoRI endonuclease reaction systems are named as 0mg/mL HP- β-CD systems.Hydroxypropyl is added in second EcoRI endonuclease reaction system
Group-beta-cyclodextrin, the content of hydroxypropyl-β-cyclodextrin is 10mg/mL, and obtained system is named as 10mg/mL HP- β-CD
System.Hydroxypropyl-β-cyclodextrin is added in the 3rd EcoRI endonuclease reaction system, the content of hydroxypropyl-β-cyclodextrin is
Obtained system is named as 50mg/mL HP- β-CD systems by 50mg/mL.It is added in the 4th EcoRI endonuclease reaction system
Hydroxypropyl-β-cyclodextrin, the content of hydroxypropyl-β-cyclodextrin is 100mg/mL, and obtained system is named as 100mg/mLHP-
β-CD systems.By 0mg/mL HP- β-CD systems, 10mg/mL HP- β-CD systems, 50mg/mL HP- β-CD systems and 100mg/
ML HP- β-CD systems are in 37 DEG C of overnight digestions.After terminating reaction, 5 μ L digestion products are taken into row agarose gel electrophoresis.Knot
Fruit shows to have no the endonuclease reaction of cyclic DNA influence (Fig. 3) containing hydroxypropyl-β-cyclodextrin in digestion system.
It is to understand influence of the hydroxypropyl-β-cyclodextrin to linear DNA endonuclease reaction, recombinant plasmid pEASY T3-NA6 is first
Digestion is carried out using BamHI, after recycling BamHI digestion products, preparing 4 identical EcoRI endonuclease reaction systems, (first extremely
4th EcoRI endonuclease reaction system), each EcoRI endonuclease reaction systems consist of the following compositions：10×H Buffer 2
0.7 μ l (TaKaRa Products) of μ l, EcoRI enzyme, sterilize 15.3 μ l of pure water, 2 μ l of digestion products.By first EcoRI digestion
Reaction system is named as 0mg/mL HP- β-CD systems.Hydroxy propyl-Beta-ring paste is added in second EcoRI endonuclease reaction system
Essence, the content of hydroxypropyl-β-cyclodextrin is 10mg/mL, and obtained system is named as 10mg/mL HP- β-CD systems.
Hydroxypropyl-β-cyclodextrin is added in three EcoRI endonuclease reaction systems, the content of hydroxypropyl-β-cyclodextrin is 50mg/mL, will
Obtained system is named as 50mg/mL HP- β-CD systems.In the 4th EcoRI endonuclease reaction system add in hydroxy propyl-Beta-
Cyclodextrin, the content of hydroxypropyl-β-cyclodextrin is 100mg/mL, and obtained system is named as 100mg/mL HP- β-CD bodies
System.By 0mg/mL HP- β-CD systems, 10mg/mL HP- β-CD systems, 50mg/mL HP- β-CD systems and 100mg/mLHP-
β-CD systems are in 37 DEG C of overnight digestions.After terminating reaction, 5 μ L EcoRI digestion products are taken into row agarose gel electrophoresis.Knot
Fruit show digestion system in containing hydroxypropyl-β-cyclodextrin on the endonuclease reaction of linear DNA also without influence.
4th, influence of the hydroxypropyl-β-cyclodextrin to quantitative fluorescent PCR
To understand influence of the hydroxypropyl-β-cyclodextrin to quantitative fluorescent PCR, using the primer and probe of table 2 to duck plague disease
Malicious (DVEV) carries out quantitative fluorescent PCR reaction.Quantitative fluorescent PCR reaction system is：6.8 μ L, 2 × GoTaqProbe qPCR of water
10 μ L of Master Mix, 0.8 μ L of primer pair, 0.4 μ L of probe, 2 μ L of viral nucleic acid (template), hydroxypropyl-β-cyclodextrin, reaction
Total volume is 20 μ L.
Four kinds of quantitative fluorescent PCR reaction systems are set：0mg/mL HP- β-CD reaction systems, 5mg/mL HP- β-CD reactions
System, 10mg/mL HP- β-CD reaction systems and 50mg/mL HP- β-CD reaction systems.These four quantitative fluorescent PCR reactants
It is other all sames (table 2) in addition to the concentration of hydroxypropyl-β-cyclodextrin is different.0mg/mLHP- β-CD reaction systems, 5mg/
Hydroxypropyl in mL HP- β-CD reaction systems, 10mg/mL HP- β-CD reaction systems and 50mg/mL HP- β-CD reaction systems-
The concentration of beta-cyclodextrin is respectively 0mg/mL, 5mg/mL, 10mg/mL and 50mg/mL.
It is placed in ABI 7500fast type real-time fluorescence quantitative PCR instrument and is detected.Above-mentioned fluorescent quantitative PCR detection method
Quantitative fluorescent PCR response procedures be：95℃2min；95 DEG C of 15s, 60 DEG C of 1min, 40 Xun Huans.
2 fluorescence quantification PCR primer of table, probe, strain and reaction system
The results show that add in Ct values that the hydroxypropyl-β-cyclodextrins of above-mentioned several concentration reacts quantitative fluorescent PCR and glimmering
Luminous intensity has no significant effect, and the coefficient of variation is less than 0.2% (table 3).
Table 3 reacts Ct values containing various concentration hydroxypropyl-β-cyclodextrin duck plague virus fluorescent quantitation
Note：0th, 5,10 and 50 represent respectively 0mg/mL HP- β-CD reaction systems, 5mg/mL HP- β-CD reaction systems,
10mg/mL HP- β-CD reaction systems and 50mg/mL HP- β-CD reaction systems.
5th, influence of the hydroxypropyl-β-cyclodextrin to fluorescence quantitative RT-RCR
It is smooth to duck using the primer and probe of table 4 to understand influence of the hydroxypropyl-β-cyclodextrin to fluorescence quantitative RT-RCR
Cloth Soviet Union virus carries out fluorescence quantitative RT-RCR reaction.RT-PCR reaction systems are：8.6 μ L of water, dNTP312.5 μm of ol/L, 5 ×
4 μ L of Colorless GoTaq Reaction Buffer, sense primer and anti-sense primer are 0.7 μM, probe 0.35pmol/
μ L, GoTaq archaeal dna polymerase 0.075U/ μ L, AMV 0.1U/ μ L, RNase inhibitor 0.6U/ μ L, 2 μ L of viral nucleic acid (template),
Hydroxypropyl-β-cyclodextrin and 1mg/ml DEPC, reaction total volume are 20 μ L.Four kinds of fluorescence quantitative RT-RCR reaction systems are set：
0mg/mL HP- β-CD reaction systems, 5mg/mL HP- β-CD reaction systems, 10mg/mL HP- β-CD reaction systems and 50mg/
ML HP- β-CD reaction systems.These four fluorescence quantitative RT-RCR reaction systems are different except the concentration of hydroxypropyl-β-cyclodextrin
Outside, other all sames (table 5).0mg/mL HP- β-CD reaction systems, 5mg/mL HP- β-CD reaction systems, 10mg/mLHP- β-
The concentration of hydroxypropyl-β-cyclodextrin is respectively 0mg/mL, 5mg/ in CD reaction systems and 50mg/mL HP- β-CD reaction systems
ML, 10mg/mL and 50mg/mL.
The reaction system of above-mentioned fluorescence quantitative RT-PCR detecting method is placed in ABI 7500fast type real-time fluorescence quantitative PCRs
It is detected in instrument.The fluorescence quantitative RT-RCR response procedures of above-mentioned fluorescence quantitative RT-PCR detecting method are：45℃10min；
95℃10min；95 DEG C of 15s, 60 DEG C of 45s, 40 Xun Huans.
4 fluorescence quantitative RT-PCR primer of table, probe
| Component | Sequence (5 ' -3 ') |
| Sense primer | CAGTTTTCATACATGGTTCCACG |
| Anti-sense primer | CGGTACCATAATCCTCCATCTCAGC |
| Probe | FAM-AGCCCAGCAGTCGC-MGB |
5 fluorescence quantitative RT-RCR reaction system of table
As a result as shown in Fig. 4 and table 6, the hydroxypropyl-β-cyclodextrin and 1mg/ml DEPC of above-mentioned several concentration determine fluorescence
The Ct values and fluorescence intensity of amount RT-PCR reactions have no significant effect, and the coefficient of variation is less than 1.6%.
Table 6 is reacted containing the duck tembusu virus fluorescent quantitation of various concentration hydroxypropyl-β-cyclodextrin and 1mg/ml DEPC
Ct values
Note：0th, 5,10 and 50 represent respectively 0mg/mL HP- β-CD reaction systems, 5mg/mL HP- β-CD reaction systems,
10mg/mL HP- β-CD reaction systems and 50mg/mL HP- β-CD reaction systems.
6th, influence of the hydroxypropyl-β-cyclodextrin to nucleic acid standard substance stability
There are mainly two types of the modes of currently used storage nucleic acid, and one kind is ultralow in liquid form after being redissolved using TE
Warm freezen protective, another kind are by the way that the nucleic acid of liquid is lyophilized into normal temperature storage or transport after solid.But both modes are all
There are it is certain the defects of, liquid storage nucleic acid overlong time be easy to cause nucleolysis, especially RNA sample, after seriously affecting
Continuous experiment definite value；And directly lyophilized nucleic acid, naked eyes can not almost be differentiated, and a degree of lose easily is caused in follow-up test
It loses, and a pipe must redissolve completely, and often pipe sample can not reuse.It is redissolved using hydroxypropyl-β-cyclodextrin solution
It is freezed after nucleic acid, since the solid phase support of hydroxypropyl-β-cyclodextrin acts on so that on the one hand nucleic acid naked eyes are as it can be seen that will not cause
It loses, on the other hand can be on-demand by the means quantitatively weighed, therefore be conducive to the smooth development of later stage experiment.
To understand influence of the hydroxypropyl-β-cyclodextrin to nucleic acid solution stability, duck plague virus nucleic acid in the present embodiment
(DNA) above-mentioned three kinds of preservations are respectively adopted in solution (solvent TE) and duck tembusu virus nucleic acid (RNA) solution (solvent TE)
Mode carries out stability test.It is specific as follows：
Experiment packet is as follows：
Cyclodextrin freezes room temperature：Hydroxypropyl-β-cyclodextrin is added in into duck plague virus nucleic acid (DNA) solution, until hydroxypropyl-
The content of beta-cyclodextrin is 50mg/mL, and (24-26 DEG C) of room temperature preserves vacuum freeze drying (vacuum degree 0.001MPa) afterwards；
Hydroxypropyl-β-cyclodextrin and DEPC are added in into duck tembusu virus nucleic acid (RNA) solution, until hydroxy propyl-Beta-ring
The content of dextrin is 50mg/mL and the content of DEPC is 1mg/ml, vacuum freeze drying (vacuum degree 0.001MPa) room temperature afterwards
(24-26 DEG C) preservation；
Lyophilized room temperature：Duck plague virus nucleic acid (DNA) solution and duck tembusu virus nucleic acid (RNA) solution difference vacuum is cold
It freezes dry (vacuum degree 0.001MPa) (directly lyophilized), (24-26 DEG C) preservation of room temperature；
- 70 DEG C of liquid：By duck plague virus nucleic acid (DNA) solution and duck tembusu virus nucleic acid (RNA) solution in -70 DEG C of guarantors
It deposits.
Using in step 4 duck plague virus quantitative fluorescent PCR reaction respectively preserve 3 days, 1 week, 2 weeks, 1 month, 3 months, 6
DNA content measure is carried out to the sample of three kinds of preservation forms at a month and 12 months；Using duck tembusu virus fluorescence in step 5
Quantitative RT-PCR reaction preserves form when preserving 3 days, 1 week, 10 days, 2 weeks, 1 month, 3 months and 6 months to three kinds respectively
Sample carries out rna content measure.During measure, each three repetitions of sample design carry out the different holding times after being averaged
Compare, the results are shown in Table 7.
The above results show that influence of three kinds of preservation conditions to DNA stability is little, and no significant difference, 12
The coefficient of variation in month shows apparent solid forms within 6.1% after being freezed due to the DNA containing cyclodextrin, have
It operates and observes beneficial to subsequent experimental.However, influence of three kinds of preservation conditions for rna stability is then significantly different, RNA is frozen
Room temperature, which preserves 3 months, after dry can not detect corresponding target fragment, and the coefficient of variation is more than 31% in half a year, illustrates the condition not
Stablize beneficial to RNA and preserve.It is freezed after RNA is mixed with hydroxypropyl-β-cyclodextrin and DEPC, room temperature preserves the change in 6 months
Different coefficient be 5.90%, hence it is evident that better than -70 DEG C liquid storages (coefficient of variation 13.33%), and the preservation condition without as -
The complex devices such as 70 DEG C of ultra low temperature freezers are conducive to RNA sample long distance transportation with preserving.
Influence of the different preservation conditions of 7 three kinds of table to nucleic acid standard substance stability
<110>China Animal Disease Control And Prevention Center
<120>Purposes of the hydroxypropyl-β-cyclodextrin in nucleic acid freezing drying protective agent is prepared
<160> 1
<170> PatentIn version 3.5
<210> 1
<211> 1360
<212> DNA
<213>Artificial sequence
<220>
<223>
<400> 1
atcaaaagat aacatgcatt tcagcaacag gagtaacact atcggtagta agcctgctaa 60
taggaatcgc caatttgggc ctaaatatcg gactacacta caaagtgagt gattcaacaa 120
ctataaacat tccaaacatg aatgagacca acccaacaac aacaaacatc actaacatta 180
tagtgaataa gaacgaagaa agaacatttc tcaacttgac caagccgcta tgtgaagtca 240
actcatggca cattctatcg aaagacaatg caataagaat aggtgaggat gctcatatac 300
tggtcacaag ggaaccttac ttgtcctgtg atccacaagg atgcaggatg tttgctctga 360
gtcaaggcac aacactcaga gggcgacatg cgaatggaac catacatgat aggagcccat 420
ttcgagctct tataagttgg gaaatgggtc aggcacccag tccatataat actagggtcg 480
aatgcatagg atggtcaagc acgtcatgcc atgatggcat atcaaggatg tcaatatgca 540
tatcaggacc gaataacaat gcatcggcag tggtgtggta cagggggaga ccagtaacag 600
aaatcccatc atgggcaggg aacattctta ggactcaaga atcagaatgt gtgtgccata 660
aaggaatctg cccagtggtc atgacagatg gtccagcaaa caacaaggca gcaactaaga 720
taatctactt caaagaggga aagatacaga aaattgaaga actgcaaggg aacgctcaac 780
acatcgaaga gtgttcatgc tacggagcag cagggatgat caaatgtgta tgcagagaca 840
attggaaggg ggcaaataga ccaataatca ctatagatcc cgaaatgatg acccacacaa 900
gcaaatactt gtgttcaaaa atcttaaccg acacaagtcg tcctaatgac cccaccaatg 960
ggaactgcga tgcgccaata acaggaggga gcccagaccc aggggtaaaa gggtttgcat 1020
tcctagacgg ggagagttca tggcttggaa ggacaattag caaagactcc agatcaggct 1080
acgaaatgtt aaaggtccca aatgcagaaa ccgacactca atcagggcca acctcatacc 1140
agctgattgt caacaaccaa aattggtcag ggtactcagg ggcattcata gactactggg 1200
caaccaagga atgcttcaat ccttgttttt atgtggagct aatcagaggg agacccaaag 1260
agagtgatgt actgtggact tccaatagca tggtagctct ctgtggatcc agggagcgat 1320
tgggatcatg gtcctggcat gatggtgcag aaatcatcta 1360
Claims (10)
1. applications of the composition H in RNA freezing drying protective agents are prepared, the composition H is by hydroxypropyl-β-cyclodextrin and coke
Diethyl carbonate forms.
2. application according to claim 1, it is characterised in that：In the composition H, the hydroxypropyl-β-cyclodextrin and
The mass ratio of pyrocarbonic acid diethyl ester is 50:1、1-50：1、5-50：1、10-50：1、20-50：1、1-5：1、5-10：1、5-20：1、
10-20：1、50-500:1 or 1-500：1.
3. Solution H is as the application in RNA freezing drying protective agents；The solution that the Solution H is made of solute and solvent,
The solute is hydroxypropyl-β-cyclodextrin and pyrocarbonic acid diethyl ester, and the solvent is water.
4. application according to claim 3, it is characterised in that：In the Solution H, the concentration of hydroxypropyl-β-cyclodextrin is
50mg/mL、1mg/mL-50mg/mL、5mg/mL-50mg/mL、10mg/mL-50mg/mL、20mg/mL-50mg/mL、1mg/mL-
5mg/mL, 5mg/mL-10mg/mL, 5mg/mL-20mg/mL, 10mg/mL-20mg/mL, 50mg/mL-500mg/mL or 1mg/
ML-500mg/mL, the concentration of pyrocarbonic acid diethyl ester is 1mg/ml.
5.RNA freezing drying protective agents, are a or b, and a is that composition H, the b described in claim 1 or 2 will for right
Seek Solution H described in 3 or 4.
6. the application of hydroxypropyl-β-cyclodextrin or hydroxypropyl-β-cyclodextrin aqueous solution in nucleic acid freezing drying protective agent is prepared.
7. application according to claim 6, it is characterised in that：The nucleic acid is DNA and/or RNA.
8. hydroxypropyl-β-cyclodextrin or hydroxypropyl-β-cyclodextrin aqueous solution are as the application in DNA freezing drying protective agents.
9. according to the application described in claim 6,7 or 8, it is characterised in that：The concentration of the hydroxypropyl-β-cyclodextrin aqueous solution
For 50mg/mL, 1mg/mL-50mg/mL, 5mg/mL-50mg/mL, 10mg/mL-50mg/mL, 20mg/mL-50mg/mL, 1mg/
ML-5mg/mL, 5mg/mL-10mg/mL, 5mg/mL-20mg/mL, 10mg/mL-20mg/mL, 50mg/mL-500mg/mL or
1mg/mL-500mg/mL。
10. the nucleic acid freeze-drying protection described in the application or claim 5 any one of Claims 1-4 and 6 to 9
Application of the agent in nucleic acid product is prepared.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610977454.3A CN108070583B (en) | 2016-11-07 | 2016-11-07 | Application of hydroxypropyl-beta-cyclodextrin in preparation of nucleic acid freeze-drying protective agent |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610977454.3A CN108070583B (en) | 2016-11-07 | 2016-11-07 | Application of hydroxypropyl-beta-cyclodextrin in preparation of nucleic acid freeze-drying protective agent |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108070583A true CN108070583A (en) | 2018-05-25 |
| CN108070583B CN108070583B (en) | 2021-03-30 |
Family
ID=62153806
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610977454.3A Active CN108070583B (en) | 2016-11-07 | 2016-11-07 | Application of hydroxypropyl-beta-cyclodextrin in preparation of nucleic acid freeze-drying protective agent |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108070583B (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111363793A (en) * | 2020-03-27 | 2020-07-03 | 宁波艾捷康宁生物科技有限公司 | PCR amplification reaction system without whole blood taking, amplification kit and amplification method thereof |
| CN111662902A (en) * | 2020-06-29 | 2020-09-15 | 诺迦(杭州)生物工程有限公司 | Freeze-drying protective agent and application thereof in nucleic acid amplification reagent |
| CN111826427A (en) * | 2020-07-24 | 2020-10-27 | 珠海丽珠试剂股份有限公司 | Freeze-drying protective agent of reagent for PCR amplification, product, preparation method and application thereof |
| CN114317700A (en) * | 2021-12-28 | 2022-04-12 | 无锡科智达科技有限公司 | Fluorescent PCR reagent freeze-drying protective agent, freeze-drying method and application |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102317472A (en) * | 2008-12-12 | 2012-01-11 | 欧洲基因技术股份有限公司 | Use Schardinger dextrins to improve specificity, sensitivity and the productive rate of nucleic acid amplification reaction |
| CN105349529A (en) * | 2015-12-09 | 2016-02-24 | 江苏正大天创生物工程有限公司 | Freeze-drying protective agent applied to nucleic acid amplification system |
| CN105463125A (en) * | 2016-02-02 | 2016-04-06 | 江苏正大天创生物工程有限公司 | Nucleic acid amplification system and freeze-drying protective agent thereof |
| WO2016165831A1 (en) * | 2015-04-17 | 2016-10-20 | Curevac Ag | Lyophilization of rna |
-
2016
- 2016-11-07 CN CN201610977454.3A patent/CN108070583B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102317472A (en) * | 2008-12-12 | 2012-01-11 | 欧洲基因技术股份有限公司 | Use Schardinger dextrins to improve specificity, sensitivity and the productive rate of nucleic acid amplification reaction |
| WO2016165831A1 (en) * | 2015-04-17 | 2016-10-20 | Curevac Ag | Lyophilization of rna |
| CN105349529A (en) * | 2015-12-09 | 2016-02-24 | 江苏正大天创生物工程有限公司 | Freeze-drying protective agent applied to nucleic acid amplification system |
| CN105463125A (en) * | 2016-02-02 | 2016-04-06 | 江苏正大天创生物工程有限公司 | Nucleic acid amplification system and freeze-drying protective agent thereof |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111363793A (en) * | 2020-03-27 | 2020-07-03 | 宁波艾捷康宁生物科技有限公司 | PCR amplification reaction system without whole blood taking, amplification kit and amplification method thereof |
| CN111662902A (en) * | 2020-06-29 | 2020-09-15 | 诺迦(杭州)生物工程有限公司 | Freeze-drying protective agent and application thereof in nucleic acid amplification reagent |
| CN111826427A (en) * | 2020-07-24 | 2020-10-27 | 珠海丽珠试剂股份有限公司 | Freeze-drying protective agent of reagent for PCR amplification, product, preparation method and application thereof |
| CN111826427B (en) * | 2020-07-24 | 2023-09-26 | 珠海丽珠试剂股份有限公司 | Freeze-drying protective agent and product of PCR amplification reagent, and preparation method and application thereof |
| CN114317700A (en) * | 2021-12-28 | 2022-04-12 | 无锡科智达科技有限公司 | Fluorescent PCR reagent freeze-drying protective agent, freeze-drying method and application |
| CN114317700B (en) * | 2021-12-28 | 2024-01-30 | 无锡科智达科技有限公司 | Freeze-drying protective agent for fluorescent PCR (polymerase chain reaction) reagent, freeze-drying method and application |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108070583B (en) | 2021-03-30 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110452972B (en) | Freeze-dried microsphere of nucleic acid amplification reaction reagent and preparation method thereof | |
| CN111560417B (en) | Freeze-drying protective agent and freeze-drying method for RNA amplification reaction reagent | |
| CN108070583A (en) | Purposes of the hydroxypropyl-β-cyclodextrin in nucleic acid freezing drying protective agent is prepared | |
| JP5904153B2 (en) | Sample preparation method for nucleic acid amplification reaction, nucleic acid amplification method, reagent for solid phase nucleic acid amplification reaction, and microchip | |
| CN103911367A (en) | Freeze-drying protective agent of nucleic acid amplification reaction reagents and freeze-drying method | |
| CN111363858B (en) | 2019-nCoV S gene detection nucleic acid composition, kit and production method | |
| JP2009538146A (en) | Molecular diagnostic kit stable at room temperature | |
| CN102242188A (en) | Gene diagnosis and detection core reagent transportable at normal temperature and of high sensitivity and high specificity | |
| JP2011526492A (en) | Lyophilized composition for biochemical reactions | |
| CN106065400B (en) | Ribonucleic acid protective agent, kit, application and storage method | |
| ES2478890T3 (en) | Ready-to-use dry and stabilized composition containing nucleic acid polymerization enzymes for applications in molecular biology | |
| Choi et al. | Combined recombinase polymerase amplification/rkDNA–graphene oxide probing system for detection of SARS-CoV-2 | |
| WO2022127846A1 (en) | Preloaded pcr reaction reagent for nucleic acid amplification and preparation method therefor | |
| KR102021605B1 (en) | Lyophilization method of the composition for multi-target nucleic acid sequence amplification reaction | |
| CN111363859B (en) | Nucleic acid composition for 2019-nCoV detection, kit and production method thereof | |
| Pernthaler et al. | Simultaneous fluorescence in situ hybridization of mRNA and rRNA for the detection of gene expression in environmental microbes | |
| CN114015758A (en) | Freeze-drying protective agent, fluorescent PCR detection kit and freeze-drying process | |
| JP2015092870A (en) | Nucleic acid amplification reagent which can be preserved for long term | |
| CN113025757A (en) | Freeze-drying protective agent for 2019-nCov multiplex amplification reaction reagent and application thereof | |
| CN107227380A (en) | The primer sequence and method of a kind of synchronous detection PCV2 and PRV infection | |
| US20160355896A1 (en) | Incoated rna | |
| CN112210593B (en) | Freeze-drying protective agent, freeze-drying PCR reagent and application thereof | |
| CN112481253A (en) | Freeze-drying protection prescription for PCR premix | |
| Didenko | In situ ligation simplified: using PCR fragments for detection of double-strand DNA breaks in tissue sections | |
| CN112210594B (en) | Freeze-drying protective agent for reverse transcription reagent |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |