CN108018269B - Levansucrase mutant with improved thermal stability - Google Patents
Levansucrase mutant with improved thermal stability Download PDFInfo
- Publication number
- CN108018269B CN108018269B CN201810060609.6A CN201810060609A CN108018269B CN 108018269 B CN108018269 B CN 108018269B CN 201810060609 A CN201810060609 A CN 201810060609A CN 108018269 B CN108018269 B CN 108018269B
- Authority
- CN
- China
- Prior art keywords
- mutant
- enzyme
- levansucrase
- gly
- val
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/1048—Glycosyltransferases (2.4)
- C12N9/1051—Hexosyltransferases (2.4.1)
- C12N9/1055—Levansucrase (2.4.1.10)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P19/00—Preparation of compounds containing saccharide radicals
- C12P19/02—Monosaccharides
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P19/00—Preparation of compounds containing saccharide radicals
- C12P19/04—Polysaccharides, i.e. compounds containing more than five saccharide radicals attached to each other by glycosidic bonds
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P19/00—Preparation of compounds containing saccharide radicals
- C12P19/18—Preparation of compounds containing saccharide radicals produced by the action of a glycosyl transferase, e.g. alpha-, beta- or gamma-cyclodextrins
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y204/00—Glycosyltransferases (2.4)
- C12Y204/01—Hexosyltransferases (2.4.1)
- C12Y204/0101—Levansucrase (2.4.1.10)
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Biomedical Technology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Molecular Biology (AREA)
- Medicinal Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Enzymes And Modification Thereof (AREA)
Abstract
The invention discloses a levansucrase mutant with improved thermal stability, which belongs to the technical field of enzyme engineering, wherein levansucrase derived from a microorganism Brenneria sp.EniD312 is taken as a parent, a gene mutation technology is utilized, glutamic acid Glu at 404 position is replaced by tryptophan Trp to obtain a single mutant enzyme E404W, under the optimal catalysis condition, the half-life period of the total enzyme activity of an enzyme catalysis substrate sucrose synthesis β - (2,1) levan at 35 ℃ is improved to 52h from original 4h, the half-life period at 45 ℃ is improved to 12.5h from original 2.1h, and the half-life period at 55 ℃ is improved to 104min from original 42 min.
Description
Technical Field
The invention relates to a levansucrase mutant with improved thermal stability, belonging to the technical field of enzyme engineering.
Background
Fructans (fructans) are a ubiquitous carbohydrate in nature, which is mainly linked by fructosyl groups, research results show that each fructan molecule contains one molecule of glucose, and that its molecular end has no reducing property, fructans are widely present in some organisms in nature, bacteria, fungi, and about 15% of flowering plants, fructans are quite complex in structure due to differences in linkage position of fructosyl groups and differences in polymerization degree between species, fructans can be largely classified into two categories, namely (1) levan fructan, which is mainly linked by β - (2,6), which is mainly present in bacteria and monocotyledons, (2) inulin, which is mainly linked by β - (2,1), which is mainly present in plants, which is more convenient to extract, but whose solubility is inferior than levan fructan, which limits its use, research shows that fructans in plants are mainly distributed in cells, can regulate osmotic pressure, can play a role in regulating the resistance of phytolaconics, can increase the resistance to osmotic stress, can be exerted by new phytochemical agents, and the resistance to drought, can be more particularly, the anti-stress agents, which can provide protection against the accumulation of fructans against bacterial stress, and against drought.
Levansucrase is a member of the family of glycosyltransferases and belongs to the class of hexosyltransferases. It has transglycosylation activity, can use sucrose as substrate to produce levan fructan, a fructose polymer with large molecular weight, and also has hydrolytic activity, and can hydrolyze sucrose into glucose and fructose. In enzymatic studies, levansucrase is an enzyme that catalyzes the following chemical reaction:
sucrose + (2,6- β -D-fructosyl)nFructus Seu fructus Cyathulae glucose + (2,6- β -D-fructosyl)n+1
Most of the discovered bacteria produce levansucrase as an extracellular enzyme and vary widely among them, of which only a few have been studied.
Since Raj in 1999, the first time a levansucrase with the ability to synthesize levan was discovered from Zymomonas mobilis, a study of the production of levan using biotransformation has been in the history of over 10 years. To date, several microorganisms have been found to produce this enzyme, including Bacillus methylotrophicus, Bacillus licheniformis, Geobacillus stearothermophilus, Bacillus amyloliquefaciens, Lactobacillus reuteri, Lactobacillus panis, Lactobacillus sanfrancisciensis. In recent years, research focuses on the identification of the properties of levansucrase and the mechanism of elongation of levan long and short chains, so that in order to obtain a more suitable biocatalyst, molecular modification is performed on levansucrase from the microorganism Brenneriasp. EniD312 by a site-directed mutagenesis method, and Brsp-LS enzyme which is more suitable for industrial application is obtained in order to further improve the catalytic activity of the levansucrase.
Disclosure of Invention
The invention aims to provide a mutant enzyme E404W of levansucrase with improved thermal stability, which has important practical significance for the synthesis of levan.
The invention provides a mutant enzyme E404W of levansucrase with improved thermal stability, which is obtained by mutating levansucrase derived from a microorganism Brenneria sp.EniD312 to obtain single mutant enzyme; the glutamic acid Glu at position 404 in the original Brsp-LS enzyme was substituted for tryptophan Trp to obtain a single mutant enzyme E404W.
Compared with a wild enzyme Brsp-LS, the optimum catalytic condition of the mutant enzyme E404W of the Brsp-LS is not changed, but the half-life period of 35 ℃ in the process of catalyzing sucrose to synthesize levan is improved to 52h from 4h, the half-life period of 45 ℃ is improved to 12.5h from 2.1h, and the half-life period of 55 ℃ is improved to 104min from 42 min.
The invention also provides a recombinant expression plasmid pET-22b (+) -E404W carrying the enzyme E404W encoding said mutant.
The invention also provides a recombinant Escherichia coli BL21(DE3) expressing the mutant enzyme E404W, which contains a recombinant plasmid pET-22b (+) -E404W carrying a gene encoding the mutant enzyme E404W of Brsp-LS.
The Brsp-LS gene of the source microorganism Brenneria sp. EniD312 is numbered as CM001230.1 in GeneBank, the full length of the gene is 1317 nucleotides, shown as SEQ ID No. 1 in a sequence table, and codes 438 amino acids, shown as SEQ ID No. 2 in the sequence table.
The mutant enzyme of Brsp-LS is obtained by replacing glutamic acid Glu at position 404 in the gene of Brsp-LS enzyme with tryptophan Trp to obtain single mutant enzyme E404W, and the amino acid sequence of the single mutant enzyme is shown in SEQ ID No. 4 in the sequence table. The nucleotide sequence of the gene encoding E404W is shown in SEQ ID No. 3.
The invention also provides a preparation method of the mutant enzyme of the Brsp-LS enzyme, which comprises the following specific steps:
(1) determining a mutation site on the basis of a Brsp-LS enzyme simulation structure of Brenneria sp. EniD312;
(2) designing a mutant primer of site-directed mutagenesis, and constructing a mutant plasmid pET-22b (+) -E404W by using a vector pET-22b (+) -Brsp-LS carrying Brsp-LS enzyme gene as a template for site-directed mutagenesis;
the mutant primers are shown below, with the mutation points underlined:
upstream outer primer: 5'-TTATCCATATGGAGGATGCAAACATGCAT-3' the flow of the air in the air conditioner,
downstream outer primer: 5'-TATATCTCGAGCCGATAACACACTTCATT-3' the flow of the air in the air conditioner,
forward mutation primer: 5' -GGAACCTGGGCTCCCACGGTA-3', the mutated base is underlined,
reverse mutation primer: 5' -TACCGTGGGAGCCCAGGTTCCTC-3', the mutated bases are underlined;
(3) transforming the mutant plasmid pET-22b (+) -E404W into an escherichia coli BL21(DE3) cell, and selecting a verified positive monoclonal for fermentation culture;
(4) and (3) centrifuging the thallus, carrying out ultrasonic disruption after resuspension, and purifying by nickel ion affinity chromatography to obtain the mutant enzyme E404W.
Use of the mutant enzyme E404W: the method is applied to the fields of chemistry, food and pharmacy, the thermal stability is obviously improved, and the method provides favorable guarantee for further industrial application of levansucrase. The invention has the beneficial effects that: the invention provides a mutant enzyme E404W of Brsp-LS, the optimum catalysis condition of which is not changed, but the half-life period of 35 ℃ in the process of catalyzing sucrose synthesis to obtain levan is improved to 52h from 4h, the half-life period of 45 ℃ is improved to 12.5h from 2.1h, and the half-life period of 55 ℃ is improved to 104min from 42 min.
Drawings
FIG. 1 comparison of the thermostability of wild and mutant enzymes at different temperatures
Detailed Description
Example 1 preparation of Brsp-LS enzyme mutants
Construction of the pET-22b (+) -E404W mutant plasmid: the recombinant plasmid pET22b-Brsp-LS was constructed: a gene fragment BN1221_00994c of levansucrase levan enzyme was synthesized according to Brenneria sp.EniD312 (accession No. CGIG01000001.1) and ligated between cleavage sites Nde I and Xho I of pET-22b (+), to obtain a recombinant plasmid pET-22b (+) -Brsp-LS.
E404W site-directed mutation is introduced by taking pET-22b (+) -Brsp-LS plasmid as a template through PCRl, PCR2 and PCR3, and sequencing verification results show that random mutation does not occur except the required mutation site, so that the construction of the mutant plasmid pET-22b (+) -E404W is successful.
The mutant primers are shown below: (underline the mutant)
Upstream outer primer: 5'-TTATCCATATGGAGGATGCAAACATGCAT-3' the flow of the air in the air conditioner,
downstream outer primer: 5'-TATATCTCGAGCCGATAACACACTTCATT-3' the flow of the air in the air conditioner,
forward mutation primer: 5' -GGAACCTGGGCTCCCACGGTA-3', the mutated base is underlined,
reverse mutation primer: 5' -TACCGTGGGAGCCCAGGTTCCTC-3', the mutated bases are underlined;
PCR 1: composition of the reaction system:
a cloning vector pET-22b (+) -Brsp-LS with a levansucrase target gene is used as a template.
And (3) PCR 2: composition of the reaction system:
| 10×PCR Buffer | 5μL |
| dNTP(2mmol/L) | 4μL |
| downstream outer primer (10. mu.M) | 1μL |
| Forward mutation primer (10. mu.M) | 1μL |
| pET-22b(+)-Brsp-LS | 1μL |
| Taq Plus DNA polymerase(5U/μL) | 0.5μL |
| ddH2O | Make up the system to 50. mu.L |
The amplification conditions of PCRl and PCR2 are as follows:
pre-denaturation at 94 ℃ for 4 min; then denaturation at 94 ℃ for 1min, annealing at 56 ℃ for lmin, extension at 72 ℃ for 1min, and 35 cycles; finally, keeping the temperature at 72 ℃ for 10 min.
Detecting the amplification products of PCRl and PCR2 by agarose electrophoresis, and recovering and purifying the tapping rubber;
and (3) PCR: composition of the reaction system:
| 10×PCR Buffer | 10μL |
| dNTP(2mmol/L) | 8μL |
| upstream outer primer (10. mu.M) | 1μL |
| Downstream outer primer (10. mu.M) | 1μL |
| PCR1 purified product | 10μL |
| PCR2 purified product | 10μL |
| Taq Plus DNA polymerase(5U/μL) | 1μL |
| ddH2O | Make up the system to 100. mu.L |
The PCR3 amplification conditions were:
pre-denaturation at 94 ℃ for 4 min; then denaturation at 94 ℃ for 1min, annealing at 56 ℃ for lmin, extension at 72 ℃ for 1min, and 35 cycles; finally, keeping the temperature at 72 ℃ for 10 min.
The PCR3 amplification product after recovery and purification by agarose electrophoresis gel is cut by restriction enzymes Nde I and Xho I, then is connected to a vector pET-22b (+), and is transformed into an escherichia coli DH5 α competent cell, after being cultured overnight in an LB solid culture medium containing 50 mug/mL of aminopenicillin, a single clone is picked up and cultured in an LB liquid culture medium containing 50 mug/mL of aminopenicillin, then a mutant plasmid pET-22b (+) -E404W is extracted, the mutant plasmid pET-22b (+) -E404W is transformed into a host escherichia coli BL21(DE3) competent cell, and the mutant plasmid is identified as a correct mutation by sequencing.
Example 2 method for the purification of the expression of a mutant enzyme of Brsp-LS from Brenneria sp. EniD312.
And (3) transforming the mutant plasmid pET-22b (+) -E404W subjected to sequencing verification into a cell of escherichia coli BL21(DE3), selecting a positive transformant, shaking and culturing the positive transformant in an LB (Luria Broussonetia) culture medium at 37 ℃ and 200rpm overnight, inoculating the positive transformant into the LB culture medium at 37 ℃ for culturing for 3-4h until the OD value is 0.6-0.8, cooling to 30 ℃, and adding IPTG (isopropyl thiogalactoside) with the final concentration of 0.6mM for inducing for 6 h.
The fermentation broth was centrifuged at 4 ℃ and l0000rpm for 20min to obtain the cells. 20mL of buffer (50mM PBS, 200mM NaCl, pH adjusted to 6.0) was added to resuspend the cells thoroughly, and the centrifuge tube was placed in an ice bath and placed in an ultrasonic cell disrupter under the following conditions: working time ls, stop time 2s, for a total of 18 min. And centrifuging the obtained crushed solution at low temperature and high speed for 30min at 4 ℃ and 10000rpm to obtain a crude enzyme solution. Filtering with 0.45 μm microporous membrane.
A nickel ion affinity chromatography column was prepared by first pumping deionized water into the column (about 6-12 column volumes) at 4 ℃ using a constant flow pump, and then equilibrating the column environment with a low salt concentration buffer (500mmol/L NaCl, 50mM PBS to pH 6.0). When the effluent at the lower end of the column and the low salt concentration buffer pumped into the column have the same pH value (about 5 column volumes of buffer), the resulting membrane-passed crude enzyme solution is added to the column. The heteroprotein was washed with a buffer containing low imidazole concentration (500mmol/L NaCl, 50mmol/L imidazole, 50mM PBS pH adjusted to 6.0) to baseline equilibrium and eluted with an eluent containing high imidazole concentration (500mmol/L NaCl, 500mmol/L imidazole, 50mM PBS pH adjusted to 6.0). Collecting the eluate of the absorption peak, and determining the enzyme activity to obtain the target protein. The purified mutant enzyme E404W of Brsp-LS was electrophoretically pure.
Example 3: thermal stability assay of mutant enzymes of Brsp-LS of Brenneria sp.
The invention compares the thermal stability change of enzyme before and after mutation, wherein the wild enzyme refers to the levansucrase from Brenneriasp. EniD312, mutant enzyme E404W.
The method for measuring the enzymatic activity of the levan sucrase comprises the following steps:
1mL of a reaction system comprising sucrose at a final concentration of 10% (w/v), a phosphate buffer solution of pH6.0 at a final concentration of 50mM, and 10. mu.g/mL of pure enzyme was reacted at 45 ℃ for 20min, and the reaction was terminated by a boiling water bath for 10 min. 1U total enzyme activity is defined as the amount of enzyme required to produce 1. mu. mol glucose per minute for the reaction at 45 ℃ at pH 6.0. The amount of levan synthesized was measured by HPLC, and the enzyme activity was calculated.
Half-life comparison
As shown in FIG. 1, the residual enzyme activity was measured after incubation at 35 deg.C (FIG. 1A), 45 deg.C (FIG. 1B) and 55 deg.C (FIG. 1C) for a certain period of time, and the half-life t was calculated using the initial enzyme activity at 0 time of incubation at 35 deg.C, 45 deg.C and 55 deg.C as 100%1/2. The half-life period of 35 ℃ is improved to 52h from the original 4h, the residual enzyme activity after heat preservation for 6h is improved to 524U/mg from the original 250U/mg, the half-life period of 45 ℃ is improved to 12.5h from the original 2.1h, the half-life period after heat preservation for 6h is improved to 410U/mg from the original 80U/mg, the half-life period of 55 ℃ is improved to 104min from the original 42min, and the half-life period after heat preservation for 120min is improved to 239U/mg from the original 114U/mg.
Although the present invention has been described with reference to the preferred embodiments, it should be understood that various changes and modifications can be made therein by those skilled in the art without departing from the spirit and scope of the invention as defined in the appended claims.
SEQUENCE LISTING
<110> university of south of the Yangtze river
<120> a levansucrase mutant with improved thermostability
<160>8
<170>PatentIn version 3.3
<210>1
<211>1314
<212>DNA
<213>Brenneria sp. EniD312
<400>1
atgagtgaac tatatcaagc taaaagtgaa acaagaagcaccattaccag ttcccttaaa 60
ggaattcagc cgtacaagcc gacaaaggcg acaatctggt cgcgggccga tgcgctgaag 120
gtcaatgaat acgacccgac caccacccaa ccgctggtca gcggggattt cccggtgatg 180
agcgatgaag tgtttatctg ggacaccatg ccgctgcgcg atattgacgg caatatcgcc 240
tcggttaacg gctggtcggt gattttcacc ctgaccgccg accgtaaccc gactgcgccg 300
gagtatcagg acgaacaggg caattacgat atcaccctcg actggaacga tcgccacggc 360
cgggcaaaaa tgtacttctg gtattcacgc accggcaaag actggatcat aggcggtcgc 420
gtaatggccg aaggggtgtc gccgaccgcg cgcgaatggg ccggtacgcc ggttctgttg 480
aacgaacgcg gcgaaattga cctgtattac accgccgtaa cgccgggcgc gaccgtcgtc 540
aaagtgcgcg gtcgcgtagt gaccacggaa aacggcgtgg aaatggtagg ctttaaaaag 600
gtgaaaagtc tgtttgaggc ggatggcaaa atgtaccaga ccgaaagcca aaacccgtac 660
tgggctttcc gcgatccctg cccgttccgc gatccgaaaa gcggcaagct gtatatgttg 720
tttgaaggca acgttgccgg ggagcgtggc tcgcacgtgg tcggtcccga cgaactgggc 780
gatgtgccgc cgggctacga ggatgccggt aattcccact tccaaacggg ctgcatcggt 840
attgcggtgt gccgcgacga ggatggggat gactgggaac tgctgccgcc gttgattacc 900
gccgtcggcg ttaacgacca gaccgaacgt ccgcactttg ttttccagga cggaaaatat 960
tatctgttca ccatcagcca taagtttacc tatggcgacg gtctcaccgg gcccgacggc 1020
gtgtacgggt tcgtcagtga aaacctgttc gggccttacg tgccgctgaa tggttctggc 1080
ctggtgctgg ggaatccccc ttcacagcct taccagacct actcgcacta cgttatgccc 1140
aacggtctgg tgacgtcctt cattgattcg gtgccgacgg gtgaagacag ctatcgtatc 1200
ggaggaaccg aagctcccac ggtattgatc aaactgaaag gcgcacagac cttcgtgctg 1260
gaagagttcg attatggtta tattccccca atgattgatg ttaaggtgga ataa 1314
<210>2
<211>437
<212>PRT
<213>Brenneria sp. EniD312
<400>2
Met Ser Glu Leu Tyr Gln Ala Lys Ser Glu Thr Arg Ser Thr Ile Thr
1 5 10 15
Ser Ser Leu Lys Gly Ile Gln Pro Tyr Lys Pro Thr Lys Ala Thr Ile
20 25 30
Trp Ser Arg Ala Asp Ala Leu Lys Val Asn Glu Tyr Asp Pro Thr Thr
35 40 45
Thr Gln Pro Leu Val Ser Gly Asp Phe Pro Val Met Ser Asp Glu Val
50 55 60
Phe Ile Trp Asp Thr Met Pro Leu Arg Asp Ile Asp Gly Asn Ile Ala
65 70 75 80
Ser Val Asn Gly Trp Ser Val Ile Phe Thr Leu Thr Ala Asp Arg Asn
85 90 95
Pro Thr Ala Pro Glu Tyr Gln Asp Glu Gln Gly Asn Tyr Asp Ile Thr
100 105110
Leu Asp Trp Asn Asp Arg His Gly Arg Ala Lys Met Tyr Phe Trp Tyr
115 120 125
Ser Arg Thr Gly Lys Asp Trp Ile Ile Gly Gly Arg Val Met Ala Glu
130 135 140
Gly Val Ser Pro Thr Ala Arg Glu Trp Ala Gly Thr Pro Val Leu Leu
145 150 155 160
Asn Glu Arg Gly Glu Ile Asp Leu Tyr Tyr Thr Ala Val Thr Pro Gly
165 170 175
Ala Thr Val Val Lys Val Arg Gly Arg Val Val Thr Thr Glu Asn Gly
180 185 190
Val Glu Met Val Gly Phe Lys Lys Val Lys Ser Leu Phe Glu Ala Asp
195 200 205
Gly Lys Met Tyr Gln Thr Glu Ser Gln Asn Pro Tyr Trp Ala Phe Arg
210 215 220
Asp Pro Cys Pro Phe Arg Asp Pro Lys Ser Gly Lys Leu Tyr Met Leu
225 230 235 240
Phe Glu Gly Asn Val Ala Gly Glu Arg Gly Ser His Val Val Gly Pro
245 250 255
Asp Glu Leu Gly Asp Val Pro Pro Gly Tyr Glu Asp Ala Gly Asn Ser
260 265 270
His Phe Gln Thr Gly Cys Ile Gly Ile Ala Val Cys Arg Asp Glu Asp
275 280 285
Gly Asp Asp Trp Glu Leu Leu Pro Pro Leu Ile Thr Ala Val Gly Val
290 295 300
Asn Asp Gln Thr Glu Arg Pro His Phe Val Phe Gln Asp Gly Lys Tyr
305 310 315 320
Tyr Leu Phe Thr Ile Ser His Lys Phe Thr Tyr Gly Asp Gly Leu Thr
325 330 335
Gly Pro Asp Gly Val Tyr Gly Phe Val Ser Glu Asn Leu Phe Gly Pro
340 345 350
Tyr Val Pro Leu Asn Gly Ser Gly Leu Val Leu Gly Asn Pro Pro Ser
355 360 365
Gln Pro Tyr Gln Thr Tyr Ser His Tyr Val Met Pro Asn Gly Leu Val
370 375 380
Thr Ser Phe Ile Asp Ser Val Pro Thr Gly Glu Asp Ser Tyr Arg Ile
385 390 395 400
Gly Gly Thr Glu Ala Pro Thr Val Leu Ile Lys Leu Lys Gly Ala Gln
405 410 415
Thr Phe Val Leu Glu Glu Phe Asp Tyr Gly Tyr Ile Pro Pro Met Ile
420 425 430
Asp Val Lys Val Glu
435
<210>3
<211>1314
<212>DNA
<213> Artificial sequence
<400>3
atgagtgaac tatatcaagc taaaagtgaa acaagaagca ccattaccag ttcccttaaa 60
ggaattcagc cgtacaagcc gacaaaggcg acaatctggt cgcgggccga tgcgctgaag 120
gtcaatgaat acgacccgac caccacccaa ccgctggtca gcggggattt cccggtgatg 180
agcgatgaag tgtttatctg ggacaccatg ccgctgcgcg atattgacgg caatatcgcc 240
tcggttaacg gctggtcggt gattttcacc ctgaccgccg accgtaaccc gactgcgccg 300
gagtatcagg acgaacaggg caattacgat atcaccctcg actggaacga tcgccacggc 360
cgggcaaaaa tgtacttctg gtattcacgc accggcaaag actggatcat aggcggtcgc 420
gtaatggccg aaggggtgtc gccgaccgcg cgcgaatggg ccggtacgcc ggttctgttg 480
aacgaacgcg gcgaaattga cctgtattac accgccgtaa cgccgggcgc gaccgtcgtc 540
aaagtgcgcg gtcgcgtagt gaccacggaa aacggcgtgg aaatggtagg ctttaaaaag 600
gtgaaaagtc tgtttgaggc ggatggcaaa atgtaccaga ccgaaagcca aaacccgtac 660
tgggctttcc gcgatccctg cccgttccgc gatccgaaaa gcggcaagct gtatatgttg 720
tttgaaggca acgttgccgg ggagcgtggc tcgcacgtgg tcggtcccga cgaactgggc 780
gatgtgccgc cgggctacga ggatgccggt aattcccact tccaaacggg ctgcatcggt 840
attgcggtgt gccgcgacga ggatggggatgactgggaac tgctgccgcc gttgattacc 900
gccgtcggcg ttaacgacca gaccgaacgt ccgcactttg ttttccagga cggaaaatat 960
tatctgttca ccatcagcca taagtttacc tatggcgacg gtctcaccgg gcccgacggc 1020
gtgtacgggt tcgtcagtga aaacctgttc gggccttacg tgccgctgaa tggttctggc 1080
ctggtgctgg ggaatccccc ttcacagcct taccagacct actcgcacta cgttatgccc 1140
aacggtctgg tgacgtcctt cattgattcg gtgccgacgg gtgaagacag ctatcgtatc 1200
ggaggaacct gggctcccac ggtattgatc aaactgaaag gcgcacagac cttcgtgctg 1260
gaagagttcg attatggtta tattccccca atgattgatg ttaaggtgga ataa 1314
<210>4
<211>437
<212>PRT
<213> Artificial sequence
<400>4
Met Ser Glu Leu Tyr Gln Ala Lys Ser Glu Thr Arg Ser Thr Ile Thr
1 5 10 15
Ser Ser Leu Lys Gly Ile Gln Pro Tyr Lys Pro Thr Lys Ala Thr Ile
20 25 30
Trp Ser Arg Ala Asp Ala Leu Lys Val Asn Glu Tyr Asp Pro Thr Thr
35 40 45
Thr Gln Pro Leu Val Ser Gly Asp Phe Pro Val Met Ser Asp Glu Val
50 55 60
Phe Ile Trp Asp Thr Met Pro Leu Arg Asp Ile Asp Gly Asn Ile Ala
65 70 75 80
Ser Val Asn Gly Trp Ser Val Ile Phe Thr Leu Thr Ala Asp Arg Asn
85 90 95
Pro Thr Ala Pro Glu Tyr Gln Asp Glu Gln Gly Asn Tyr Asp Ile Thr
100 105 110
Leu Asp Trp Asn Asp Arg His Gly Arg Ala Lys Met Tyr Phe Trp Tyr
115 120 125
Ser Arg Thr Gly Lys Asp Trp Ile Ile Gly Gly Arg Val Met Ala Glu
130 135 140
Gly Val Ser Pro Thr Ala Arg Glu Trp Ala Gly Thr Pro Val Leu Leu
145 150 155 160
Asn Glu Arg Gly Glu Ile Asp Leu Tyr Tyr Thr Ala Val Thr Pro Gly
165 170 175
Ala Thr Val Val Lys Val Arg Gly Arg Val Val Thr Thr Glu Asn Gly
180 185 190
Val Glu Met Val Gly Phe Lys Lys Val Lys Ser Leu Phe Glu Ala Asp
195 200 205
Gly Lys Met Tyr Gln Thr Glu Ser Gln Asn Pro Tyr Trp Ala Phe Arg
210 215 220
Asp Pro Cys Pro Phe Arg Asp Pro Lys Ser Gly Lys Leu Tyr Met Leu
225 230 235 240
Phe Glu Gly Asn Val Ala Gly Glu Arg Gly Ser His Val Val Gly Pro
245 250 255
Asp Glu Leu Gly Asp Val Pro Pro Gly Tyr Glu Asp Ala Gly Asn Ser
260 265 270
His Phe Gln Thr Gly Cys Ile Gly Ile Ala Val Cys Arg Asp Glu Asp
275 280 285
Gly Asp Asp Trp Glu Leu Leu Pro Pro Leu Ile Thr Ala Val Gly Val
290 295 300
Asn Asp Gln Thr Glu Arg Pro His Phe Val Phe Gln Asp Gly Lys Tyr
305 310 315 320
Tyr Leu Phe Thr Ile Ser His Lys Phe Thr Tyr Gly Asp Gly Leu Thr
325 330 335
Gly Pro Asp Gly Val Tyr Gly Phe Val Ser Glu Asn Leu Phe Gly Pro
340 345 350
Tyr Val Pro Leu Asn Gly Ser Gly Leu Val Leu Gly Asn Pro Pro Ser
355 360 365
Gln Pro Tyr Gln Thr Tyr Ser His Tyr Val Met Pro Asn Gly Leu Val
370 375 380
Thr Ser Phe Ile Asp Ser Val Pro Thr Gly Glu Asp Ser Tyr Arg Ile
385 390 395 400
Gly Gly Thr Trp Ala Pro Thr Val Leu Ile Lys Leu Lys Gly Ala Gln
405 410 415
Thr Phe Val Leu Glu Glu Phe Asp Tyr Gly Tyr Ile Pro Pro Met Ile
420 425 430
Asp Val Lys Val Glu
435
<210>5
<211>29
<212>DNA
<213> Artificial sequence
<400>5
ttatccatat ggaggatgca aacatgcat 29
<210>6
<211>29
<212>DNA
<213> Artificial sequence
<400>6
tatatctcga gccgataaca cacttcatt 29
<210>7
<211>21
<212>DNA
<213> Artificial sequence
<400>7
ggaacctggg ctcccacggt a 21
<210>8
<211>23
<212>DNA
<213> Artificial sequence
<400>8
taccgtggga gcccaggttc ctc 23
Claims (12)
1. A mutant levansucrase enzyme having the amino acid sequence shown in SEQ ID No. 4, wherein glutamic acid Glu at position 404 of levansucrase derived from Brenneria sp. EniD312 is substituted for tryptophan Trp.
2. The mutant levansucrase enzyme according to claim 1 wherein the gene sequence encoding the mutant levansucrase enzyme is shown in SEQ ID No 3.
3. A gene encoding the mutant enzyme of claim 1 or 2.
4. A plasmid carrying the gene of claim 3.
5. A microbial cell carrying the gene of claim 3.
6. A recombinant Escherichia coli expressing the mutant enzyme of claim 1 or 2, wherein the recombinant expression plasmid pET-22b (+) -E404W is transformed with Escherichia coli BL21(DE3) as a host.
7. The method for preparing the mutant enzyme according to claim 1 or 2, which comprises the steps of:
(1) determining a mutation site on the basis of a levansucrase mimic structure of Brenneria sp. enid 312;
(2) designing forward and reverse primers by taking a recombinant plasmid pET-22b (+) -Brsp-LS as a template, and carrying out site-directed mutagenesis on levansucrase of Brenneria sp.EniD312 by using a two-step method, wherein the preparation method of the recombinant plasmid pET-22b (+) -Brsp-LS comprises the following steps: synthesizing a gene fragment BN1221_00994c of levansucrase levan enzyme shown in SEQ ID No. 1, and connecting the gene fragment BN to an enzyme cutting site Nde I and an Xho I of pET-22b (+), so as to obtain a recombinant plasmid pET-22b (+) -Brsp-LS;
(3) introducing the successfully constructed mutant plasmid into an expression host E.coliBL21(DE3), and selecting the verified positive monoclonal for induced expression culture;
(4) and (3) centrifuging the thallus, carrying out ultrasonic disruption after resuspension, and purifying by nickel ion affinity chromatography to obtain the mutant enzyme E404W.
8. Use of a mutant enzyme according to claim 1 or 2 for the preparation of fructan, glucose or fructose.
9. Use of the plasmid of claim 4 for the preparation of levan, glucose or fructose.
10. Use of the microbial cell of claim 5 for the preparation of levan, glucose or fructose.
11. Use of the mutant enzyme according to claim 1 or 2 in the fields of chemistry, food and pharmaceuticals.
12. Use of the recombinant E.coli strain of claim 6 for the preparation of fructan, glucose or fructose.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810060609.6A CN108018269B (en) | 2018-01-22 | 2018-01-22 | Levansucrase mutant with improved thermal stability |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810060609.6A CN108018269B (en) | 2018-01-22 | 2018-01-22 | Levansucrase mutant with improved thermal stability |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108018269A CN108018269A (en) | 2018-05-11 |
| CN108018269B true CN108018269B (en) | 2020-05-08 |
Family
ID=62075164
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810060609.6A Active CN108018269B (en) | 2018-01-22 | 2018-01-22 | Levansucrase mutant with improved thermal stability |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108018269B (en) |
Families Citing this family (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110396512B (en) * | 2019-07-26 | 2021-03-02 | 江南大学 | Inulin sucrase mutant and application thereof |
| CN112251420A (en) * | 2020-10-23 | 2021-01-22 | 沈阳农业大学 | Bacterial levan synthetase from strict anaerobe |
| CN113512544B (en) * | 2021-07-14 | 2023-08-08 | 江南大学 | Mannose isomerase mutant with improved heat stability |
| CN114231511B (en) * | 2021-12-17 | 2023-08-08 | 江南大学 | Difructosan hydrolase mutant E160F with improved thermostability |
| CN114790472B (en) * | 2022-03-25 | 2024-04-16 | 上海龙殷生物科技有限公司 | Fructosyl curcumin, preparation method and application |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102533605A (en) * | 2012-01-16 | 2012-07-04 | 江南大学 | Strain capable of producing levansucrase and method for producing levan by using levansucrase |
| CN104073456A (en) * | 2014-07-10 | 2014-10-01 | 江南大学 | Bacterial strain for producing levansucrase and method for producing lactosucrose by utilizing lavansucrase |
-
2018
- 2018-01-22 CN CN201810060609.6A patent/CN108018269B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102533605A (en) * | 2012-01-16 | 2012-07-04 | 江南大学 | Strain capable of producing levansucrase and method for producing levan by using levansucrase |
| CN104073456A (en) * | 2014-07-10 | 2014-10-01 | 江南大学 | Bacterial strain for producing levansucrase and method for producing lactosucrose by utilizing lavansucrase |
Non-Patent Citations (2)
| Title |
|---|
| Efficient biosynthesis of levan from sucrose by a novel levansucrase from Brenneria goodwinii;Qian Liu et al.;《Carbohydrate Polymers》;20161122;第157卷;第1732-1740页 * |
| NCBI Reference Sequence: WP_009114565.1;NCBI;《NCBI》;20170712;第1页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108018269A (en) | 2018-05-11 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108018269B (en) | Levansucrase mutant with improved thermal stability | |
| CN108559735B (en) | Construction and application of leucine dehydrogenase mutant | |
| CN111647579B (en) | Thermolabile exoinulase mutant MutQ23 delta 9 and preparation and application thereof | |
| CN110592059B (en) | Maltooligosyl trehalose synthase mutant | |
| EP3104717B1 (en) | Sucrose reduction and generation of insoluble fiber in juices | |
| CN108034648B (en) | D-psicose 3-epimerase mutant with improved thermal stability | |
| CN108018278B (en) | D-psicose 3-epimerase mutant with improved catalytic efficiency | |
| CN110396512B (en) | Inulin sucrase mutant and application thereof | |
| CN109486794B (en) | Chitinase mutant with improved enzyme activity | |
| CN110452919B (en) | Truncated alginate lyase Aly7B-CDII gene and application thereof | |
| CN112391365B (en) | Starch branching enzyme mutant with improved catalytic activity and application thereof | |
| CN112725319B (en) | Alginate lyase FaAly7 with polyG substrate specificity and application thereof | |
| CN115960875A (en) | Alginate lyase mutant enzyme with improved thermal stability | |
| CN110055233B (en) | MTSase mutant with improved thermal stability and application thereof | |
| CN106801046B (en) | Acid pullulanase mutant with improved thermal stability as well as encoding gene and application thereof | |
| CN111269907A (en) | Alginate lyase mutant based on loop region transformation and application thereof | |
| CN109022396B (en) | Alpha-amylase mutant with improved enzyme activity and application thereof | |
| Schründer et al. | Extranuclear Expression of the Bacterial Xylose Isomerase (Xyl A) and the UDP-Glucose Dehydrogenase (Has B) Genes in Yeast with Kluyveromyces lactis Linear Killer Plasmids as Vectors | |
| CN110684754B (en) | Mycotoxin ZEN degrading enzyme mutant and application thereof | |
| CN110229800B (en) | Linear maltooligosaccharide-producing enzyme mutant with improved maltohexaose production capacity | |
| CN113302299A (en) | Psicose epimerase variants, methods of producing the same, and methods of producing psicose using the same | |
| CN116286762A (en) | Glutamate decarboxylase and application thereof | |
| CN114231511B (en) | Difructosan hydrolase mutant E160F with improved thermostability | |
| CN113699131B (en) | Alpha-cyclodextrin glucosyltransferase mutant and application thereof | |
| CN115820608A (en) | Lambda-carrageenase mutant OUC-Cglobal A-DPQQ and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |