CN108004241A - Tobacco nitrate reductase NIA2 promoters, its expression vector and its application - Google Patents
Tobacco nitrate reductase NIA2 promoters, its expression vector and its application Download PDFInfo
- Publication number
- CN108004241A CN108004241A CN201711395854.4A CN201711395854A CN108004241A CN 108004241 A CN108004241 A CN 108004241A CN 201711395854 A CN201711395854 A CN 201711395854A CN 108004241 A CN108004241 A CN 108004241A
- Authority
- CN
- China
- Prior art keywords
- promoter
- nia2
- sequence
- tobacco
- expression
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/0004—Oxidoreductases (1.)
- C12N9/0012—Oxidoreductases (1.) acting on nitrogen containing compounds as donors (1.4, 1.5, 1.6, 1.7)
- C12N9/0044—Oxidoreductases (1.) acting on nitrogen containing compounds as donors (1.4, 1.5, 1.6, 1.7) acting on other nitrogen compounds as donors (1.7)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
- C12N15/8237—Externally regulated expression systems
- C12N15/8238—Externally regulated expression systems chemically inducible, e.g. tetracycline
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y107/00—Oxidoreductases acting on other nitrogenous compounds as donors (1.7)
- C12Y107/99—Oxidoreductases acting on other nitrogenous compounds as donors (1.7) with other acceptors (1.7.99)
- C12Y107/99004—Nitrate reductase (1.7.99.4)
Landscapes
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Biomedical Technology (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Cell Biology (AREA)
- General Chemical & Material Sciences (AREA)
- Plant Pathology (AREA)
- Medicinal Chemistry (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
Grow tobacco nitrate reductase the invention discloses oneNIA2Promoter, its expression vector and its application.ShouldNIA2The nucleotides sequence of promoter is classified as：The sequence as shown in SEQ ID NO.1；Or on the basis of the core promoter sequence of sequence as shown in SEQ ID NO.1 is retained, through removing or doublingNIA2Expression, withThe highly similar key element of signal response element sequence；Or there is equal nucleotide sequence derived from sequence as shown in SEQ ID NO.1.One kind hasNIA2The carrier for expression of eukaryon for Genetic Transformation in Higher Plants of promoter sequence.One kind hasNIA2The engineering bacteria for Genetic Transformation in Higher Plants of promoter sequence.NIA2Application of the promoter in destination gene expression is started, target gene areGUSGene.The present invention is verificationNIA2The research of promoter nitric acid signal response function lays the first stone, and has bright prospects to improving plant nitrogen efficiency, saving nitrogen fertilizer amount and the environmentally friendly agricultural of development resource economizing type.
Description
Technical field
The present invention relates to technical field of molecular biology, and in particular to one grows tobacco nitrate reductaseNIA2Promoter, its
Expression vector and its application.
Background technology
Macronutrient necessary to nitrogen is plant growth, participates in the composition of the large biological molecules such as protein, DNA/RNA,
All play an important role during protein synthesis, enzyme function, pigment and Secondary Metabolism of Plant, be called " life member
Element ".
Nitrate nitrogen and ammonium nitrogen are two kinds of main nitrogens of crop, and wherein nitrate nitrogen can induce and regulate and control a base more than 1000
The expression of cause, due to the continuous change of extraneous nitrogen nutrition, plant needs constantly to adjust the growth of itself and internal metabolism
Journey with adapt to can utilize nitrogen nutrition composition fluctuation, during this adjusting, nitrate anion（）It is that sensing is outer in plant
One key signal molecule of boundary's nitrogen nutrition change.
Nitrate reductase（Nitrate Reductase,NIA）And nitrite reductase（Nitrite reductase,NIR）Gene be typically byThe gene of adjusting.Nitrate nitrogen withAfter form enters plant, first by cytoplasm
'sNIAIt is reduced to nitrite anions, Ran HouNIRAmmonium is reduced under effect（）,Closed under the action of a series of enzymes
Into various amino acid.
NIA is first key enzyme of nitrate metabolism in plant, withAccumulation it is in close relations, directly influence
The utilization rate of plant nitrogen fertilizer.NIAGene andNIRThe high expression of gene can also influence the nitrogen metabolism process of plant,NIAGene
Height expression can increase the accumulation of seed-protein, the high expression in tobaccoNIRAfter gene, the C N metabolism of blade is shown
Writing influences, and blade holds green time lengthening, in bladeNIAActivity also has rise, at the same time, proline, glutamine and paddy
The content of propylhomoserin has decline.
Promoter is located at structural gene 5 ' and holds upstream, can instruct the correct combination of holoenzyme and masterplate, activation RNA polymerizations
Enzyme, and with the form of starting specific transcriptional, determine direction and efficiency and the used RNA polymerase class transcribed
Type, is the center of transcriptional control.The expression and regulation and control of eukaryotic gene are one of centre points of plant genetic engineering research, are started
Son is a kind of important controlling element on transcriptional level.
Research report, in various plantsNIRAll there are the conserved sequence of a 43bp long in gene promoter, through research
It was found that the sequence is oneThe cis-acting elements of response（NRE）, the core sequence of the element is tGaCCcTT-N (9-
10)-AAGaG, the sequence forGene expression regulation in the signal transduction pathway of mediation is required, in rice, jade
The promoter of NIR have also discovered the presence of the element in the plant such as rice and sorghum.Newest result of study shows, in rice nitric acid
There is also the similar component of a 20bp long in transport protein NAR2.1, to the gene responseThe process of signal, which has, to be adjusted
Effect.In arabidopsisNIA13 '-flanking regions of gene also containing two similar NRE sequences, are affected by responseThe regulation and control of the NIR transcription factors of signal.Also studies have found that,NIAThe promoter region of gene there are 3 non-NRE
The motif of sequence（Motif）, forNIAThe expression regulation of gene is extremely important, is MYB binding motifs（C-G/C-GTT-G/A）,
ALFINI binding motifs（Core sequence is C/A-CAC）With E-box motifs（CAAGTG）.
However, not yet clearly act at presentNIAGene promoter regionSignal response element, there is an urgent need to grind
Study carefullyNIAThe promoter regulation element of gene and whether depositSignal response element, further to verify itSignal is rung
The research of function is answered to lay the first stone, it is environmental-friendly to improving plant nitrogen efficiency, saving nitrogen fertilizer amount and development resource economizing type
Type agricultural has great importance.
The content of the invention
Grow tobacco nitrate reductase the technical problem to be solved in the present invention is to provide oneNIA2Promoter, its expression vector and
It is applied.
In order to solve the above technical problems, the technical thought of the present invention is as follows：
Plant tobacco is material to the present invention in mode, clones, identifies tobaccoNIA2The promoter sequence of gene, findsNIA2
Gene promoter position there are GACCCTA-N for -335bp~-316bp in region（10）- AAG sequences, the sequence is with having reported
RoadNIR1The core sequence GACCCTT-N of NRE in gene promoter（9-10）- AAG only has a Nucleotide differences, i.e. " T "
" A " is sported, a step of going forward side by side, which demonstrate,proves the controlling element, to be regulated and controledGUSThe expression of gene, deletes or doubles（4 times）Regulation and control member
Part has a certain impact GUS activity.
The element may be responded equally as NRE elementsSignal is simultaneously rightNIA2The transcription of gene and expression regulation rise
Effect, it is also possible to which the position that a nucleotide changes is precisely that critical sites cause the sequence to play different from NRE members
The adjusting function of part.
The present invention is as follows using concrete technical scheme：
One grows tobacco nitrate reductaseNIA2Promoter, its nucleotides sequence are classified as：
（1）Nucleotide sequence as shown in SEQ ID NO.1；Or
（2）On the basis of the core promoter sequence for retaining the nucleotide sequence as shown in SEQ ID NO.1, through removing or doubling
Regulation and controlNIA2Expression, withThe highly similar key element of signal response element sequence；Or
（3）There is equal nucleotide sequence as derived from the nucleotide sequence shown in SEQ ID NO.2.
Preferably, the multiple doubled is 2~5.
A kind of carrier for expression of eukaryon for Genetic Transformation in Higher Plants is designed, which has the tobacco nitrate reductaseNIA2Promoter sequence.
A kind of engineering bacteria for Genetic Transformation in Higher Plants is designed, which has the tobacco nitrate reductaseNIA2
Promoter sequence.
The tobacco nitrate reductaseNIA2Application of the promoter in destination gene expression is started.
Preferably, the target gene isGUSGene.
The tobacco nitrate reductaseNIA2Promoter startsGUSThe method of gene expression, comprises the following steps：
（1）By the tobacco nitrate reductaseNIA2Promoter insertion containsGUSThe expression vector of gene, is carried with replacing the expression
Existing promoter, obtains recombinant plasmid in body；
（2）Gained recombinant plasmid is imported to set out and plant and is cultivated, in the plant that sets out by the tobacco nitric acid also
ProtoenzymeNIA2Promoter starts in the recombinant plasmidGUSGene expression；
（3）GUS dyeing, and quantitative analysis are carried out to the blade for cultivating plant.
Preferably, the plant that sets out is dicotyledon.
Preferably, the dicotyledon is Ben's tobacco.
Compared with prior art, advantageous effects of the invention are：
1. the present invention has separated tobacco N metabolic key enzymes firstNIA2The promoter sequence of gene.
2. the present invention is first to possible in promoterSignal response element is transformed（Such as deletion or plus 4
Times）, there is provided promoter sequence can startGUSGene is expressed in tobacco.
3. promoter sequence provided by the invention and possibleSignal response element is improving plant nitrogen efficiency, is saving
There are wide application space and market prospects on nitrogen fertilizer amount.
Brief description of the drawings
Fig. 1：Tobacco nitrate reductaseNIA2The PCR amplification electrophoretogram of promoter.
Fig. 2：Tobacco nitrate reductaseNIA2It is promoter, possibleThe GUS of signal response element transformation fragment is instantaneous
Expression vector establishment conceptual scheme.
Fig. 3-1：Tobacco nitrate reductaseNIA2It is promoter, possibleSignal response element transforms the restructuring of promoter
One of vector construction schematic diagram.
Fig. 3-2：Tobacco nitrate reductaseNIA2It is promoter, possibleSignal response element transforms the restructuring of promoter
The two of vector construction schematic diagram.
Fig. 3-3：Tobacco nitrate reductaseNIA2It is promoter, possibleSignal response element transforms the restructuring of promoter
The three of vector construction schematic diagram.
Fig. 4：Tobacco nitrate reductaseNIA2It is promoter, possibleSignal response element transforms the GUS tables of promoter
Electrophoretogram is extracted up to vector plasmid.
Fig. 5：Agrobacterium EHA105 injection Ben Shi cigarette sketches containing recombinant plasmid.
Fig. 6：Inject the blade GUS colored graphs of Ben's tobacco.
Fig. 7：In the Ben's tobacco leaf of dyeingGUSThe quantitative fluorescent PCR analysis chart of gene expression amount.
Embodiment
Illustrate the embodiment of the present invention with reference to the accompanying drawings and examples, but following embodiments are used only in detail
Describe the bright present invention in detail, do not limit the scope of the invention in any way.
Involved reagent, is then conventional commercial product unless otherwise instructed in following embodiments.People in the art
Member can make conventional selection or accommodation according to concrete application scene.Involved experiment side in following embodiments
Method, is then conventional method unless otherwise instructed.
Embodiment 1：Obtain promoter fragment
Tobacco N metabolic key enzymes are found in ncbi databaseNIA2The ATG upstream sequences of gene, intercept the base of 1105bp
Sequence, particular sequence refer to SEQ ID NO.1, design primer, using tobacco gene group as template, are obtained by PCR amplification
Fragment, the primer sequence of amplified fragments：
Sense primer is NIA2-F：TACATACAAGGGCGCGAATAA；
Anti-sense primer is NIA2-R：AGATTATTCTAAAAAAAGAATATGAATG；
As a result：Referring to Fig. 1, connection carrier is cloned by TA after acquisition 1105bp purpose fragments, sequencing compares, with being carried in database
The sequence of confession is consistent.
Embodiment 2：PromoterSignal response element transforms the acquisition of fragment
It is possible according to the early-stage study of inventor and prediction, one section of discoverySignal response element, sequence are：
GACCCTACGGGCGTAAAAAG, the element existNIA2Position in gene promoter is -335bp~-316bp.
The element is transformed, as shown in Fig. 2, structure is deleted the promoter of the element and doubled respectively（4 times）This yuan
The promoter of part, tobacco nitrate reductaseNIA2It is promoter, possibleThe restructuring of signal response element transformation promoter carries
Body structure schematic diagram is as shown in Figure 3.
When expanding the promoter of transformation, upstream and downstream primer is identical with 1 the primer of embodiment.
As a result：After being deleted, doubling promoter purpose fragment, pass through TA clone's connection carriers, sequencing compares, with data
The base sequence of the homologous segment of sequence described in storehouse is consistent.
Embodiment 3：The structure of promoter recombinant expression carrier
（1）PCAMBIA-NPT-GUS carriers are usedEcoRⅠ/HindAfter III digestion, 35S promoter is cut, recycling large fragment is treated
With；
（2）The promoter sequence being sequenced in embodiment 1 and embodiment 2 correctly in all kinds of carrier Ts is usedEcoRⅠ/HindIII enzyme
After cutting, recycling, purify, in the pCAMBIA-NPT-GUS carriers after the purpose fragment is connected to digestion with T4 DNA ligases；
（3）Connection product is transformed into Escherichia coliE.coliIn DH5 α competence, positive recombinant is identified with colony polymerase chain reaction (PCR) method,
So thatNIA2Promoter is merged with gus gene；
（4）PCR identifications are carried out to recombinant plasmid, after confirming that sequence size is correct, extraction plasmid is spare, obtains expression gus gene
Plant recombination expression vector pCAMBIA-NPT-NIA2-P-GUS, electrophoretogram is as shown in Figure 4.
Embodiment 4：Agrobacterium-mediated Transformation Ben's tobacco
（1）By heat-shock transformed method, the various promoter plant recombination expression vector pCAMBIA-NPT- that embodiment 3 is built
PNIA2-GUS are transformed into Agrobacterium EHA105 competence, are coated onto on solid YEB culture mediums, light culture 2~3 days；
（2）Picking monoclonal bacterium, accesses in liquid YEB culture mediums, during shaking table culture to OD values about 0.4, with the absorption of 1ml syringes
20 μ l bacterium solutions are slowly injected into the Ben's tobacco leaf of growth 40 days, as shown in Figure 5.
Embodiment 5：GUS activity analysis
After when injection Ben's tobacco leaf 48 is small in example 4 to be performed, promoter activity is identified with GUS decoration methods.
Use GUS staining kits（Purchased from middle Ke Ruitai bio tech ltd）GUS activity analysis is carried out, dyeing is former
Reason is to measure plant beta-glucuronidase in sample with double antibody sandwich method（GUS）It is horizontal.
Ben's tobacco leaf after injection is immersed in GUS dyeing liquors, 1 hour is kept the temperature in 25~37 DEG C to overnight.Turn
Enter in 70% ethanol and decolourize 2~3 times, it is white to negative control material.
As a result：As shown in fig. 6, micro- Microscopic observation, the blue dot in white background is GUS expression sites.TobaccoNIA2Promoter, delete and double element promoter and can induceGUSThe expression of gene.
Embodiment 6：GUS enzyme linked immunoassay quantitative analyses
With plant GUS enzyme-linked immunoassay kits（Purchased from Shanghai Nuo Yuan bio tech ltd）Carry out GUS enzyme linked immunologicals
Response assays.
Detailed step is as follows：
（1）According to specification dilution standard product, 5ng/ml, 10ng/ml, 20ng/ml, 40ng/ml and 80ng/ml are respectively obtained
Standard items；
（2）Standard items are accurately loaded 50 μ l on the coating plate of enzyme mark hole, first add 40 μ l of sample diluting liquid in sample to be tested hole, then
Again plus 10 μ l of sample to be tested（The final dilution factor of sample is 5 times）, incubated 30 minutes for 37 DEG C with film sealing plate postposition；
（3）After striping, liquid is discarded, is dried, cleaning solution is filled it up with per hole, is discarded after standing 30 seconds, is so repeated 5 times, pats dry；
（4）50 μ l of enzyme marking reagent are added per hole, 37 DEG C incubate 30 minutes, discard liquid, wash 5 times；
（5）50 μ l of color developing agent A are first added per hole, add 50 μ l of color developing agent B, gently concussion mixes, 37 DEG C of lucifuge colour developings 15
Minute；
（6）Add 50 μ l of terminate liquid per hole, terminate reaction（Blueness is vertical at this time turns yellow）；
（7）Returned to zero with blank well, 450nm wavelength sequentially measures the absorbance in each hole（OD values）.
As a result：As shown in fig. 7, tobaccoNIA2Promoter can induceGUSThe expression quantity of gene is 71ng/mg, deletes cigarette
GrassNIA2Promoter can induceGUSThe expression quantity of gene is 65ng/mg, is doubledNIA2Promoter can induceGUSGene
Expression quantity is 79ng/mg, the promoter highest of the expression activity of GUS to double.
The present invention is described in detail above in conjunction with drawings and examples, still, those of skill in the art
Member can also carry out each design parameter in above-described embodiment it is understood that on the premise of present inventive concept is not departed from
Change, forms multiple specific embodiments, is the common excursion of the present invention, is no longer described in detail one by one herein.
SEQUENCE LISTING
<110>Agricultural University Of He'nan
<120>Tobacco nitrate reductase NIA2 promoters, its expression vector and its application
<130> 2017
<160> 3
<170> PatentIn version 3.2
<210> 1
<211> 1105
<212> DNA
<213> Nicotiana benthamiana
<400> 1
tacatacaag ggcgcgaata aacttttttt aaagtaaatg tatatgaact tgcaatgaaa 60
gaggacctta acttgtttgt ctttgttgct ttctgcaaat ttcaccttaa cagcccattt 120
gagattgatt tagttagtta taacaattag ttaaatgctt gtgtaatttg aagaaaatat 180
ttggacgtgc tcgctgaaaa cattatactc ctatataata gaaatacttt ctgaaaagtt 240
ggtcttgttc aaaaacgtat aagagagttg gtcttctcat aaatagtcac tagctttctg 300
attttttttc actttctata tcacgtaaat aggtactcaa atttgatatt tacaccaaac 360
aaatgaaaat aggatatgtg tttttcatac gtatatttat ctatcgtact taatgataca 420
tacatataca tataacctta ctttttgatt actaaaaatt taattatatt taatttgggt 480
aaatatcaga tgccacaaaa catttaccta gccactgttt ttgactacta aaaatttaat 540
tatgtttagc ttgggtaaat atcagatgtc actaaacatt ttacctagcc attcctccga 600
aaagaaattg agaaggaaat tagagttagt ggagccataa taatgtttaa tgtgaccata 660
actcggtgaa aaccacggca agaataagaa acagctgtta aggctaacca acagctgcat 720
atctttaagc catttgctat taccccaaca tcgcatcttc ctctgatccc gaccctacgg 780
gcgtaaaaag tgtaaatcgt tagaattgtt ttatttattt tatgatgtca ctatttttta 840
aaatcaaaat taaattgggg tgtcgatttt tttgggtcct gcttatgtat agtatggcgc 900
tatggaggca ctgagagagt ccgaaacgtt tctatataag gccaccccac gcattcacaa 960
acttcgttcc caaacagaac aagaaaatca aatctcggag agagagagag agagaaatat 1020
tttgagagag aaatacagaa aatctctctt ccttctttcc tttttttttt caatccccat 1080
tcatattctt tttttagaat aatct 1105
<210> 2
<211> 21
<212> DNA
<213>It is artificial synthesized
<400> 2
tacatacaag ggcgcgaata a 21
<210> 3
<211> 28
<212> DNA
<213>It is artificial synthesized
<400> 3
agattattct aaaaaaagaa tatgaatg 28
Claims (9)
1. one grows tobacco nitrate reductaseNIA2Promoter, it is characterised in that its nucleotides sequence is classified as：
（1）Nucleotide sequence as shown in SEQ ID NO.1；Or
（2）On the basis of the core promoter sequence for retaining the nucleotide sequence as shown in SEQ ID NO.1, through removing or doubling
Regulation and controlNIA2Expression, withThe highly similar key element of signal response element sequence；Or
（3）There is equal nucleotide sequence as derived from the nucleotide sequence shown in SEQ ID NO.2.
2. tobacco nitrate reductase according to claim 1NIA1Promoter, it is characterised in that the multiple that doubles is
2~5.
3. a kind of carrier for expression of eukaryon for Genetic Transformation in Higher Plants, it is characterised in that the carrier has described in claim 1
Tobacco nitrate reductaseNIA2Promoter sequence.
4. a kind of engineering bacteria for Genetic Transformation in Higher Plants, it is characterised in that the engineering bacteria has the tobacco described in claim 1
Nitrate reductaseNIA2Promoter sequence.
5. tobacco nitrate reductase described in claim 1NIA2Application of the promoter in destination gene expression is started.
6. application according to claim 5, it is characterised in that the target gene isGUSGene.
7. tobacco nitrate reductase described in claim 1NIA2Promoter startsGUSThe method of gene expression, it is characterised in that
Comprise the following steps：
（1）By tobacco nitrate reductase described in claim 1NIA2Promoter insertion containsGUSThe expression vector of gene, to replace
Existing promoter, obtains recombinant plasmid in the expression vector；
（2）Gained recombinant plasmid is imported to set out and plant and is cultivated, in the plant that sets out by the tobacco nitric acid also
ProtoenzymeNIA2Promoter starts in the recombinant plasmidGUSGene expression；
（3）GUS dyeing, and quantitative analysis are carried out to the blade for cultivating plant.
8. the method according to the description of claim 7 is characterized in that the plant that sets out is dicotyledon.
9. according to the method described in claim 8, it is characterized in that, the dicotyledon is Ben's tobacco.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711395854.4A CN108004241B (en) | 2017-12-21 | 2017-12-21 | Tobacco nitrate reductaseNIA2Promoter, expression vector and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711395854.4A CN108004241B (en) | 2017-12-21 | 2017-12-21 | Tobacco nitrate reductaseNIA2Promoter, expression vector and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108004241A true CN108004241A (en) | 2018-05-08 |
| CN108004241B CN108004241B (en) | 2021-07-09 |
Family
ID=62060500
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201711395854.4A Active CN108004241B (en) | 2017-12-21 | 2017-12-21 | Tobacco nitrate reductaseNIA2Promoter, expression vector and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108004241B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116583176A (en) * | 2020-12-09 | 2023-08-11 | 日本烟草产业株式会社 | Tobacco plant and tobacco product |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US7148400B1 (en) * | 1999-04-20 | 2006-12-12 | Bayer Bioscience N.V. | Methods and means for delivering inhibitory RNA to plants and applications thereof |
| CN106222172A (en) * | 2016-08-11 | 2016-12-14 | 河南农业大学 | One grows tobacco GCN2 promoter and application thereof |
| CN106497928A (en) * | 2016-09-26 | 2017-03-15 | 河南农业大学 | Nicotiana tabacum L. GCN2 promoteres, its expression vector and its application |
-
2017
- 2017-12-21 CN CN201711395854.4A patent/CN108004241B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US7148400B1 (en) * | 1999-04-20 | 2006-12-12 | Bayer Bioscience N.V. | Methods and means for delivering inhibitory RNA to plants and applications thereof |
| CN106222172A (en) * | 2016-08-11 | 2016-12-14 | 河南农业大学 | One grows tobacco GCN2 promoter and application thereof |
| CN106497928A (en) * | 2016-09-26 | 2017-03-15 | 河南农业大学 | Nicotiana tabacum L. GCN2 promoteres, its expression vector and its application |
Non-Patent Citations (3)
| Title |
|---|
| KONISHI，M. 等: "The Regulatory Region Controlling the Nitrate-Responsive Expression of a Nitrate Reductase Gene, NIA1, in Arabidopsis", 《PLANT CELL PHYSIOL.》 * |
| VAUCHERET,H.,等: "GenBank: X14059.1", 《GENBANK》 * |
| 周炎 等: "烟草硝酸还原酶基因NIA1 启动子互作蛋白的筛选", 《中国烟草学报》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116583176A (en) * | 2020-12-09 | 2023-08-11 | 日本烟草产业株式会社 | Tobacco plant and tobacco product |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108004241B (en) | 2021-07-09 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CA2833052C (en) | Transcription terminator sequences | |
| US7279617B2 (en) | Promoter, promoter control elements, and combinations, and uses thereof | |
| Han et al. | Characterization of a small constitutive promoter from Arabidopsis translationally controlled tumor protein (AtTCTP) gene for plant transformation | |
| US9777285B2 (en) | Promoter, promoter control elements, and combinations, and uses thereof | |
| US20180119161A1 (en) | Synthetic promoter and methods of use thereof | |
| CN103403022A (en) | Plant gene expression modulatory sequences from maize | |
| CN108004241A (en) | Tobacco nitrate reductase NIA2 promoters, its expression vector and its application | |
| XU et al. | OsPIN1a gene participates in regulating negative phototropism of rice roots | |
| CN101302530A (en) | Gateway cloning entry vector, construction method and use thereof | |
| Perani et al. | Gene transfer methods for crop improvement: Introduction of foreign DNA into plants. | |
| CN108004242A (en) | Tobacco nitrate reductase NIA1 promoters, its expression vector and its application | |
| Cheng et al. | Identification of a 193 bp promoter region of TaNRX1-D gene from common wheat that contributes to osmotic or ABA stress inducibility in transgenic Arabidopsis | |
| CN105018520B (en) | The plant expression vector and application thereof of 4 pairs of cotton DELLA protein gene GhGAIs expression of regulation and control | |
| CN113234732B (en) | Lycoris longituba LlbHLH19 gene and expressed protein and application thereof | |
| CN110734917B (en) | Lycoris longituba LlDFRc gene, protein expressed by same and application of gene | |
| CN110747179B (en) | Lycoris longituba LlDFRb gene and protein expressed by same and application of gene | |
| Croissant-Sych et al. | Identification of positive and negative regulatory cis-elements of the rice glutelin Gt3 promoter | |
| US20020157135A1 (en) | Polynucleotide and method for selectively expressing a protein in a target cell or tissue of a plant | |
| CN110760530B (en) | Lycoris longituba LlDFRa gene, protein expressed by same and application of gene | |
| Masood et al. | Cloning and expression analysis of dhordein hybrid promoter isolated from barley (Hordeum vulgare L.) | |
| CN110484548B (en) | Method for constructing expression vector by one-step Gateway reaction and application | |
| CN116478998B (en) | Rice phloem specific expression promoter POs04g0452500 and application thereof | |
| Wang et al. | A novel bi-directional promoter cloned from melon and its activity in cucumber and tobacco | |
| Ito et al. | Interspecies compatibility of NAS1 gene promoters | |
| AU2011202966B2 (en) | Expression enhancing intron sequences |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |