CN108003241B - Active UL36-480-GST protein, and preparation method and application thereof - Google Patents

Abstract

The invention provides an active UL36-480-GST protein and a preparation method thereof, which takes UL36-480 deubiquitinase encoded by MDV virus as a target spot, fuses a GST label promoting protein dissolution and facilitating purification, a Thrombin protease digestion site and a Gly-Gly-Gly-Ser flexible connecting peptide segment at the C end, and utilizes a baculovirus-insect cell expression system to express and purify to obtain UL 36-480-GST. A method for screening specific inhibitors in vitro for antitumor and antiviral treatments using the enzyme; establishes a new preparation method for obtaining the active virus coding deubiquitinating enzyme UL36-480-GST, and provides a new specific drug target for effectively preventing and controlling MDV virus.

Description

Active UL36-480-GST protein, and preparation method and application thereof

Technical Field

The invention provides an active UL36-480-GST protein and a preparation method thereof, which is a protein capable of being used as an antiviral drug target. Also discloses a preparation method of the protein, and uses a plurality of compounds to perform activity inhibition on the protein, belonging to the technical field of biological engineering.

Background

Many animal cell-encoded deubiquitinases, including virally-encoded proteins with deubiquitinase activity, play an important role in the infection of host cells by viruses and in the pathogenic processes of viruses. Therefore, the proteins with deubiquitinating enzyme activity can be used as targets for screening antitumor and antiviral drugs. The immune system of the host is regulated and controlled by regulating the ubiquitination modification system of the host cell, thereby playing the role of resisting tumor and virus.

The UL36-480 protein is a protein encoded by MDV virus and having deubiquitinase activity. The destruction of the deubiquitinating enzyme activity can inhibit the replication, packaging and transmission of MDV in chicken cells, thereby preventing the chicken MD tumor disease caused by MDV.

The invention content is as follows:

the invention provides a gene sequence of deubiquitinase fusion protein UL 36-480-GST.

The invention further provides a method for acquiring the UL36-480-GST protein gene.

The invention further provides an expression method of the protein, and the UL36-480 is fused with the GST tag to prepare a soluble UL36-480-GST protein with deubiquitinating enzyme activity, which can be used as a target spot for screening antitumor and antiviral drugs.

The invention provides an active UL36-480-GST protein, the gene sequence of which is shown as follows: SEQ No. 1.

The method for acquiring the UL36-480-GST gene comprises the following steps:

1) optimizing UL36-480 gene, connecting with GST label gene through protease Trombin recognition sequence and linker sequence to obtain UL36-480-GST gene;

UL36-480 related primers:

P1：5’- ATACGCGTCGACATGACTGACAGCACTGAC -3’；

P2：5’- ATTCCCAAGCTTGCTCTGGGGGGTCCAGAG -3’；

GST tag related primers:

P3：5’- ATTCCCAAGCTTCTGGTTCCGCGTGGATCCATG -3’；

P4：5’- AGTGCACTGCAGCTGGTTCCGCGTGGATCCATG -3’；

2) taking the optimized UL36-480 gene sequence as a template, combining an upstream primer P1 and a downstream primer P2, and carrying out PCR amplification to obtain a UL36-480 gene with a specified enzyme cutting site;

3) combining an upstream primer P3 and a downstream primer P4, and carrying out PCR amplification to obtain a GST tag gene with a specified enzyme cutting site;

4) applications ofHindIII enzyme cutting site connects UL36-480 gene sequence and GST tag gene sequence to UL36-480-GST gene sequence.

The invention relates to a preparation method of UL36-480-GST protein, which comprises the following steps:

1) constructing insect cell expression plasmid;

the UL36-480-GST gene was ligated with pFast-Bac-Dual vector, and the ligation product was transformed intoE.coliIn TOP 10 competence, amplifying and extracting recombinant plasmid to obtain pFast-Bac-Dual-UL36-480-GST plasmid;

2) constructing recombinant Bacmid;

transforming pFast-Bac-Dual-UL36-480-GST plasmid into DH10Bac competent cells, and amplifying and extracting recombinant plasmid to obtain recombinant Bacmid;

3) UL36-480-GST expression;

transfecting the recombinant Bacmid obtained in the step 2) into sf9 cells for protein expression;

4) purification of UL 36-480-GST;

collecting insect cells expressing the protein, carrying out affinity chromatography under a low-temperature environment to obtain the protein, dialyzing, packaging and freezing to obtain the product.

The UL36-480-GST fusion protein is used for screening antiviral and antitumor drugs.

The invention has the positive effects that: an active UL36-480-GST protein is prepared, and support is provided for UL36-480 serving as an anti-tumor and anti-virus target.

Drawings

FIG. 1 is an electrophoretogram demonstrating that UL36-480-GST has deubiquitinase activity in accordance with the present invention;

in the figure, UL36-480-GST can cut Di-Ub of the 7 different connection modes, and the UL36-480-GST is shown to have activity on Di-Ub connected in different modes;

FIG. 2 is an electrophoretogram demonstrating the effect of inhibitors on UL36-480-GST activity in accordance with the present invention;

in the figure, inhibitors ML-323 and P5091 both have inhibitory effect on UL36-480-GST activity.

Detailed Description

The invention is further illustrated by the following examples, which are not intended to be limiting in any way. The following examples further illustrate the essence of the present invention, but the present invention is not limited thereto.

Example 1

The UL36-480 gene is obtained by the following specific process:

1) obtaining an optimized UL36-480 gene sequence;

2) designing a primer:

using optimized UL36-480 as template, designing primer, and adding enzyme cutting site(s) to upstream and downstream primersSal I、HindIII) constructing an insect cell expression vector.

The primers used were:

an upstream primer:

5’- ATACGCgtcgacATGACTGACAGCACTGAC -3’；

a downstream primer:

5’- ATTCCCaagcttGCTCTGGGGGGTCCAGAG -3’；

3) obtaining a UL36-480 gene sequence by a PCR method:

using the optimized UL36-480 gene as a template, and applying the two primers to amplify to obtain a UL36-480 gene sequence;

and (3) PCR reaction conditions:

1、95℃ 3 min

2、94℃ 30s；58℃ 45s；72℃ 1 min30s；30 cycles

3、72℃ 10min

4、4℃ store

4) applications ofHindIII enzyme cutting site connects UL36-480 gene sequence and GST tag gene sequence to UL36-480-GST gene sequence.

Example 2

GST tag Gene amplification

The specific implementation process is as follows:

1) primer design

Using PGEX-4t-3 gene as template, designing primer, and adding enzyme cutting site(s) to upstream and downstream primersHind III、PstI) The method is used for constructing the insect cell expression vector.

The primers used were:

an upstream primer:

5’- attcccAAGCTTctggttccgcgtggatccatg -3’

a downstream primer:

5’- AGTGCActgcagCTGGTTCCGCGTGGATCCATG -3’

2) PCR method for obtaining GST tag gene sequence

And (3) amplifying by using the two primers by using the PGEX-4t-3 gene as a template to obtain a GST tag gene sequence.

And (3) PCR reaction conditions:

1、95℃ 3 min

2、94℃ 30s；56℃ 45s；72℃ 45s；30 cycles

3、72℃ 10min

4、4℃ store。

example 3

Insect cell expression plasmid construction, recombinant Bacmid construction, protein eukaryotic expression, purification and other detailed methods.

1) And (3) constructing an insect cell expression plasmid.

1.1) recovering and purifying PCR amplification products of UL36-480 gene and PCR amplification products of GST tag gene.

1.2) the PCR products of UL36-480 and GST are connected to a PMD18T vector for sequencing after being recovered by glue, and the two segments of gene fragments and the pFast-Bac-Dual vector are subjected to double enzyme digestion after the sequencing is completely correct. The restriction enzyme sites are respectively: pFast-Bac-Dual:Sali andPst I；UL36-480：Sal i andHind III；GST：HindIII withPst I；

1.3) carrying out agarose gel electrophoresis on all products of the 3 double enzyme digestion reactions, and recovering gel blocks of target bands according to the sizes of target fragments. Using T4 ligase to connect the UL36-480-GST fragment into a pFast-Bac-Dual vector, namely an insect cell expression vector;

1.4) transformation of the recombinant plasmid pFast-Bac-Dual-UL36-480-GST intoE.coliIn TOP 10 competence, the recombinant plasmid is amplified and identified, and the identification result is correct;

2) recombinant Bacmid construction

2.1) transforming pFast-Bac-Dual-UL36-480-GST plasmid into DH10Bac competent cells, and amplifying and extracting recombinant plasmid to obtain recombinant Bacmid;

2.2) after the recombinant Bacmid is extracted, carrying out PCR identification on whether the recombinant Bacmid is polluted by an empty carrier;

3) after PCR identification, the recombinant Bacmid is determined to contain the UL36 gene, and can be transfected into sf9 cells for recombinant protein expression;

4) this generation of transfected virus became P0 generation virus, and virus passage was carried out 7 days after successful virus transfection. After 3 days of culture, the virus becomes P1 generation virus;

5) infecting a large number of insect cells with the P1 virus, culturing for 3 days, and collecting the cells;

6) the cells were blown up using pre-cooled PBS and the residual medium was washed. Discarding the supernatant; 30 mL Binding Buffer (50 mM Tris-H) was usedCl, 0.2M NaCl, 10% glycerol, pH 8.0) resuspend the cells and sonicate the cells under ice bath conditions. Centrifuging the ultrasonically crushed cells at 4 deg.C, 12000gCentrifuging for 1 h;

7) 1 mL of Glutathione-Sepharose beads were pipetted into a purification column, and the column was washed with ten column volumes of ultrapure water to remove ethanol. In addition, Binding buffers with ten times column volume are used for balancing the Beads;

8) the turbid bacteria liquid after centrifugation is divided into two parts, namely supernatant and sediment. Most of the protein was solubilized in the supernatant, while cell debris and a few insoluble proteins were aggregated in the pellet. Filtering the supernatant with a 0.45 μm filter membrane;

9) adding the balanced Beads into the filtered supernatant, sealing the pipe orifice, placing the pipe orifice into a test tube mixer, and combining the target protein with the Beads for 1 h in an environment at 4 ℃. Adding the mixture into a purification column, and reserving the sample in the sample loading effluent; after all the columns are loaded, washing the Beads by using 300 mL Binding Buffer at the flow rate of about 1 mL/min;

10) finally, eluting the target protein from Glutathione-Sepharose Beads by using 5 mL of 33 mM reduced Glutathione, and collecting eluent;

11) and (5) dialyzing and storing. And (3) dialysis: the dialysis solution (137 mM NaCl, 2.7mM KCl, 10mM Na) was replaced three times an hour each time₂HPO₄，2mM KH₂P0₄10% glycerol; (PH = 8.0)); after the sub-packaging of the dialyzed sample is finished, the sample is quickly placed in liquid nitrogen and frozen for 5 minutes. Storing in a refrigerator at-80 deg.C for use;

12) and (3) carrying out SDS-PAGE on protein samples in all steps in the protein purification process, and identifying the purification result.

Test example 1

The specific process of functional verification of the UL36-480-GST protein is as follows:

1) enzyme-specific assay for UL36-480-GST

Ub molecules ubiquitinate the protein of interest by forming isopeptide bonds with lysine residues of the protein of interest, whereas Ub molecules themselves contain 7 lysine residues and can ubiquitinate themselves in 7 different ways of attachment. The invention identifies the deubiquitinase activity of UL36-480-GST on double ubiquitin chains (Di-Ub) of 7 different connection modes (K6, K11, K27, K29, K33, K48 and K63). As shown in FIG. 1, UL36-480-GST can cleave these 7 different Di-Ub linkages, indicating that UL36-480-GST is active against different Di-Ub linkages;

2) effect of inhibitors on UL36-480-GST Activity

Using Ub-PLA₂As substrates, UL36-480-GST was acted upon with inhibitor ML-323 of USP1-UAF1 deubiquitinase and inhibitor P5091 of USP7 deubiquitinase. As shown in FIG. 2, both ML-323 and MLN9708 inhibit the deubiquitinating enzyme activity of UL 36-480-GST;

3) use of UL36 for resistance to MDV.

Numerous studies have shown that inhibition or disruption of UL36-480 activity results in inhibition or reduction of MDV replication, infection, and transmission. Therefore, the inhibitor capable of inhibiting the activity of UL36-480 has an anti-MDV effect, and can be used for treating and preventing MD caused by MDV infection.

The detailed description set forth is merely a detailed description of possible embodiments of the invention and is not intended to limit the scope of the invention, which is intended to include all equivalent embodiments or modifications within the scope of the invention without departing from the spirit thereof.

Sequence listing

<110> Jilin university

<120> active UL36-480-GST protein, preparation method and application

<160> 1

<170> SIPOSequenceListing 1.0

<210> 1

<211> 2133

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

atgactgaca gcactgacag ccgtcaggcc actaccaact gccgcaagta tagccgcacc 60

actagcaacg ctcccatgct ggccgctaat gtgctgcgtg acaagagcac tagcggtctg 120

tgctccctgg accgtaagca cgacccttac ttcggccaga tcatggacaa ccccgaggtc 180

atcctggatg agtgggccaa gatggtcatc gacaccaccg acgtgaccgt cgtggctgtg 240

ggtatccgta atcagttcgc tcccgacctg tcccctgctt cctccgtgtc ctgcctgcgt 300

tcctccctcg ctttcctccg catcgtgttc gcctatggcc tggacactgt catcagcagc 360

gatgctatcg accgcctgct gctgcagggc aaggcttgga ccatcgctac ctccgaggac 420

ggcacctaca ccacttgcgt cccccacgac ctgcccaacc gcatcatcag caaggacgct 480

ggcggcaacc tgtgtgtcgc cttcagctcc agctacggcg agttcgagtt ctacctggag 540

gagaacactc ccaccatcct cgacacccag atcagcgccc gcaccttcat cgagcagatc 600

tggaagaaga agcgcggcga cgtctactgc ctcatcgtcg tcggcgtgct gggtattggt 660

gtgtatcgca gcggcgacgg tatctacatc ttcgaccctc acggccacgg ccacatcggc 720

caggcttgta tcgtgcgtgt gagcgagggc tacttctacc agtacctcac cagctacgcc 780

gacccttccg ctacccctga ttggagcgct accttcgtgt acttcgtgag caccgtctcc 840

atctgccctc ctcgcgacga gatcatcagc accgtgagcc gcatttacgg caccagcgac 900

attgtgctgg acctgggccg cgcccgtgag gaagataacc gcaaggtggt gtccgctgac 960

ttcgaccccc ctagccgtcc ccaacctcgt ctgaccaaac tcgtgatcgg ttccaccgac 1020

accactatcc agggtagcga ttacccctgt atccaggctg aggacctgaa cggcgaagac 1080

tcccgccctc tggaccacaa cctcagctac aacgacgctc ccaccaacac cgagagcgtg 1140

gctccccctt ccaccaagga ctgccgcgac tgcattaaca tccaaaaccc cggcgagacc 1200

ctcgacgaca ctcactccac catcgtggac cccagcacta aagactccat ctccgtgacc 1260

gcctggcagg gtgtgttcag cgacgtcatc gaggaccctc cccctaagac caacttccag 1320

ttcagcttcg gcactttcgc caaggtggcc gagaacaaga tcggtactac cagcgtggag 1380

ggttgcattc gcaactacgc ccgccacaaa cgccgccgtc ctctctggac cccccagagc 1440

aagcttctgg ttccgcgtgg atccatgtcc cctatactag gttattggaa aattaagggc 1500

cttgtgcaac ccactcgact tcttttggaa tatcttgaag aaaaatatga agagcatttg 1560

tatgagcgcg atgaaggtga taaatggcga aacaaaaagt ttgaattggg tttggagttt 1620

cccaatcttc cttattatat tgatggtgat gttaaattaa cacagtctat ggccatcata 1680

cgttatatag ctgacaagca caacatgttg ggtggttgtc caaaagagcg tgcagagatt 1740

tcaatgcttg aaggagcggt tttggatatt agatacggtg tttcgagaat tgcatatagt 1800

aaagactttg aaactctcaa agttgatttt cttagcaagc tacctgaaat gctgaaaatg 1860

ttcgaagatc gtttatgtca taaaacatat ttaaatggtg atcatgtaac ccatcctgac 1920

ttcatgttgt atgacgctct tgatgttgtt ttatacatgg acccaatgtg cctggatgcg 1980

ttcccaaaat tagtttgttt taaaaaacgt attgaagcta tcccacaaat tgataagtac 2040

ttgaaatcca gcaagtatat agcatggcct ttgcagggct ggcaagccac gtttggtggt 2100

ggcgaccatc ctccaaaatc ggattgactc gag 2133

Claims (1)

1. The application of the active UL36-480-GST fusion protein in screening antiviral and antitumor drugs is characterized in that the gene sequence is as follows: SEQ No. 1;

the preparation method of the UL36-480-GST protein comprises the following steps:

1) constructing insect cell expression plasmid;

the UL36-480-GST gene was ligated with pFast-Bac-Dual vector, and the ligation product was transformed intoE.coliIn TOP 10 competence, the recombinant plasmid is amplified and extracted to obtain pFast-Bac-Dual-UL36-480-GST plasmid;

2) constructing recombinant Bacmid;

transforming pFast-Bac-Dual-UL36-480-GST plasmid into DH10Bac competent cells, and amplifying and extracting recombinant plasmid to obtain recombinant Bacmid;

3) UL36-480-GST expression;

transfecting the recombinant Bacmid obtained in the step 2) into sf9 cells for protein expression;

4) purification of UL 36-480-GST;

collecting insect cells expressing the protein, carrying out affinity chromatography under a low-temperature environment to obtain the protein, dialyzing, packaging and freezing to obtain the product.

Images