CN107988355A - For detecting and the relevant type II diabetes tumor susceptibility gene kit of organophosphorus pesticide - Google Patents
For detecting and the relevant type II diabetes tumor susceptibility gene kit of organophosphorus pesticide Download PDFInfo
- Publication number
- CN107988355A CN107988355A CN201711385021.XA CN201711385021A CN107988355A CN 107988355 A CN107988355 A CN 107988355A CN 201711385021 A CN201711385021 A CN 201711385021A CN 107988355 A CN107988355 A CN 107988355A
- Authority
- CN
- China
- Prior art keywords
- type
- organophosphorus pesticide
- tumor susceptibility
- diabetes
- susceptibility gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Genetics & Genomics (AREA)
- Analytical Chemistry (AREA)
- Biophysics (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Immunology (AREA)
- Biotechnology (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Pathology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to gene engineering technology field, disclose one kind and be used for detection and the relevant type II diabetes tumor susceptibility gene kit of organophosphorus pesticide, formed by PCR amplification primer and for the specific oligonucleotide probe of the relevant caused type II diabetes tumor susceptibility gene of detection and organophosphorus pesticide；Extract sample DNA；Target gene, the amplimer of target gene, probe are mixed according to definite ratio；Real-time fluorescence detection is carried out by fluorescence quantitative PCR instrument；Sample to be tested genotype interpretation.The kit of the present invention is easy to operate; save time, consumptive material and sample; it is high sensitivity, economy, safe and pollution-free; suitable for complete genome DNA samples such as detection human whole blood, tissues; and only need 10ng 20ng genomic DNAs, 2 it is interior when small can complete entirely to test, last detection process only needs 20 30 minutes; with good application market and economic benefit, easy scale application.
Description
Technical field
The invention belongs to gene engineering technology field, more particularly to one kind to be used to detect and relevant II type of organophosphorus pesticide
Diabetes-susceptible kit gene.
Background technology
Diabetes are a kind of metabolic diseases characterized by hyperglycaemia, and most common one kind is type II diabetes
(type 2diabetes mellitus, T2DM), constitutes about 90% or so of diabetes sum.T2DM is a kind of great heterogeneous
Property metabolic disease, the cause of disease and pathogenesis are complicated.It is now recognized that it is by Other Risk Factors such as heredity, environment, behaviors
Multi-factor disease caused by common participation and interaction.In recent years, with the completion of the Human Genome Project, high throughput monokaryon
The foundation of nucleotide polymorphism (single nucleotide polymorphism, SNP) detection biochip and full-length genome
The development of association study (Genome-Wide Association Study, GWAS), a series of T2DM correlations tumor susceptibility genes are sent out
It is existing, and cause the concern of people.At least 40 and the relevant tumor susceptibility genes of T2DM have been filtered out at present, have mainly been included：
TCF7L2, PPARG, KCNJ11, CDKAL1, OCT1, CDKN2A/B, SLC30A8, IGF2BP2 and FTO etc..Tumor susceptibility gene for
It was found that the undiscovered biological pathways that may change β cell functions, insulin activity or other metabolic activities before some
There is good suggesting effect.Organophosphor is widely used as a kind of efficient, wide spectrum insecticide, largely improves
The yield of crops.But organophosphorus pesticide has stronger toxicity, therefrom caused by agricultural product organophosphorus pesticide residual quantity
Also it is increasing, cause peasant to cause the accumulation of organophosphor after contacting, eating, the harm to health also increases.
Some researches show that long-term micro contact organophosphorus pesticide can cause to damage to body, can cause multiple organ, the chronic damage of multisystem
Wound even threat to life.It is micro for a long time to contact organophosphorus pesticide to the toxicity of mammal in addition to suppressing cholinesterase activity,
Mammal glycometabolism can be also disturbed by all means, induces experimental animal hyperglycemia, and there is potential cause diabetes effect
Should.Generally using PCR-RFLP, (restriction fragment length polymorphism polymerase chain was anti-in the past for diabetes-susceptible gene tester
Should), PCR-SBT (polymerase chain reaction direct sequencing) and PCR-SSP (PCR of sequence specific primers guiding reacts) etc..But
The shortcomings that being long generally existing operating time, complex steps, it is impossible to meet the requirement that modern medicine detects in real time；Need height
Specific primer, otherwise easily there is false positive or false negative in the amplification condition of optimization, causes result equivocal or judges by accident；
Special construction DNA sequence dna is difficult to be sequenced, is easy to cause missing inspection.Therefore, how quickly, accurately detect related with organophosphorus pesticide
Type II diabetes tumor susceptibility gene be one of main bugbear of diabetes clinical diagnosis.
For traditional tumor susceptibility gene detection method shortcoming, the quantitative PCR technique based on Taqman probes is in regular-PCR
Fluorophor is added in reaction system, it is only completely matched respectively with two kinds of fluorochrome labels according to allelic product
Probe can just amplify corresponding genotype, therefore high specificity.It can just be completed in a PCR reacts to single
The genotype of SNP site judges, therefore easy to operate, time-consuming short, high sensitivity.Therefore should by Taqman probes and quantitative PCR method
Detected for type II diabetes tumor susceptibility gene relevant with organophosphor, be conducive to the molecule diagnosis of diabetes.
The content of the invention
In view of the problems of the existing technology, it is used to detect and relevant II type of organophosphorus pesticide the present invention provides one kind
Diabetes-susceptible kit gene.
The present invention is achieved in that a kind of for detecting type II diabetes tumor susceptibility gene examination relevant with organophosphorus pesticide
Agent box, it is described to be used to detect with the relevant type II diabetes tumor susceptibility gene kit of organophosphorus pesticide by PCR amplification primer and use
Formed in detection and the specific oligonucleotide probe of organophosphorus pesticide type II diabetes tumor susceptibility gene caused by relevant；
The nucleotides sequence of the specific oligonucleotide probe is classified as SEQ ID NO：1~SEQ ID NO：14；
The PCR amplification primer, sequence are SEQ ID NO：15~SEQ ID NO：28.
Further, described 7 tumor susceptibility genes of type II diabetes are：MTHFR, CAPN10, LEP, IL1A, ApoE, CTLA4 and
APOB genes.
Further, it is described to further include 2 with the relevant type II diabetes tumor susceptibility gene kit of organophosphorus pesticide for detecting
The water of × TaqManMasterMix and PCR grades；
Further, the fluorophor that the specific oligonucleotide probe 5 ' is held, wild-type probe VIC, saltant type are visited
Pin is FAM, and the quenching group at 3 ' ends is NFQ.
Another object of the present invention is to provide to be used to detect and the relevant type II diabetes of organophosphorus pesticide described in one kind
The detection method of tumor susceptibility gene kit, it is described to be used to detect and the relevant type II diabetes tumor susceptibility gene reagent of organophosphorus pesticide
The detection method of box comprises the following steps：
Step 1, extracts sample DNA；
Step 2, target gene, the amplimer of target gene, probe are mixed according to definite ratio；
Step 3, real-time fluorescence detection is carried out by fluorescence quantitative PCR instrument；
Step 4, sample to be tested genotype interpretation.
Further, amplification system is：2 × TaqMan MasterMix, 10.0 μ L, 2 μ L of genomic DNA template (10~
50ng/ μ L), each 0.9 μ L of 10pmol/ μ L upstream and downstream primers, 10pmol/ μ L wild types and each 0.5 μ L of saltant type probe, supplement
The water of PCR grades is to 20 μ L of final volume.
Further, amplification program is：95 DEG C of 10min, (92 DEG C of 15s, 60 DEG C of 1min) × 60 circulations, 72 DEG C of 10min；
Data scanning is carried out using ABI companies 7900HT types fluorescence quantitative PCR instrument after the completion of PCR, testing result uses corresponding software
Applied Biosystems AutoCallerTMSoftware carries out genotype interpretation.
Advantages of the present invention and good effect are：1. high sensitivity, high throughput, low cost.The kit of the present invention uses
Taqman- real-time quantitative fluorescence PCRs method detects the type II diabetes tumor susceptibility gene related with organophosphorus pesticide, suitable for inspection
The complete genome DNA samples such as human whole blood, tissue are surveyed, and only need 10ng-20ng genomic DNAs, compared to traditional PCR-SSP skills
50-100ng genomic DNAs needed for art, sensitivity higher；The detection of at least 96 samples can be once carried out at the same time, it is average every
A reaction tube is of low cost.It is 2. easy to operate, time-consuming short.PCR reaction just completes two contents of amplification and sequencing, 2-3h
It is interior to complete real-time quantitative PCR experiment.3. easy scale application.Designed specific probe is directed to DNA point mutation, as a result
Accuracy is high, has good application market and economic benefit.It is 4. safe and pollution-free.Reaction process without secondary addition reagent,
The possibility of secondary pollution is avoided, all reaction reagents are safe and nontoxic.
Brief description of the drawings
Fig. 1 is provided in an embodiment of the present invention for detecting type II diabetes tumor susceptibility gene examination relevant with organophosphorus pesticide
The detection method flow chart of agent box.
Fig. 2 is Taqman probe in detecting principle schematic provided in an embodiment of the present invention.
Fig. 3 is the related 7 tumor susceptibility gene detection sites of type ii diabetes of organophosphorus pesticide provided in an embodiment of the present invention
Cluster result schematic diagram.
Embodiment
In order to make the purpose , technical scheme and advantage of the present invention be clearer, with reference to embodiments, to the present invention
It is further elaborated.It should be appreciated that the specific embodiments described herein are merely illustrative of the present invention, it is not used to
Limit the present invention.
Have not yet to see related document and disclose type II diabetes tumor susceptibility gene detection suitably relevant with organophosphorus pesticide
Kit.How quickly and accurately to detect with the relevant type II diabetes susceptibility gene mutation of organophosphorus pesticide is that diabetes are faced
Bed diagnosis problem to be solved.Taqman- real-time quantitative PCR methods are in DNA amplification reaction, add fluorophor and are quenched
Group, when probe is complete, the fluorescence signal of reporter group transmitting is quenched group absorptions；During PCR amplification, Taq enzyme 5 ' -3 ' outside
Enzyme cutting activity degrades probe digestion, separates fluorophor and quenching group, so that fluorescence monitoring system can receive fluorescence
Signal, as soon as often expanding a DNA chain, has a fluorescence molecule to be formed, realizes the accumulation of fluorescence signal and the shape of PCR product
Into fully synchronized, have the characteristics that high sensitivity, high specificity, it is easy to operate, take short, high throughput, be pollution-free.Using
Taqman- Real-time quantitative PCRs, study the correlation between type II diabetes Gene Susceptibility and organophosphorus pesticide, with this
Achievement in research is applied to type II diabetes precisely treatment and prevention and control, is that the type II diabetes caused by organophosphorus pesticide is suffered from
Person provides scientific basis in tumor susceptibility gene examination, early diagnosis and precisely in terms for the treatment of.
The application principle of the present invention is explained in detail below in conjunction with the accompanying drawings.
It is provided in an embodiment of the present invention to be used to detect and the relevant type II diabetes tumor susceptibility gene kit of organophosphorus pesticide
By PCR amplification primer and for detecting the few core of specificity with organophosphorus pesticide type II diabetes tumor susceptibility gene caused by relevant
Thuja acid probe forms.
Relevant with organophosphorus pesticide 7 tumor susceptibility genes of type II diabetes of being used to detect of the embodiment of the present invention are：
MTHFR, CAPN10, LEP, IL1A, ApoE, CTLA4 and APOB gene.
The nucleotides sequence of the specific oligonucleotide probe of the embodiment of the present invention is classified as SEQ ID NO：1~SEQ ID NO：
14.The PCR amplification primer of the embodiment of the present invention, sequence are SEQ ID NO：15~SEQ ID NO：28.
Described 7 kit for detecting susceptibility genes of type II diabetes relevant with organophosphorus pesticide further include 2 ×
The H of TaqMan MasterMix and PCR grades2O；
The fluorophor that the specific oligonucleotide probe 5 ' is held, wild-type probe VIC, saltant type probe is FAM,
The quenching group at 3 ' ends is NFQ.
It is as shown in Figure 1, provided in an embodiment of the present invention susceptible with the relevant type II diabetes of organophosphorus pesticide for detecting
The detection method of kit gene comprises the following steps：
S101：Extract sample DNA；
S102：Target gene, the amplimer of target gene, probe are mixed according to definite ratio；
S103：Real-time fluorescence detection is carried out by fluorescence quantitative PCR instrument；
S104：Sample to be tested genotype interpretation.
In a preferred embodiment of the invention：Amplification system is：2 × TaqMan MasterMix, 10.0 μ L, genome
2 μ L of DNA profiling (10~50ng/ μ L), each 0.9 μ L of 10pmol/ μ L upstream and downstream primers, 10pmol/ μ L wild types and saltant type are visited
Each 0.5 μ L of pin, supplement the water of PCR grades to 20 μ L of final volume.
In a preferred embodiment of the invention：Amplification program is：95 DEG C of 10min, (92 DEG C of 15s, 60 DEG C of 1min) × 60
Circulation, 72 DEG C of 10min；After the completion of PCR data scanning, testing result are carried out using ABI companies 7900HT types fluorescence quantitative PCR instrument
Use corresponding software Applied Biosystems AutoCallerTMSoftware carries out genotype interpretation.
The purposes of the kit of the embodiment of the present invention is：For gene be and the relevant type II diabetes of organophosphorus pesticide
7 tumor susceptibility genes.
The present invention is screened by a pair type ii diabetes susceptibility loci related with organophosphorus pesticide, and design is related
Probe, by repetition test and verification, has obtained one group of good probe of hybrid specificities high accuracy, probe sequence is as follows.
1 specific oligonucleotide probe sequence of table
| Gene Name | Probe serial number | Wild-type probe sequence |
| MTHFR | 1 | 5'-VIC-ATGAAATCGGCTCCCGC-NFQ-3' |
| CAPN10 | 3 | 5'-VIC-AAGTAAGGCGTTTGAAG-NFQ-3' |
| LEP | 5 | 5'-VIC-CAGCGCCAGCGGTTGCAA-NFQ-3' |
| IL1A | 7 | 5'-VIC-CCAGGCAACACCATTGAA-NFQ-3' |
| ApoE | 9 | 5'-VIC-CGGCCGCACACGTCCT-NFQ-3' |
| CTLA4 | 11 | 5'-VIC-AACCTGGCTACCAGGACCT-NFQ-3' |
| APOB | 13 | 5'-VIC-TGTATCTTCTAGGGTCTCT-NFQ-3' |
| Gene Name | Probe serial number | Saltant type probe sequence |
| MTHFR | 2 | 5'-FAM-ATGAAATCGACTCCCGC-NFQ-3' |
| CAPN10 | 4 | 5'-FAM-AAGTAAGGCATTTGAAG-NFQ-3' |
| LEP | 6 | 5'-FAM-CAGCGCCAACGGTTGCAA-NFQ-3' |
| IL1A | 8 | 5'-FAM-CCAGGCAACATCATTGAA-NFQ-3' |
| ApoE | 10 | 5'-FAM-CGGCCGCGCACGTCCT-NFQ-3' |
| CTLA4 | 12 | 5'-FAM-AACCTGGCTGCCAGGACC-NFQ-3' |
| APOB | 14 | 5'-FAM-TGTATCTTCTAGAGTCTCT-NFQ-3' |
The type ii diabetes susceptibility loci PCR amplification primer sequence related with organophosphorus pesticide is as follows.
The primer sequence in 24 susceptibility gene mutation sites of table
| Gene Name | Site | Primer sequence number | Forward primer sequence 5'-3' |
| MTHFR | rs1801133 | 15 | GCACTTGAAGGAGAAGGTGTCT |
| CAPN10 | rs3792267 | 17 | GCGCTCACGCTTGCT |
| LEP | rs7799039 | 19 | GCAAGTTGTGATCGGGCCGCTAT |
| IL1A | rs1800587 | 21 | GCCACAGGAATTATAAAAGCTGAGA |
| ApoE | rs429358 | 23 | AGACCATGAAGGAGTTGAAGGCCT |
| CTLA4 | rs926169 | 25 | AAGGCTCAGCTGAACCTGG |
| APOB | rs693 | 27 | GGCTCACATGAAGGCCAAATTC |
| Gene Name | Site | Primer sequence number | Reverse primer sequences 5'-3' |
| MTHFR | rs1801133 | 16 | CCTCAAAGAAAAGCTGCGTGATG |
| CAPN10 | rs3792267 | 18 | CCTCACCAAGTCAAGGCTTAGC |
| LEP | rs7799039 | 20 | GGCACAGCCCAGCAGCAAATC |
| IL1A | rs1800587 | 22 | CCCGGGAGGTATGCGTAAG |
| ApoE | rs429358 | 24 | CACCTGCTCCTTCACCTCGT |
| CTLA4 | rs926169 | 26 | GCTGAAACAAATGAAACC |
| APOB | rs693 | 28 | AGTTCCTGCTGAATGTCCATTTGAT |
The application principle of the present invention is further described with reference to embodiment.
Embodiment 1：
The embodiment of the present invention screens and organophosphorus pesticide Long Term Contact crowd, according to type II diabetes tumor susceptibility gene, adopts
With meta analysis methods, statistic of classification is carried out to each tumor susceptibility gene, OR values is calculated, counts and organophosphorus pesticide Long Term Contact
Relevant susceptibility loci.By taking the rs1801133 gene locis of MTHFR as an example, statistics organophosphorus pesticide Long Term Contact is susceptible
People group and the data of control group, Wei You contact histories Susceptible population and control group, through 5 software analysis of reviewmanager, knot
Fruit shows, site OR values are 2.03, more than 1, therefore the site for organophosphorus pesticide Long Term Contact Susceptible population it is dangerous because
Element.
The specific oligonucleotides for being used to detect the diabetes B tumor susceptibility gene related with organophosphor in the embodiment of the present invention
Acid probe, the nucleotide sequence such as SEQ ID NO of the probe：Shown in 1~14, amplimer such as SEQ ID NO：15~28 institutes
Show, the synthesis of commission Shanghai company.
Embodiment 2：
The extraction and dilution of 1.DNA samples
Base is carried out after obtaining the vacuum blood collection tube collection venous blood with ethylenediamine tetra-acetic acid (EDTA) anti-freezing according to a conventional method
Because of a group DNA extractions, poba gene group DNA extraction kit joins the self-built kit of lucky medical test Co., Ltd of institute for Shanghai, uses
PCR grade water dilute samples are to 10~50ng/ μ L.
2. pattern detection
Amplification system is：2 × TaqMan Master Mix, 10.0 μ L, 2 μ L of genomic DNA template (10~50ng/ μ L),
Each 0.9 μ L of 10pmol/ μ L upstream and downstream primers, 10pmol/ μ L wild types and each 0.5 μ L of saltant type probe, supplement the water of PCR grades
To 20 μ L of final volume.
Amplification program is：95 DEG C of 10min, (92 DEG C of 15s, 60 DEG C of 1min) × 60 circulations, 72 DEG C of 10min；After the completion of PCR
Data scanning is carried out using ABI companies 7900HT types fluorescence quantitative PCR instrument, testing result uses corresponding software Applied
Biosystems AutoCallerTMSoftware carries out genotype interpretation.
3. testing result
Gene is MTHFR in Fig. 3-I, and Genotype 11 is the 11 of in corresponding diagram 3 I Genotype row, and correspondence is shown in
Genotype in report is GG, Genotype 11：4 represent that the sample number that testing result is GG is 4；Genotype 12：3
Represent, the sample number that testing result is AG is 3；Genotype22：2 represent that the sample number that testing result is AA is 2.
Gene is CAPN10, Genotype 11 in Fig. 3-II：0 represents that the sample number that testing result is AA is 0；
Genotype 12：2 represent that the sample number that testing result is AG is 2；Genotype 22：4 represent, testing result is GG's
Sample number is 4.
Gene is LEP, Genotype 11 in Fig. 3-III：5 represent that the sample number that testing result is AA is 5；
Genotype 12：1 represents that the sample number that testing result is AG is 1；Genotype 22：1 represents, testing result is GG's
Sample number is 1.
Gene is IL1A, Genotype 11 in Fig. 3-IV：1 represents that the sample number that testing result is AA is 1；
Genotype 12：1 represents that the sample number that testing result is AG is 1；Genotype 22：3 represent, testing result is GG's
Sample number is 3；NTC：1 represents 1 negative control sample.
Gene is ApoE, Genotype 11 in Fig. 3-V：0 represents that the sample number that testing result is GG is 0；
Genotype 12：4 represent that the sample number that testing result is AG is 4；Genotype 22：16 represent, testing result is AA's
Sample number is 16.
Gene is CTLA4, Genotype 11 in Fig. 3-VI：0 represents that the sample number that testing result is AA is 0；
Genotype 12：4 represent that the sample number that testing result is AG is 4；Genotype 22：16 represent, testing result is GG's
Sample number is 16.
Gene is APOB, Genotype 11 in Fig. 3-VII：0 represents that the sample number that testing result is AA is 0；
Genotype 12：2 represent that the sample number that testing result is AG is 2；Genotype 22：6 represent, testing result is GG's
Sample number is 6.
The foregoing is merely illustrative of the preferred embodiments of the present invention, is not intended to limit the invention, all essences in the present invention
All any modification, equivalent and improvement made within refreshing and principle etc., should all be included in the protection scope of the present invention.
<110>Xuzhou Engineering Institute
<120>For detecting and the relevant type II diabetes tumor susceptibility gene kit of organophosphorus pesticide
<160> 29
<210> 1
<211> 17
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 1
ATGAAATCGGCTCCCGC
<210> 2
<211> 17
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 2
ATGAAATCGACTCCCGC
<210> 3
<211> 17
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 3
AAGTAAGGCGTTTGAAG
<210> 4
<211> 17
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 4
AAGTAAGGCATTTGAAG
<210> 5
<211> 18
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400>5
CAGCGCCAGCGGTTGCAA
<210> 6
<211> 18
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 6
CAGCGCCAACGGTTGCAA
<210> 7
<211> 18
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 7
CCAGGCAACACCATTGAA
<210> 8
<211> 18
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 8
CCAGGCAACATCATTGAA
<210> 9
<211> 16
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 9
CGGCCGCACACGTCCT
<210> 10
<211> 16
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 10
CGGCCGCGCACGTCCT
<210> 11
<211>19
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 11
AACCTGGCTACCAGGACCT
<210> 12
<211> 18
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 12
AACCTGGCTGCCAGGACC
<210> 13
<211> 19
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 13
TGTATCTTCTAGGGTCTCT
<210> 14
<211> 19
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 14
TGTATCTTCTAGAGTCTCT
<210> 15
<211> 22
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 15
GCACTTGAAGGAGAAGGTGTCT
<210> 16
<211> 23
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 16
CCTCAAAGAAAAGCTGCGTGATG
<210> 17
<211> 15
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 17
GCGCTCACGCTTGCT
<210> 18
<211> 22
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 18
CCTCACCAAGTCAAGGCTTAGC
<210> 19
<211> 23
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 19
GCAAGTTGTGATCGGGCCGCTAT
<210>20
<211>21
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 20
GGCACAGCCCAGCAGCAAATC
<210>21
<211> 25
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400>21
GCCACAGGAATTATAAAAGCTGAGA
<210> 22
<211> 19
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 22
CCCGGGAGGTATGCGTAAG
<210> 23
<211> 24
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 23
AGACCATGAAGGAGTTGAAGGCCT
<210> 24
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400>24
CACCTGCTCCTTCACCTCGT
<210> 25
<211> 19
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400>25
AAGGCTCAGCTGAACCTGG
<210> 26
<211> 18
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 26
GCTGAAACAAATGAAACC
<210>27
<211> 22
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 27
GGCTCACATGAAGGCCAAATTC
<210> 28
<211> 25
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 28
AGTTCCTGCTGAATGTCCATTTGAT
<210> 29
<211> 30
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 29
TGTATCTTCTAGAGTCTCTC
Claims (7)
1. one kind is used to detect and the relevant type II diabetes tumor susceptibility gene kit of organophosphorus pesticide, it is characterised in that described
For detecting with the relevant type II diabetes tumor susceptibility gene kit of organophosphorus pesticide by PCR amplification primer and for detecting and having
The specific oligonucleotide probe composition of type II diabetes tumor susceptibility gene caused by machine phosphorus insecticide is relevant；
The nucleotides sequence of the specific oligonucleotide probe is classified as SEQ ID NO：1~SEQ ID NO：14；
The PCR amplification primer, sequence are SEQ ID NO：15~SEQ ID NO：28.
2. as claimed in claim 1 be used for detection and the relevant type II diabetes tumor susceptibility gene kit of organophosphorus pesticide, its
It is characterized in that, described 7 tumor susceptibility genes of type II diabetes are：MTHFR, CAPN10, LEP, IL1A, ApoE, CTLA4 and APOB base
Cause.
3. as claimed in claim 1 be used for detection and the relevant type II diabetes tumor susceptibility gene kit of organophosphorus pesticide, its
Be characterized in that, it is described be used to detecting with the relevant type II diabetes tumor susceptibility gene kit of organophosphorus pesticide further include containing 2 ×
The water of TaqManMasterMix and PCR grades.
4. as claimed in claim 1 be used for detection and the relevant type II diabetes tumor susceptibility gene kit of organophosphorus pesticide, its
It is characterized in that, the fluorophor that the specific oligonucleotide probe 5 ' is held, wild-type probe VIC, saltant type probe is
FAM, the quenching group at 3 ' ends is NFQ.
5. a kind of be used to detect and the relevant type II diabetes tumor susceptibility gene kit of organophosphorus pesticide as claimed in claim 1
Detection method, it is characterised in that described to be used to detect and the relevant type II diabetes tumor susceptibility gene kit of organophosphorus pesticide
Detection method comprises the following steps：
Step 1, extracts sample DNA；
Step 2, target gene, the amplimer of target gene, probe are mixed according to definite ratio；
Step 3, real-time fluorescence detection is carried out by fluorescence quantitative PCR instrument；
Step 4, sample to be tested genotype interpretation.
6. detection method as claimed in claim 5, it is characterised in that amplification system is：2×TaqMan Master Mix
10.0 μ L, 2 μ L of genomic DNA template (10~50ng/ μ L), each 0.9 μ L of 10pmol/ μ L upstream and downstream primers, 10pmol/ μ L are wild
Type and each 0.5 μ L of saltant type probe, supplement the water of PCR grades to 20 μ L of final volume.
7. detection method as claimed in claim 5, it is characterised in that amplification program is：95 DEG C of 10min, (92 DEG C of 15s, 60 DEG C
1min) × 60 circulation, 72 DEG C of 10min；Data are carried out after the completion of PCR using ABI companies 7900HT types fluorescence quantitative PCR instrument to sweep
Retouch, testing result uses software Applied Biosystems AutoCallerTMSoftware carries out genotype interpretation.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711385021.XA CN107988355A (en) | 2017-12-20 | 2017-12-20 | For detecting and the relevant type II diabetes tumor susceptibility gene kit of organophosphorus pesticide |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711385021.XA CN107988355A (en) | 2017-12-20 | 2017-12-20 | For detecting and the relevant type II diabetes tumor susceptibility gene kit of organophosphorus pesticide |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN107988355A true CN107988355A (en) | 2018-05-04 |
Family
ID=62039342
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201711385021.XA Pending CN107988355A (en) | 2017-12-20 | 2017-12-20 | For detecting and the relevant type II diabetes tumor susceptibility gene kit of organophosphorus pesticide |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107988355A (en) |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101748190A (en) * | 2008-12-22 | 2010-06-23 | 上海基康生物技术有限公司 | Method for detecting related loci of type-2 diabetes |
-
2017
- 2017-12-20 CN CN201711385021.XA patent/CN107988355A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101748190A (en) * | 2008-12-22 | 2010-06-23 | 上海基康生物技术有限公司 | Method for detecting related loci of type-2 diabetes |
Non-Patent Citations (7)
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| KR102028375B1 (en) | Systems and methods to detect rare mutations and copy number variation | |
| CN103608818B (en) | The antenatal ploidy identification device of Noninvasive | |
| JP5317430B2 (en) | Probe set, probe carrier, and fungal discrimination identification method | |
| CN110100013A (en) | Method and system for lesion detection | |
| CN107708556A (en) | diagnostic method | |
| CN106047998A (en) | Detection method and application of lung cancer genes | |
| CN105518151A (en) | Identification and use of circulating nucleic acid tumor markers | |
| CN107077537A (en) | With short reading sequencing data detection repeat amplification protcol | |
| CN107447033A (en) | A kind of diagnosis of colorectal carcinoma biomarker and its application | |
| CN107254531B (en) | Genetic biomarker for auxiliary diagnosis of early colorectal cancer and application thereof | |
| KR20210119282A (en) | Methods and systems for monitoring long-term health and disease | |
| CN106367491A (en) | Kit for detecting deafness susceptibility genes | |
| CN105648088A (en) | AD or MCI detection marker and detection method thereof | |
| CN108893532A (en) | A kind of gene detecting kit and detection method for SMA genetic screening | |
| CN107586842A (en) | A kind of biomarker for clear cell carcinoma of kidney diagnosis and treatment | |
| CN106929577A (en) | A kind of lncRNA biomarker related to adenocarcinoma of lung | |
| CN103911440A (en) | SNP marker related to liver toxicity of platinum type chemotherapeutic medicines and applications thereof | |
| CN102286625B (en) | Seminal plasma micro RNA combination relevant to male reproductive function disorder and application thereof | |
| CN107988355A (en) | For detecting and the relevant type II diabetes tumor susceptibility gene kit of organophosphorus pesticide | |
| US20220333199A1 (en) | Diagnostic Chromosome Marker | |
| CN106702002A (en) | Biomarker for lung adenocarcinoma diagnosis and treatment | |
| US20110118125A1 (en) | Neonatal salivary genomics | |
| CN102766573A (en) | Gene group detection structure | |
| CN102286615B (en) | Molecular marker for predicting curative effect of platinum chemo-treatment on later non-small cell lung cancer and application thereof | |
| CN110229891A (en) | The product of non-invasive diagnosis Male Osteoporosis |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20180504 |
|
| RJ01 | Rejection of invention patent application after publication |