CN107988354A - Primer, kit and the method for NUDT15 Genotypings - Google Patents
Primer, kit and the method for NUDT15 Genotypings Download PDFInfo
- Publication number
- CN107988354A CN107988354A CN201711332298.6A CN201711332298A CN107988354A CN 107988354 A CN107988354 A CN 107988354A CN 201711332298 A CN201711332298 A CN 201711332298A CN 107988354 A CN107988354 A CN 107988354A
- Authority
- CN
- China
- Prior art keywords
- primer
- nudt15
- seq
- sequence
- genotypings
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Pathology (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of primer, kit and the method for NUDT15 Genotypings.The characteristics of primer, kit and the method for the NUDT15 Genotypings lack 3 ' 5 ' end 5 prime excision enzyme activity using Taq thermal starting archaeal dna polymerases, when 3 ' end bases of amplimer and template base not mutual added time, it can cause the drastically reduction of amplified production, 3 primers of point mutation known to design accordingly, its 3 ' end base template base complementrity with saltant type and wild type respectively, so as to which wild type and mutated genes are distinguished.The primer of the NUDT15 Genotypings of the present invention, kit and method testing process are simple, amplification efficiency is high, high specificity, in parting detection process, internal reference template, internal control primer pair and positive control, negative control etc. can be coordinated, complete monitoring is carried out to real-time fluorescence PCR process, avoid the occurrence of false negative and false positive as a result, genotyping result accurately and reliably.
Description
Technical field
The present invention relates to molecular Biological Detection field, more particularly, to a kind of primer of NUDT15 Genotypings, examination
Agent box and method.
Background technology
The mercapto such as imuran (Azathioprine, AZA) and Ismipur (6-mercaptopurine, 6-MP) is fast
Purine class medicine is widely used in treating cancer, organ transplant, autoimmune disease or diseases associated with inflammation, such as inflammatory bowel disease (IBD).
But thiopurine medicine can cause the generation of leukopenia, this potential hazard is in the Europe for taking thiopurine medicine
5% is up in people IBD crowd.Thiopurine methyltransferase (TMPT) mutation and leukopenia caused by thiopurine medicine
Between relation have been found, and U.S. FDA recommend before thiopurine medicine is taken carry out TMPT detections.However, take
Thiopurine medicine causes the IBD crowd of leukopenia, and only about 1/4 carries TPMT mutation, and there are other factors for prompting
Cause the generation of the symptom, therefore the validity of TPMT detections makes us querying.Further study showed that the TPMT of European crowd dashes forward
Control with changed scale (about 10%) is higher than asian population (about 3%), still, Neuroleptic Leukocytopenia caused by thiopurine medicine in asian population
The proportion of disease is but far above European crowd.It recent studies have shown that, mutation and the thiopurine medicine of NUDT15 genes cause
The correlation of leukopenia is mutated the correlation with the symptom far above TMPT, and NUDT15 genes are that mercapto is fast in different crowd
Purine class medicine causes the important hereditary factor of leukopenia.
NUDT15 genes are located at No. 13 chromosome of people, specific location chr13:48611703-48621358 (hg19),
Full length gene 9656bp.Totally 3 extrons, coding section length are 492bp to the gene, and encoding proteins are nudix hydrolases 15
(nudix hydrolase 15).The 415th position (chr13 of extron of NUDT15 genes:48619855 (hg19)) it is one
SNP site, under normal circumstances, the base at 415 are C (cytimidine), and the amino acid of 415-417 bases CGT codings is Arg (essences
Propylhomoserin)；After undergoing mutation, the base at 415 is changed into T (thymidine), and the amino acid of 415-417 bases TGT codings is changed into Cys
(cysteine).NUDT15c.415C>T sports germline mutation, and the mutation is in the most commonly seen (AF=of East Asia crowd
10.43%), secondly Latin America and South Asia, European Finn, the African frequency of mutation are minimum.
Due to NUDT15 genes c.415C>T (p.Arg139Cys) mutation enhance the white blood cell of mercaptopurine drug induction
The neurological susceptibility of disease is reduced, therefore, for acute lymphatic leukemia, autoimmune disease (such as Crohn disease, rheumatoid
Property arthritis) and organ transplant patients, the detection NUDT15 gene mutation points before mercaptopurine drug (Thiopurine) is being taken,
Determine the genotype of NUDT15, help to instruct personalized medicine therapeutic scheme.
The method of traditional Genotyping has generation PCR sequencing PCR, fragment length polymorphism method (restriction enzyme), high score
Resolution melting curve method (HRM) and other methods based on qPCR.Wherein, the sequencing of generation PCR sequencing PCR is accurate, but operating procedure
More, experimental period is grown；Fragment length polymorphism analysis method be easy to cause sample contamination or digestion is not filled, it is necessary to digestion, electrophoresis
Point；High-resolution melting curve method is higher to the temperature control requirement of instrument, and applicability is relatively low.Especially currently on the market not
There is effective detection product of NUDT15 Genotypings, therefore, the detection product for designing special detection NUDT15 genotype has
Very great meaning.
The content of the invention
Based on this, it is necessary to provide a kind of high detection efficiency, high specificity and the NUDT15 bases for not easily causing sample contamination
Because of the primer, kit and method of parting.
The technical solution that the present invention solves above-mentioned technical problem is as follows.
A kind of primer of NUDT15 Genotypings, at least one set in following three groups of primers：
First group：Forward primer, sequence mutation as shown in SEQ ID NO.2 of the sequence as shown in SEQ ID NO.1 is anti-
To the wild reverse primer of primer and sequence as shown in SEQ ID NO.3；
Second group：Forward primer, sequence mutation as shown in SEQ ID NO.4 of the sequence as shown in SEQ ID NO.1 is anti-
To the wild reverse primer of primer and sequence as shown in SEQ ID NO.5；
3rd group：Forward primer, sequence mutation as shown in SEQ ID NO.6 of the sequence as shown in SEQ ID NO.1 is anti-
To the wild reverse primer of primer and sequence as shown in SEQ ID NO.7.
In one of the embodiments, the PCR primer is selected from the 3rd group of primer, i.e., sequence is as shown in SEQ ID NO.1
The open country of mutation reverse primer and sequence as shown in SEQ ID NO.7 as shown in SEQ ID NO.6 of forward primer, sequence
Raw reverse primer.
In one of the embodiments, the primer of the NUDT15 Genotypings further includes internal control primer pair, described interior
Ginseng primer pair is used for GAPDH genetic fragment of the extension increasing sequence as shown in SEQ ID NO.8.
In one of the embodiments, the sequence of the forward primer of the internal control primer pair and reverse primer is respectively such as SEQ
Shown in ID NO.9 and SEQ ID NO.10.
A kind of kit of NUDT15 Genotypings, is used containing the NUDT15 Genotypings described in any of the above-described embodiment
Primer.
In one of the embodiments, the positive of the kit of the NUDT15 Genotypings also containing CC type genotype
The positive quality control product of quality-control product and/or TT type genotype.
In one of the embodiments, the kit of the NUDT15 Genotypings also contains internal reference template, described interior
Moduli plate has GAPDH genetic fragment of the sequence as shown in SEQ ID NO.8.
In one of the embodiments, the kit of the NUDT15 Genotypings also containing PCR reaction buffers,
Taq DNA thermal startings polymerase, dNTP, MgCl2, in SYBR Green I fluorescent dyes and ROX Reference Dye
At least one reagent.
A kind of NUDT15 methods of genotyping, includes the following steps：
Obtain the DNA sample of sample to be tested；
Using the DNA sample of acquisition as template, using the NUDT15 Genotypings by the use of primer as PCR amplification primer, add
Enter PCR reaction buffers, Taq DNA thermal startings polymerase, dNTP, MgCl2, SYBR Green I fluorescent dyes and ROX
Reference Dye, carry out real-time fluorescence PCR reaction；
Gather fluorescence signal in real time in real-time fluorescence PCR reaction process.
In one of the embodiments, the final concentration of each component is as follows in the reaction system of real-time fluorescence PCR reaction：PCR
Reaction buffer：1 ×, Taq DNA thermal starting polymerases：0.05~0.1U/ μ l, dNTP：0.1~1.0mM, MgCl2：0.3~
3mM, SYBR Green I fluorescent dyes：(0.2~1) ×, ROX Reference Dye：0.1~1 μM, each forward primer：0.1
~1 μM, each reverse primer：0.1~1 μM；
Real-time fluorescence PCR reaction condition be：94~95 DEG C of 5~15min of pre-degeneration；94~95 DEG C, 10~15s, 58~
63 DEG C, 30~40s, period gather fluorescence signal in real time, totally 35~45 circulations；95 DEG C, 15s, 60 DEG C, 60s, 95 DEG C, 15s,
And continuous collecting fluorescence signal.
Primer, kit and the method for above-mentioned NUDT15 Genotypings lack 3 ' using Taq thermal starting archaeal dna polymerases-
The characteristics of 5 ' end 5 prime excision enzyme activity, when 3 ' end bases of amplimer and template base not mutual added time, can cause amplified production
Drastically reduce, accordingly design known to point mutation 3 primers, its 3 ' end base respectively with saltant type and the template base of wild type
Complementation, so as to which wild type and mutated genes are distinguished.
By further study show that, although the primer of design and the template base complete complementary of saltant type and wild type can
Go out required purpose fragment with specific amplification, but Genotyping effect is bad, and spy, which is traced it to its cause, has found that it is likely that it is non-specific
Amplification caused by, for example there is CC types primer and not only have amplification to CC genotype samples, also have expansion to TT genotype samples
The situation of increasing, and TT types primer not only has TT genotype samples amplification, also has amplification to CC genotype samples.Research finds,
3 ' end base pair dna polymerases starting PCR amplifications of primer are most important, but except can be complementary with A-T, C-G between base-pair
With external, often there is also base mispairing, such as purine bases and purine bases mispairing, pyrimidine bases and pyrimidine bases mispairing or
Purine bases and pyrimidine bases mispairing, such as G-A mispairing, T-C mispairing and G-T mispairing, and each not phase of the combination power of base mismatch
Together, although therefore wild type, saltant type can also be matched respectively with the primer of saltant type and the template base complete complementary of wild type
It is nucleic acid-templated, but Genotyping cannot be distinguished completely.Thus, when in face of the technical barrier, the present invention further by
The reverse primer of NUDT15 Genotypings actively introduces base mismatch close to the position at 3 ' ends, and by creatively deeply grinding
To study carefully, it is found that the artificial mutation that introduces is more, parting effect is better, but amplification efficiency can decline, and it is fewer to introduce artificial mutation, point
Type effect is poorer, but amplification efficiency raises, and studies and also found, introduces the binding ability difference of different base mismatch, and
And primer 3 ' hold diverse location base introduce mispairing after, with template pairing ability it is also different cause, finally filter out
The reverse primer of several groups of reverse primers, such as above-mentioned second group and the 3rd group, can not only realize correct Genotyping, and expand
Increasing Efficiency significantly improves.
The common fluorescent marker of quantitative fluorescent PCR has fluorescent dye and Taqman probes.Although Taqman sonde method signals
Intensity is high, but there was only a base for the NUDT15 genes that present invention needs detect, its two kinds of probe for being used for Genotyping
Difference, thus need to carry out numerous and diverse optimal conditions just can, not only detection efficiency is low, is also easy to cause wrong amplification, produces
The result of false positive or false negative.And the NUDT15 methods of genotyping of the present invention is by using specially designed primer sequence,
Binding fluorescent dyes method, can be whether there is by amplification curve Ct values and realize Genotyping, and can combine melting curve Tm values into
One step determines whether specific amplification, can obtain the result accuracy and reliability higher of Genotyping.
NUDT15 methods of genotyping operating procedures of the invention are simple, the cycle is short, and can carry out stopped pipe type PCR expansions
Increase and real-time fluorescence detects, subsequently carry out electrophoresis or digestion without open pipe, can effectively reduce the risk of experimental pollution, further
Improve the accuracy and reliability of testing result.And requirement of the NUDT15 methods of genotyping to detection device of the present invention and
The requirement of the control accuracy of the parameters such as temperature is relatively low, and the applicability of instrument platform is more extensive.
The primer of the NUDT15 Genotypings of the present invention, kit and method testing process are simple, amplification efficiency is high, special
It is different in nature strong, in parting detection process, internal reference template, internal control primer pair and positive control, negative control etc. can be coordinated, to real-time
Fluorescent PCR process carries out complete monitoring, avoids the occurrence of the result of false negative and false positive.
Brief description of the drawings
Fig. 1 is that the amplification curve to CC types and TT type positive plasmids and melting are bent respectively for CC types primer pair in first group of primer
Line；
Fig. 2 is that the amplification curve to CC types and TT type positive plasmids and melting are bent respectively for TT types primer pair in first group of primer
Line；
Fig. 3 is that the amplification curve to CC types and TT type positive plasmids and melting are bent respectively for CC types primer pair in second group of primer
Line；
Fig. 4 is that the amplification curve to CC types and TT type positive plasmids and melting are bent respectively for TT types primer pair in second group of primer
Line；
The amplification curve to CC types and TT type positive plasmids and melting are bent respectively for CC types primer pair in the 3rd group of primer by Fig. 5
Line；
The amplification curve to CC types and TT type positive plasmids and melting are bent respectively for TT types primer pair in the 3rd group of primer by Fig. 6
Line；
Fig. 7 is to the expansion to CC types sample to be tested and internal reference template in embodiment 2 using the 3rd group of primer and internal control primer
Increase curve and melting curve；
Fig. 8 is to the expansion to CT types sample to be tested and internal reference template in embodiment 3 using the 3rd group of primer and internal control primer
Increase curve and melting curve.
Embodiment
For the ease of understanding the present invention, the present invention is described more fully below with reference to relevant drawings.In attached drawing
Give presently preferred embodiments of the present invention.But the present invention can realize in many different forms, however it is not limited to this paper institutes
The embodiment of description.On the contrary, the purpose for providing these embodiments is to make the understanding to the disclosure more thorough
Comprehensively.
Unless otherwise defined, all of technologies and scientific terms used here by the article is with belonging to technical field of the invention
The normally understood implication of technical staff is identical.Term used in the description of the invention herein is intended merely to description tool
The purpose of the embodiment of body, it is not intended that in the limitation present invention.Term as used herein "and/or" includes one or more phases
The arbitrary and all combination of the Listed Items of pass.
For the 415th position (chr13 of extron of NUDT15 genes:48619855 (hg19)), i.e. rs116855232
Point, present embodiment design multigroup primer, by studying the problems occurred during real-time fluorescent PCR amplification
Analysis, such as the problems such as amplification efficiency is low, poor specificity, actively introduces base mismatch in specific site creativeness, is ensureing spy
On the premise of the opposite sex, amplification efficiency is significantly improved.Table 1 below be primer details, the NUDT15 genes of present embodiment
The primer of parting may be selected from least one set in three groups of primers in table 1, such as can be independently detected selected from one of which,
Conjunction can be assembled selected from wherein two groups or three and carry out Multiple detection, analyzed with multiple-authentication, ensure the accuracy of result.
Table 1
Forward primer forms TT type primer pairs, forward primer and wild reverse primer with mutation reverse primer in each group primer
Form CC type primer pairs.
Preferably, in a specific embodiment, PCR primer is independently selected from the 3rd group of primer, i.e. sequence such as SEQ ID
Mutation reverse primer and the sequence such as SEQ ID NO.7 of forward primer, sequence as shown in SEQ ID NO.6 shown in NO.1
Shown wild reverse primer.
In one embodiment, the primer of the NUDT15 Genotypings further includes internal control primer pair, internal control primer to
In GAPDH genetic fragment of the extension increasing sequence as shown in SEQ ID NO.8.The forward primer of internal control primer pair and the sequence of reverse primer
Row can be but not limited to respectively such as SEQ ID NO.9 (5 '-CTTTGGTATCGTGGAAGGACT-3 ') and SEQ ID NO.10
Shown in (5 '-GTGAGCTTCCCGTTCAGCTC-3 ').GAPDH genetic fragments：
atggggaaggtgaaggtcggagtcaacggatttggtcgtattgggcgcctggtcaccagggctgcttttaactctgg
taaagtggatattgttgccatcaatgaccccttcattgacctcaactacatggtttacatgttccaatatgattcca
cccatggcaaattccatggcaccgtcaaggctgagaacgggaagcttgtcatcaatggaaatcccatcaccatcttc
caggagcgagatccctccaaaatcaagtggggcgatgctggcgctgagtacgtcgtggagtccactggcgtcttcac
caccatggagaaggctggggctcatttgcaggggggagccaaaagggtcatcatctctgccccctctgctgatgccc
ccatgttcgtcatgggtgtgaaccatgagaagtatgacaacagcctcaagatcatcagcaatgcctcctgcaccacc
aactgcttagcacccctggccaaggtcatccatgacaactttggtatcgtggaaggactcatgaccacagtccatgc
catcactgccacccagaagactgtggatggcccctccgggaaactgtggcgtgatggccgcggggctctccagaaca
tcatccctgcctctactggcgctgccaaggctgtgggcaaggtcatccctgagctgaacgggaagctcactggcatg
gccttccgtgtccccactgccaacgtgtcagtggtggacctgacctgccgtctagaaaaacctgccaaatatgatga
catcaagaaggtggtgaagcaggcgtcggagggccccctcaagggcatcctgggctacactgagcaccaggtggtct
cctctgacttcaacagcgacacccactcctccacctttgacgctggggctggcattgccctcaacgaccactttgtc
aagctcatttcctggtatgacaacgaatttggctacagcaacagggtggtggacctcatggcccacatggcctccaa
ggagtaa。
Present embodiment additionally provides a kind of kit of NUDT15 Genotypings, it contains any of the above-described embodiment
The primer of NUDT15 Genotypings.
In one embodiment, positive quality control product of the kit of the NUDT15 Genotypings also containing CC type genotype
And/or the positive quality control product of TT type genotype.Each positive quality control product can be the plasmid of the genetic fragment containing corresponding gene type,
Carrier T recombinant plasmid such as containing one section of NUDT15 CC type genetic fragment, the T containing one section of NUDT15 TT type genetic fragment are carried
Body recombinant plasmid etc..
In one embodiment, the kit of the NUDT15 Genotypings also contains internal reference template, and internal reference template has
GAPDH genetic fragment of the sequence as shown in SEQ ID NO.8.Internal reference template can be but not limited to as containing corresponding GAPDH bases
Carrier T recombinant plasmid because of fragment etc..
In addition, the kit of the NUDT15 Genotypings also polymerize containing PCR reaction buffers, Taq DNA thermal startings
Enzyme, dNTP, MgCl2, at least one of SYBR Green I fluorescent dyes and ROX Reference Dye reagent.
In a specific embodiment, 10 ×, the formula of the PCR reaction buffers of pH8.3 it is as follows：
Tris-HCl buffer solutions (pH8.3)： 100mM；
KCl： 500mM.
Preparation method：By 100ml 10 × PCR reaction buffers exemplified by：Tris 1.21g, KCl 3.73g are weighed to dry
Net beaker, adds deionized water dissolving, adjusts pH to 8.3 and is settled to 100ml, using 0.2 μm of membrane filtration, stores to 4
℃.It is diluted to 1 during use ×.
Further, present embodiment additionally provides a kind of NUDT15 methods of genotyping, it includes the following steps：
Obtain the DNA sample of sample to be tested；
Using the DNA sample of acquisition as template, using NUDT15 Genotypings by the use of primer be used as PCR amplification primer, add PCR
Reaction buffer, Taq DNA thermal startings polymerase, dNTP, MgCl2, SYBR Green I fluorescent dyes and ROX
Reference Dye, carry out real-time fluorescence PCR reaction；
Gather fluorescence signal in real time in real-time fluorescence PCR reaction process.
In one embodiment, the final concentration of each component is as follows in the reaction system of real-time fluorescence PCR reaction：PCR reacts
Buffer solution：1×；Taq DNA thermal starting polymerases：0.05~0.1U/ μ l, are preferably 0.05U/ μ l；dNTP：0.1~1.0mM,
Preferably 0.2mM；MgCl2：0.3~3mM, is preferably 2mM；SYBR Green I fluorescent dyes：(0.2~1) ×, it is preferably 1
×；ROX Reference Dye：0.1~1 μM, be preferably 0.5 μM；Each forward primer：0.1~1 μM, be preferably 0.2 μM；Respectively
Reverse primer：0.1~1 μM, be preferably 0.2 μM.In addition, the addition concentration of DNA sample or positive quality control product is 1~10ng/ μ l,
It is preferred that 1ng/ μ l.
In one embodiment, the condition of real-time fluorescence PCR reaction is：94~95 DEG C of 5~15min of pre-degeneration；94~95
DEG C, 10~15s, 58~63 DEG C, 30~40s, period gather fluorescence signal in real time, totally 35~45 circulations；95 DEG C, 15s, 60
DEG C, 60s, 95 DEG C, 15s, and continuous collecting fluorescence signal.Preferably, the condition of real-time fluorescence PCR reaction is：95 DEG C of pre-degenerations
5min；95 DEG C, 10s, 60 DEG C, 30s, period gather fluorescence signal in real time, totally 40 circulations；95 DEG C, 15s, 60 DEG C, 60s, 95
DEG C, 15s, and continuous collecting fluorescence signal.
Primer, kit and the method for above-mentioned NUDT15 Genotypings lack 3 ' using Taq thermal starting archaeal dna polymerases-
The characteristics of 5 ' end 5 prime excision enzyme activity, when 3 ' end bases of amplimer and template base not mutual added time, can cause amplified production
Drastically reduce, accordingly design known to point mutation 3 primers, its 3 ' end base respectively with saltant type and the template base of wild type
Complementation, so as to which wild type and mutated genes are distinguished.Primer, the kit of the NUDT15 Genotypings of the present invention
With method testing process is simple, amplification efficiency is high, high specificity, in parting detection process, internal reference template, interior reference can be coordinated
Thing pair and positive control, negative control etc., complete monitoring is carried out to real-time fluorescence PCR process, avoids the occurrence of false negative and vacation sun
Property as a result, genotyping result accurately and reliably.
It is specific embodiment part below.
Embodiment 1
1st, amplification efficiency and specificity analysis
Using above-mentioned 1 three groups of primers of table as the primer of real-time fluorescent PCR amplification, using CC types and TT types positive plasmid as treating
Test sample sheet, is analyzed using the physiological saline of free nucleic acid as negative control, verification amplification efficiency and specificity.
The construction method of CC types and TT type positive plasmids is summarized as follows：
Using the method for molecular cloning, using the nucleic acid of CC type genotype samples as template, produce one section through amplification and contain
The nucleic acid fragment of NUDT15CC type genotype, with- T Easy carriers (promega) connection, conversion bacillus coli DH 5
α, the positive bacterium colony sequencing of selection clone, extraction plasmid, obtains CC type positive plasmids；
Using the nucleic acid of CC type genotype samples as template, the method for overlapped PCR introduces point mutation, and one section is produced through amplification
Nucleic acid fragment containing NUDT15TT type genotype, with- T Easy carriers (promega) connection, conversion large intestine bar
Bacterium DH5 α, the positive bacterium colony sequencing of selection clone, extraction plasmid, obtain TT type positive plasmids.
Amplification system is prepared and see the table below 2.
Table 2
Note：For the amplification system of sample to be tested, the DNA sample addition as amplification template is 20ng.
Amplification condition see the table below 3.
Table 3
* melting curve step：60 DEG C~95 DEG C continuous collecting fluorescence signals.
Testing result see the table below 4.
Table 4
With reference to primer sequence in table 1, from upper table 4, three groups of primers can distinguish different genotype, but expand
Efficiency is different.Wherein, as depicted in figs. 1 and 2, first group of primer：CC type primer pair CC type positive plasmids have amplification and melt bent
Line peak figure is single, it is to TT type positive plasmids without amplification；TT type primer pair TT type positive plasmids have amplification and Tm value peak figures are single,
It is to CC type positive plasmids without amplification.Although first group of primer can distinguish CC types, TT type positive plasmids, amplification efficiency is opposite
It is relatively low.
As shown in Figure 3 and Figure 4, second group of primer：CC type primer pair CC type positive plasmids have amplification and melting curve peak figure
Single, it is to TT type positive plasmids without amplification；TT type primer pair TT type positive plasmids have amplification and melting curve peak figure is single, its
There is faint amplification to CC type positive plasmids, but Tm values are 71.86 DEG C, with the TT positive plasmid Tm 79.40 DEG C of phases of value normally expanded
Difference is huge, therefore is non-specific amplification, but does not influence the effect of Genotyping.Compared with first group of primer, the expansion of second group of primer
Increasing Efficiency increases.
As shown in Figure 5, Figure 6, the 3rd group of primer：CC type primer pair CC type positive plasmids have amplification and melting curve peak figure list
One, it is to TT type positive plasmids without amplification；TT type primer pair TT type positive plasmids have amplification and Tm value peak figures are single, it is to CC types
Positive plasmid is without amplification.Compared with first group of primer, second group of primer, the amplification efficiency of the 3rd group of primer is higher, parting effect
Well, and without non-specific amplification, it is easier to judge result.
Three groups of primer combinations can be independently operated, and can also be applied in combination, and consider, the gene point of the 3rd group of primer
Type effect is more excellent, is especially suitable for being used alone.
2nd, sensitivity is verified
Verified using above-mentioned 3rd group of primer pair into line sensitivity, and using second group of primer as a comparison.
By the human peripheral DNA of extraction, after nanodrop measured concentrations, be diluted to respectively 40ng/ μ l, 20ng/ μ l,
10ng/ μ l, are verified using same experiment condition is detected with above-mentioned positive plasmid.
The result shows that：Second group of primer is 10ng/ μ l in DNA concentration, still can detect amplified signal, but expand Ct
Value is less than the 3rd group of primer.
Two kinds of plasmid CC types and TT types are diluted to 1 × 105Copies/ μ l are expanded at the same time as positive quality control with sample
The Ct values and Tm values of sample are observed afterwards, if no signal or Ct>35, or Tm values do not meet, then it is assumed that the sample is without amplification.As a result table
It is bright, the recall rate 100% of primer, discrimination 100%.
Thus above-mentioned second group of primer and the 3rd group of primer detection coincidence rate 100% are illustrated, specificity is good, meets gene point
The requirement of type.
Embodiment 2
Using 1 blood sample, after extracting DNA, Nanodrop measured concentrations, 20ng/ μ l are diluted to using sterile water, are made
For the template of amplification.A generation sequencing the result shows that, which is CC types.
As shown in fig. 7, being detected using the 3rd group of primer in above-mentioned table 1, testing result shows, is as a result also CC
Type, its Ct value：27.48 Tm values：79.82 DEG C (meeting with positive quality control), internal control primer Ct values：22.14 Tm values：80.91℃.
TT type primer pair samples without amplification curve, without melting curve.
Embodiment 3
Using 1 blood sample, after extracting DNA, Nanodrop measured concentrations, 20ng/ μ l are diluted to using sterile water, are made
For the template of amplification.A generation sequencing the result shows that, which is CT types.
As shown in figure 8, being detected using the 3rd group of primer in above-mentioned table 1, testing result shows, is as a result also CT
Type, wherein, the Ct values of CC type primer pairs：28.2nd, Tm values：79.73 DEG C (meeting with CC type positive quality controls), the Ct of TT type primer pairs
Value：31.12, Tm values：77.81 DEG C (meeting with TT type positive quality controls), internal control primer is to Ct values：21.65 Tm values：80.88℃.
Each technical characteristic of embodiment described above can be combined arbitrarily, to make description succinct, not to above-mentioned reality
Apply all possible combination of each technical characteristic in example to be all described, as long as however, the combination of these technical characteristics is not deposited
In contradiction, the scope that this specification is recorded all is considered to be.
Embodiment described above only expresses the several embodiments of the present invention, its description is more specific and detailed, but simultaneously
Cannot therefore it be construed as limiting the scope of the patent.It should be pointed out that come for those of ordinary skill in the art
Say, without departing from the inventive concept of the premise, various modifications and improvements can be made, these belong to the protection of the present invention
Scope.Therefore, the protection domain of patent of the present invention should be determined by the appended claims.
Sequence table
<110>Guangzhou steps scape gene medical science and technology Co., Ltd
<120>Primer, kit and the method for NUDT15 Genotypings
<160> 10
<170> SIPOSequenceListing 1.0
<210> 1
<211> 19
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 1
aagaactacc tcccctgga 19
<210> 2
<211> 21
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 2
gccttgttct tttaaacatc a 21
<210> 3
<211> 21
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 3
gccttgttct tttaaacaaa g 21
<210> 4
<211> 21
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 4
gccttgttct tttaaacagc a 21
<210> 5
<211> 21
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 5
gccttgttct tttaaacagc g 21
<210> 6
<211> 21
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 6
gccttgttct tttaaacacc a 21
<210> 7
<211> 21
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 7
gccttgttct tttaaacatc g 21
<210> 8
<211> 1008
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 8
atggggaagg tgaaggtcgg agtcaacgga tttggtcgta ttgggcgcct ggtcaccagg 60
gctgctttta actctggtaa agtggatatt gttgccatca atgacccctt cattgacctc 120
aactacatgg tttacatgtt ccaatatgat tccacccatg gcaaattcca tggcaccgtc 180
aaggctgaga acgggaagct tgtcatcaat ggaaatccca tcaccatctt ccaggagcga 240
gatccctcca aaatcaagtg gggcgatgct ggcgctgagt acgtcgtgga gtccactggc 300
gtcttcacca ccatggagaa ggctggggct catttgcagg ggggagccaa aagggtcatc 360
atctctgccc cctctgctga tgcccccatg ttcgtcatgg gtgtgaacca tgagaagtat 420
gacaacagcc tcaagatcat cagcaatgcc tcctgcacca ccaactgctt agcacccctg 480
gccaaggtca tccatgacaa ctttggtatc gtggaaggac tcatgaccac agtccatgcc 540
atcactgcca cccagaagac tgtggatggc ccctccggga aactgtggcg tgatggccgc 600
ggggctctcc agaacatcat ccctgcctct actggcgctg ccaaggctgt gggcaaggtc 660
atccctgagc tgaacgggaa gctcactggc atggccttcc gtgtccccac tgccaacgtg 720
tcagtggtgg acctgacctg ccgtctagaa aaacctgcca aatatgatga catcaagaag 780
gtggtgaagc aggcgtcgga gggccccctc aagggcatcc tgggctacac tgagcaccag 840
gtggtctcct ctgacttcaa cagcgacacc cactcctcca cctttgacgc tggggctggc 900
attgccctca acgaccactt tgtcaagctc atttcctggt atgacaacga atttggctac 960
agcaacaggg tggtggacct catggcccac atggcctcca aggagtaa 1008
<210> 9
<211> 21
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 9
ctttggtatc gtggaaggac t 21
<210> 10
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 10
gtgagcttcc cgttcagctc 20
Claims (10)
- A kind of 1. primer of NUDT15 Genotypings, it is characterised in that at least one set in following three groups of primers：First group：Forward primer, sequence mutation as shown in SEQ ID NO.2 of the sequence as shown in SEQ ID NO.1 is reversely drawn The wild reverse primer of thing and sequence as shown in SEQ ID NO.3；Second group：Forward primer, sequence mutation as shown in SEQ ID NO.4 of the sequence as shown in SEQ ID NO.1 is reversely drawn The wild reverse primer of thing and sequence as shown in SEQ ID NO.5；3rd group：Forward primer, sequence mutation as shown in SEQ ID NO.6 of the sequence as shown in SEQ ID NO.1 is reversely drawn The wild reverse primer of thing and sequence as shown in SEQ ID NO.7.
- 2. the primer of NUDT15 Genotypings as claimed in claim 1, it is characterised in that the PCR primer is selected from the 3rd Group primer, i.e. mutation reverse primer of forward primer, sequence of the sequence as shown in SEQ ID NO.1 as shown in SEQ ID NO.6, And wild reverse primer of the sequence as shown in SEQ ID NO.7.
- 3. the primer of NUDT15 Genotypings as claimed in claim 1 or 2, it is characterised in that internal control primer pair is further included, The internal control primer is to the GAPDH genetic fragments for extension increasing sequence as shown in SEQ ID NO.8.
- 4. the primer of NUDT15 Genotypings as claimed in claim 3, it is characterised in that the forward direction of the internal control primer pair The sequence of primer and reverse primer is respectively as shown in SEQ ID NO.9 and SEQ ID NO.10.
- 5. a kind of kit of NUDT15 Genotypings, it is characterised in that containing as any one of Claims 1 to 4 NUDT15 Genotypings primer.
- 6. the kit of NUDT15 Genotypings as claimed in claim 5, it is characterised in that also containing CC type genotype The positive quality control product of positive quality control product and/or TT type genotype.
- 7. the kit of the NUDT15 Genotypings as described in claim 5 or 6, it is characterised in that also containing internal reference template, The internal reference template has GAPDH genetic fragment of the sequence as shown in SEQ ID NO.8.
- 8. the kit of the NUDT15 Genotypings as described in claim 5 or 6, it is characterised in that also slow containing PCR reactions Fliud flushing, Taq DNA thermal startings polymerase, dNTP, MgCl2, SYBR Green I fluorescent dyes and ROX Reference At least one of Dye reagents.
- 9. a kind of NUDT15 methods of genotyping, it is characterised in that include the following steps：Obtain the DNA sample of sample to be tested；Using the DNA sample of acquisition as template, using the NUDT15 Genotypings by the use of primer be used as PCR amplification primer, add PCR Reaction buffer, Taq DNA thermal startings polymerase, dNTP, MgCl2, SYBR Green I fluorescent dyes and ROX Reference Dye, carry out real-time fluorescence PCR reaction；Gather fluorescence signal in real time in real-time fluorescence PCR reaction process.
- 10. NUDT15 methods of genotyping as claimed in claim 9, it is characterised in that the reactant of real-time fluorescence PCR reaction The final concentration of each component is as follows in system：PCR reaction buffers：1 ×, Taq DNA thermal starting polymerases：0.05~0.1U/ μ l, dNTP：0.1~1.0mM, MgCl2：0.3~3mM, SYBR Green I fluorescent dyes：(0.2~1) ×, ROX Reference Dye：0.1~1 μM, each forward primer：0.1~1 μM, each reverse primer：0.1~1 μM；Real-time fluorescence PCR reaction condition be：94~95 DEG C of 5~15min of pre-degeneration；94~95 DEG C, 10~15s, 58~63 DEG C, 30~40s, period gather fluorescence signal in real time, totally 35~45 circulations；95 DEG C, 15s, 60 DEG C, 60s, 95 DEG C, 15s, and continue Gather fluorescence signal.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711332298.6A CN107988354B (en) | 2017-12-13 | 2017-12-13 | Primer, kit and method for NUDT15 genotyping |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711332298.6A CN107988354B (en) | 2017-12-13 | 2017-12-13 | Primer, kit and method for NUDT15 genotyping |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN107988354A true CN107988354A (en) | 2018-05-04 |
| CN107988354B CN107988354B (en) | 2021-05-14 |
Family
ID=62038443
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201711332298.6A Active CN107988354B (en) | 2017-12-13 | 2017-12-13 | Primer, kit and method for NUDT15 genotyping |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107988354B (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110512003A (en) * | 2019-09-24 | 2019-11-29 | 上海科新生物技术股份有限公司 | For detecting the detection kit and its application method of NUDT15 gene pleiomorphism |
| CN112210590A (en) * | 2020-10-27 | 2021-01-12 | 鲲羽生物科技(江门)有限公司 | Method for detecting and typing continuous multi-site gene mutation, application and reagent |
| CN113924370A (en) * | 2019-05-10 | 2022-01-11 | 香港中文大学 | Primers and assays by use of polymerase attachment regions |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106536749A (en) * | 2014-01-22 | 2017-03-22 | 蔚山大学校产学协力团 | Composition for predicting risk of thiopurine-induced leukopenia, containing single nucleotide polymorphism marker within NUDT15 gene |
| CN107299147A (en) * | 2017-08-22 | 2017-10-27 | 中国农业科学院蔬菜花卉研究所 | A kind of how main rod spore bacterium of Rapid identification is to the drug-fast method of fluopyram and special primer pair |
-
2017
- 2017-12-13 CN CN201711332298.6A patent/CN107988354B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106536749A (en) * | 2014-01-22 | 2017-03-22 | 蔚山大学校产学协力团 | Composition for predicting risk of thiopurine-induced leukopenia, containing single nucleotide polymorphism marker within NUDT15 gene |
| CN107299147A (en) * | 2017-08-22 | 2017-10-27 | 中国农业科学院蔬菜花卉研究所 | A kind of how main rod spore bacterium of Rapid identification is to the drug-fast method of fluopyram and special primer pair |
Non-Patent Citations (1)
| Title |
|---|
| CHI-CHUN HO，ET AL: "Novel Tetra-Primer ARMS-PCR Assays for Thiopurine Intolerance Susceptibility Mutations NUDT15 c.415C>T and TPMT c.719A>G (TPMT*3C) in East Asians", 《GENES》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113924370A (en) * | 2019-05-10 | 2022-01-11 | 香港中文大学 | Primers and assays by use of polymerase attachment regions |
| CN110512003A (en) * | 2019-09-24 | 2019-11-29 | 上海科新生物技术股份有限公司 | For detecting the detection kit and its application method of NUDT15 gene pleiomorphism |
| CN112210590A (en) * | 2020-10-27 | 2021-01-12 | 鲲羽生物科技(江门)有限公司 | Method for detecting and typing continuous multi-site gene mutation, application and reagent |
Also Published As
| Publication number | Publication date |
|---|---|
| CN107988354B (en) | 2021-05-14 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105821138B (en) | A kind of method that double loop-stem structure DNA profiling detection nucleic acid are built based on coupled reaction | |
| Van Loo et al. | Single cell analysis of cancer genomes | |
| ES2688458T5 (en) | Varietal nucleic acid count for genomic copy number information | |
| CN103789435B (en) | A kind of miRNA fluorescence detection reagent kit based on cascade constant-temperature amplification and method | |
| US20130267427A1 (en) | Single cell analysis by polymerase cycling assembly | |
| CN105934523A (en) | Multiplex detection of nucleic acids | |
| CN108300716A (en) | Joint component, its application and the method that targeting sequencing library structure is carried out based on asymmetric multiplex PCR | |
| CN109844137A (en) | For identifying the bar coded cyclic annular library construction of chimeric product | |
| CN107849606A (en) | The method for improving sequencing sensitivity of future generation | |
| CN105039322B (en) | DNA sequence labels and sequencing library construction method and kit | |
| ES2950346T3 (en) | Improved detection of short homopolymeric repeats | |
| KR20180108137A (en) | Melting Curve Analysis Using bifunctional PNA probe for Microsatellite Instability (MSI) Diagnosis, and Method and Kit of Microsatellite Instability Diagnosis Using the Same | |
| CN107988354A (en) | Primer, kit and the method for NUDT15 Genotypings | |
| CN110129415A (en) | A kind of NGS builds library molecular adaptor and its preparation method and application | |
| CN109576346A (en) | The construction method of high-throughput sequencing library and its application | |
| CN107988372A (en) | A kind of kit and its detection method for detecting susceptibility gene of colorectal cancer mutation | |
| CN108998508A (en) | The construction method and primer sets and kit of amplicon sequencing library | |
| CN104694622A (en) | Probe for detecting K-ras gene mutation, primer, kit and method | |
| CN107513577A (en) | A kind of method of efficient detection EGFRT790M mutant and probe and kit for detection | |
| CN102191308B (en) | Wild ginseng and cultivated ginseng multiple polymerase chain reaction (PCR) test kit and identification method | |
| CN109251964A (en) | Recycle the method and application of microRNAs detection kit and specific detection circulation microRNAs | |
| CN109680044A (en) | A kind of detection method of gene mutation for eliminating wild chain background interference based on selectivity | |
| CN104404128B (en) | A kind of detection kit in TERT assortments of genes mutational site | |
| CN101985659A (en) | Kit for testing schizophrenia related gene and preparation method thereof | |
| CN103352070B (en) | ROS1 fusion gene screening method |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |