CN107988329A - It is a kind of to be used to identify that multipotential stem cell is endogenous and detection primer group, kit and the detection method of external source versatility gene expression - Google Patents
It is a kind of to be used to identify that multipotential stem cell is endogenous and detection primer group, kit and the detection method of external source versatility gene expression Download PDFInfo
- Publication number
- CN107988329A CN107988329A CN201711118485.4A CN201711118485A CN107988329A CN 107988329 A CN107988329 A CN 107988329A CN 201711118485 A CN201711118485 A CN 201711118485A CN 107988329 A CN107988329 A CN 107988329A
- Authority
- CN
- China
- Prior art keywords
- primer
- stem cell
- amplification
- gene
- endogenous
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention relates to a kind of Primer composition, kit and the detection method of surveyor's induced multi-potent stem cell versatility gene, its Primer composition includes A primer sets, B primer sets and internal control primer, the A primer sets include the one or more in the primer pair of amplification people's induced multi-potent stem cell endogenous gene Oct4, Sox2 and Nanog, the B primer sets are the one or more of the primer pair of the amplification total gene of Oct4, Sox2 and Nanog, and the internal control primer is the primer of amplification GAPDH genes.Ribonucleic acid (RNA) is particularly extracted from multipotential stem cell, carries out quantitative detection to its versatility gene using real-time polymerase chain reaction (Real Time PCR) technology to identify endogenous and external source versatility gene expression difference detection method and kit.Identification method using the present invention is easy to operate, cost is low, and accuracy and high sensitivity.
Description
Technical field
The present invention relates to biological technical field, and in particular to one kind is used to identify that multipotential stem cell is endogenous and external source versatility
Detection primer group, kit and the detection method of gene expression.
Background technology
Multipotential stem cell (Pluripotent Stem Cells, PSCs) be it is a kind of have self-renewing, be divided into it is a variety of
The cell of cell tissue, mainly including embryonic stem cell (Embryonic Stem Cells, ESCs) and induced multi-potent stem cell
(Induced Pluripotent Stem Cells,iPSCs).ESCs is thin by separating blastaea inner cell mass or primordial germ
Born of the same parents and obtain, the tool that iPSCs refers to express specific transcription factor in the body cell of differentiation to induce it to reprogram and obtains
There is the cell of self-renewal capacity and multipotency.The foundation of iPSCs technologies, avoids the obstacle of ethics, not only can be
In basic research, unique instrument is provided for research differentiation potential mechanism and normal development, and in disease pathogenesis
There is huge potential value in terms of research, new medicament screen.
The hot issue paid close attention to the most in iPSCs researchs is safety issue, and transgenic method is to directly affect iPSCs
Foreign gene is easily incorporated into cell dyeing body by one of key element of security, especially integrated transgene carrier method.PCR
Detection technique is often used to detection endogenous cellular multipotency gene and exogenous programming with its sensitivity, specificity and high efficiency
Expression conditions, but there are the shortcomings that easy cross contamination and loaded down with trivial details operating process, with fluorescence real-time quantitative polymerase chain
The appearance of formula reaction (Real Time PCR), can not only carry out the Qualitative Identification of gene, and gene can be determined
Amount, more preferably solves the problems, such as cross contamination, and simplify operating process.
Oct4, Sox2 and Nanog gene are only just expressed in multipotent stem cells, by Real Time PCR to multipotency
The expression of the versatility gene of stem cell is analyzed, and can not only draw the relative expression quantity of versatility gene, moreover it is possible to sentence
Disconnected external source quiding gene whether in the cell silence.Although Real Time round pcrs are widely used to gene quantification analysis,
But it yet there are no that useful Real Time round pcrs identification multipotential stem cell is endogenous and the reagent of external source versatility gene expression
Box.
The content of the invention
The object of the present invention is to provide a kind of endogenous and tool of external source versatility gene for being used to identify human pluripotent stem cells
There is the Primer composition of high specific and sensitivity.The Primer composition includes A primer sets, B primer sets and internal control primer
It is right, one kind in the primer pair of the A primer sets selected from amplification multipotential stem cell endogenous gene Oct4, Sox2 and Nanog
Or it is a variety of, one in the primer pair of the B primer sets selected from the amplification total gene of multipotential stem cell Oct4, Sox2 and Nanog
Kind or it is a variety of, the internal control primer to expand the primer pair of GAPDH genes, wherein,
Expand the sequence such as SEQ ID NO of the forward primer of the primer pair of multipotential stem cell endogenous gene Oct4:1 institute
Show, the sequence such as SEQ ID NO of reverse primer:Shown in 2；
Expand the sequence such as SEQ ID NO of the forward primer of the primer pair of multipotential stem cell endogenous gene Sox2:3 institutes
Show, the sequence such as SEQ ID NO of reverse primer:Shown in 4；
Expand the sequence such as SEQ ID NO of the forward primer of the primer pair of multipotential stem cell endogenous gene Nanog:5 institutes
Show, the sequence such as SEQ ID NO of reverse primer:Shown in 6；
Expand the sequence such as SEQ ID NO of the forward primer of the primer pair of the total gene Oct4 of multipotential stem cell:Shown in 7, instead
To the sequence such as SEQ ID NO of primer:Shown in 8；
Expand the sequence such as SEQ ID NO of the forward primer of the primer pair of the total gene Sox2 of multipotential stem cell:Shown in 9, instead
To the sequence such as SEQ ID NO of primer:Shown in 10；
Expand the sequence such as SEQ ID NO of the forward primer of the primer pair of the total gene Nanog of multipotential stem cell:Shown in 11,
The sequence of reverse primer such as SEQ ID NO:Shown in 2；
Expand the sequence such as SEQ ID NO of the forward primer of the primer of GAPDH genes:Shown in 13, the sequence of reverse primer
Such as SEQ ID NO:Shown in 14.
Second object of the present invention, which is to provide, a kind of is used to detecting that human pluripotent stem cells to be endogenous and external source versatility gene
Kit, contain the Primer composition described in the first aspect of the present invention.
It is another object of the present invention to provide a kind of testing cost is low, easy to use, detection speed is fast and specific
The high identification multipotential stem cell based on Rael-Time round pcrs is endogenous and the detection method of external source versatility gene expression.
Further, the described method comprises the following steps：
1. the extracting RNA from sample
Sample is handled by lysate of Trizol, chloroform is layered RNA, is precipitated with isopropanol, then 75% ethanol
Dissolving removes organic solvent, and re-dry RNA precipitate, is finally dissolved with RNase-Free water.
2. reverse transcription reaction
The use of MMLV or AMV one of which reverse transcriptase by the rna transcription of extracting is cDNA.
3. real time fluorescent quantitative RCR amplification procedures
Real Time PCR amplifications are carried out to cDNA using the Primer composition in the present invention.Primer in PCR reaction systems
Final concentration of 0.1~0.4 μM, preferably 0.2 μM, annealing temperature are 60 ± 2 DEG C, and amplified production is 150~220bp of section fragment.
The Ct values of multipotential stem cell sample to be detected are within 35, and total gene relative expression quantity of B primer sets amplification is high
In or equal to A primer amplifications endogenous gene relative expression quantity, then judge that the testing result is errorless.
Ct values are obtained to the amplification curve and solubility curve of amplification according to A primer sets and internal control primer, judge induced multi-potent
The relative expression quantity of stem cell endogenous multipotency gene；Further according to B primer sets and internal control primer to the amplification curve of amplification and molten
The Ct values that solution curve obtains, calculate the relative expression quantity of the versatility gene totality of induced multi-potent stem cell, and versatility gene is total
The difference of body expression quantity and endogenous versatility gene expression amount is exogenous expression's amount.
Present invention offer one kind is easy to operate, cost is low, specific and high sensitivity, and energy stable detection people's induced multi-potent is done
Primer composition, kit and its method for the expression quantity of endogenous and exogenous versatility gene in cell.
Brief description of the drawings
Fig. 1 behaviour inducing pluripotent cellular endogenous genomic Oct4 fluorescence quantitative PCR detection amplification curve diagrams；
Fig. 2 behaviour inducing pluripotent cellular endogenous genomic Oct4 fluorescence quantitative PCR detection solubility curve figures；
The total gene by fluorescence quantitative PCR detections amplification curve diagrams of Fig. 3 behaviour inducing pluripotent cells Oct4；
The total gene by fluorescence quantitative PCR detections solubility curve figures of Fig. 4 behaviour inducing pluripotent cells Oct4；
Fig. 5 behaviour inducing pluripotent cellular endogenous genomic Nanog fluorescence quantitative PCR detection amplification curve diagrams；
Fig. 6 behaviour inducing pluripotent cellular endogenous genomic Nanog fluorescence quantitative PCR detection solubility curve figures；
The total gene by fluorescence quantitative PCR detections amplification curve diagrams of Fig. 7 behaviour inducing pluripotent cells Nanog；
The total gene by fluorescence quantitative PCR detections solubility curve figures of Fig. 8 behaviour inducing pluripotent cells Nanog；
Fig. 9 behaviour inducing pluripotent cellular endogenous genomic Sox2 fluorescence quantitative PCR detection amplification curve diagrams；
Figure 10 behaviour inducing pluripotent cellular endogenous genomic Sox2 fluorescence quantitative PCR detection solubility curve figures；
The total gene by fluorescence quantitative PCR detections amplification curve diagrams of Figure 11 behaviour inducing pluripotent cells Sox2；
The total gene by fluorescence quantitative PCR detections solubility curve figures of Figure 12 behaviour inducing pluripotent cells Sox2；
Figure 13 behaviour inducing pluripotent cell GAPDH gene by fluorescence quantitative PCR detects amplification curve diagram；
Figure 14 behaviour inducing pluripotent cell GAPDH gene by fluorescence quantitative PCR detects solubility curve figure；
Figure 15 is the agarose gel electrophoresis figure of the RNA of HFF and HFF-derived-iPSCs；
Figure 16 is the expression figure of endogenous and external source Oct4, Sox2 and Nanog of HFF-derived-iPSCs.
Embodiment
Below according to attached drawing, the present invention is further illustrated in conjunction with specific embodiments, to more fully understand the present invention.
First, experiment material：
Human skin fibroblasts (HFF), the hiPS cells by retrovirus induction human skin fibroblasts
(HFF-derived-iPSCs)。
2nd, primer screening
1st, Oct4, Sox2 and Nanog fluorescence quantitative PCR detection primer screening of endogenous multipotency gene
Multipair amplified fragments are designed 150bp's or so for multipotential stem cell endogenous gene Oct4, Sox2 and Nanog
Primer, is cDNA according to the total serum IgE and reverse transcription of conventional Trizol methods extraction hiPS cells, is carried out using each primer to design
Amplification, each pair primer respectively make 2~3 repetitions.
Amplification system is as follows：
| 2×SYBR Premix Ex Taq | 10μL |
| Upstream and downstream primer | Each 0.2 μM |
| ROX Reference Dye II | 0.4μL |
| cDNA | 50ng |
| ddH2O | Mend to 20 μ L |
Using two-step method PCR, amplification condition is：95 DEG C of 30s, 95 DEG C of 5s, 60 DEG C of 34s；40cycles.The extension stage collects
Fluorescence signal.
The amplification curve and solubility curve of each pair of primer after amplification are analyzed to obtain Ct values, screen amplification effect respectively
Each 1 pair of the primer of best Oct4, Sox2 and Nanog endogenous gene fluorescence quantitative PCR detection of fruit, primer are：
Oct4-Endo F:GCCTGCCCTTCTAGGAATGG
Oct4-Endo R:ACTTCACCTTCCCTCCAACC
Sox2-Endo F:CATCACCCACAGCAAATGAC
Sox2-Endo R:GAGCGTACCGGGTTTTCTCC
Nanog-Endo F:CCTGAAGACGTGTGAAGATG
Nanog-Endo R:TCGCTGATTAGGCTCCAAC
Wherein, the amplification curve to endogenous Oct4 gene primers and solubility curve are distinguished as depicted in figs. 1 and 2, by Fig. 1
Understand, the amplification curve of repeating hole is substantially overlapping, and Ct values are 16.8.Amplified production all shows neat single in Fig. 2
Peak is dissolved, illustrates that this is good to primer specificity, therefore can be as the fluorogenic quantitative detection of multipotential stem cell endogenous Oct4 genes.
Similarly, screen to obtain effect most by the amplification curve to endogenous Sox2 and Nanog gene and solubility curve
Good primer pair.
2nd, the total gene by fluorescence quantitative PCR detection primers screening of Oct4, Sox2 and Nanog
Primer of the multipair amplified fragments in 150bp or so, peace are designed for versatility total gene Oct4, Sox2 and Nanog
The total serum IgE and reverse transcription for filling people's induced multi-potent stem cell that the extraction of routine Trizol methods is induced by retrovirus are cDNA,
Expanded using each primer to design, each pair primer respectively makees 2~3 repetitions.PCR amplification system and condition are the same as " endogenous more
Energy property gene by fluorescence quantitative PCR detection primers screening ".
The amplification curve and solubility curve of each pair of primer after amplification are analyzed, it is best to screen expanding effect respectively
Each 1 pair of the primer of the total gene by fluorescence quantitative PCR detections of Oct4, Sox2 and Nanog, primer are：
Oct4-Total F:TGGGAGCCCTCACTTCACTG
Oct4-Total R:AACCCTGGCACAAACTCCAG
Sox2-Total F:ATGTCCCAGCACTACCAGAG
Sox2-Total R:GAGCGTACCGGGTTTTCTCC
Nanog-Total F:TGACTTGGAGGCTGCCTTGG
Nanog-Total R:GAGGAAGGATTCAGCCAGTG
3rd, reference gene GAPDH fluorescence quantitative PCR detections primer screening
According to the primer of the people source multipair 200bp of GAPDH sequence designs announced on NCBI or so, screening technique is the same as " endogenous
Versatility gene by fluorescence quantitative PCR detection primers are screened ", obtain 1 pair of optimal primer of effect：
GAPDH F：GCTGAGTACGTCGTGGAGTC
GAPDH R：TGGTGGTGCAGGAGGCATTG
3rd, the detection of hiPS cellular endogenous and external source versatility gene expression
1st, extraction, detection and the reverse transcription of the total serum IgE of hiPS and HFF cells
With no feeder layer CMC model hiPS cells, when cell length to about 80% is converged, IV in 6 porocyte culture plates
Collagenase digesting cell is simultaneously resuspended with complete medium, and supernatant is abandoned after centrifugation, the Trizol of 1ml precoolings is added, after being vigorously mixed
It is stored at room temperature 5min.Add 200 μ L chloroforms fully to mix, stand 5min, 4 DEG C of 12000 × g centrifuge 15min, upper strata aqueous phase is turned
Move on in new centrifuge tube, add isometric isopropanol and overturn mixing, stand 4 DEG C of 12000 × g centrifugation 15min after 10min,
Abandon most supernatant.75% ethanol washs RNA, abandons ethanol after 4 DEG C of 12000 × g centrifugation 5min, after dry RNA with no RNase water by its
Dissolving, Cord blood are spare.The RNA of extracting section is taken to be examined respectively into row agarose gel electrophoresis and ultramicrospectrophotometer
Survey, as shown in Figure 15 electrophoresis occur three bright bands, be respectively 28sRNA, 18sRNA and 5sRNA, and the brightness of 28 s apparently higher than
18s, 5s band are most dark, OD160/OD280 1.93, illustrate that the RNA of extraction is preferable without degraded, purity.
The synthesis of the first chain cDNA is carried out to the RNA of extraction using M-MLV reverse transcriptase, is concretely comprised the following steps：In PCR pipe
Add following components：
| Random primer | 1μL |
| dNTP(10mmol/L) | 1μL |
| Aqua sterilisa | 7μL |
| Template ribonucleic acid | 3μL |
| Cumulative volume | 12μL |
Mix, after 65 DEG C of effect heating 5min, be immediately placed in cooled on ice.Again plus following components：
| 5 × the first chains synthesize buffer solution | 4μL |
| DTT(0.1mol/L) | 2μL |
| RNase inhibitor | 1μL |
Mix and 2min is incubated at 37 DEG C, add 1 μ L M-MLV reverse transcriptases, gently mix, be incubated at 25 DEG C
50min is incubated at 10min, then 37 DEG C.The cDNA of synthesis is directly used in qRT-PCR or -20 DEG C of short-term preservations.
2nd, the Real-Time PCR of Oct4, Sox2 and Nanog endogenous and total gene react
Using the cDNA of synthesis as template, carry out Real-Time PCR detections using the primer of screening and lured by retrovirus
Oct4, Sox2 and Nanog endogenous for the hiPS cells led and the expression quantity of total gene mRNA, so as to draw endogenous and exogenous
The expression quantity of Oct4, Sox2 and Nanog gene mRNA, skin fibroblasts are used as negative control, GAPDH genes using before induction
As endogenous control.The condition established according to primer screening carries out Real-Time PCR reactions, and △ Ct are used after amplification
Method does relative quantification, calculates the relative expression quantity of target gene.
As shown in Figure 16：Compared with HFF, endogenous Oct4-Endo, Sox2-Endo of HFF-derived-iPSCs and
The expression of Nanog-Endo is all effectively raised, the expression of Oct4-Total, Sox2-Total and Nanog-Total
Also corresponding up-regulation, but the expression quantity of its corresponding difference, that is, allogenic gene declines.
The results show, by the identification of the present invention, multipotential stem cell is endogenous and the detection of external source versatility gene expression
Primer sets, kit and detection method can accurately detect multipotency gene Oct4, Sox2 and Nanog endogenous and total mRNA
Expression quantity, so that endogenous and exogenous versatility gene is identified, to judge that induced multi-potent stem cell endogenous multipotency gene swashs
Whether living, allogenic gene silence whether provide one kind and stablize sensitive method.
The specific embodiment of the present invention is described in detail above, but it is intended only as example, and the present invention is not
It is limited to the specific embodiment of description.To those skilled in the art, it is any to the equivalent modifications that carry out of the present invention and to replace
In generation, is also all among scope of the invention.Therefore, the impartial conversion made without departing from the spirit and scope of the invention and repair
Change, all should be contained within the scope of the invention.
Sequence table
<110>Guangdong Chinese mugwort epoch biotechnology Co., Ltd
<120>It is a kind of be used to identifying multipotential stem cell is endogenous and the detection primer group of external source versatility gene expression, kit and
Detection method
<160> 14
<170> SIPOSequenceListing 1.0
<210> 1
<211> 20
<212> DNA
<213>People (human)
<400> 1
gcctgccctt ctaggaatgg 20
<210> 2
<211> 20
<212> DNA
<213>People (human)
<400> 2
acttcacctt ccctccaacc 20
<210> 3
<211> 20
<212> DNA
<213>People (human)
<400> 3
catcacccac agcaaatgac 20
<210> 4
<211> 20
<212> DNA
<213>People (human)
<400> 4
gagcgtaccg ggttttctcc 20
<210> 5
<211> 20
<212> DNA
<213>People (human)
<400> 5
cctgaagacg tgtgaagatg 20
<210> 6
<211> 19
<212> DNA
<213>People (human)
<400> 6
tcgctgatta ggctccaac 19
<210> 7
<211> 20
<212> DNA
<213>People (human)
<400> 7
tgggagccct cacttcactg 20
<210> 8
<211> 20
<212> DNA
<213>People (human)
<400> 8
aaccctggca caaactccag 20
<210> 9
<211> 20
<212> DNA
<213>People (human)
<400> 9
atgtcccagc actaccagag 20
<210> 10
<211> 20
<212> DNA
<213>People (human)
<400> 10
gagcgtaccg ggttttctcc 20
<210> 11
<211> 20
<212> DNA
<213>People (human)
<400> 11
tgacttggag gctgccttgg 20
<210> 12
<211> 20
<212> DNA
<213>People (human)
<400> 12
gaggaaggat tcagccagtg 20
<210> 13
<211> 20
<212> DNA
<213>People (human)
<400> 13
gctgagtacg tcgtggagtc 20
<210> 14
<211> 20
<212> DNA
<213>People (human)
<400> 14
tggtggtgca ggaggcattg 20
Claims (13)
1. a kind of Primer composition and its kit for identifying human pluripotent stem cells versatility gene, it is characterised in that described to draw
Compositions and kit are applied to induced multi-potent stem cell and embryonic stem cell.
A kind of 2. Primer composition of surveyor's induced multi-potent stem cell versatility gene, it is characterised in that the primer combination
Thing includes A primer sets, B primer sets and internal control primer pair.
3. Primer composition according to claim 2, it is characterised in that the A primer sets are done for amplification induced multi-potent
One or more in the primer pair of cellular endogenous genomic dna Oct4, Sox2 and Nanog, the B primer sets be selected from amplification Oct4,
The one or more of the primer pair of the total genes of Sox2 and Nanog, the internal control primer are the primer of amplification GAPDH genes.
4. a kind of be used to identify that induced multi-potent stem cell is endogenous and the kit of external source versatility gene expression, it is characterised in that
The kit includes the Primer composition described in Claims 2 or 3.
5. a kind of be used to identify that induced multi-potent stem cell is endogenous and the method for external source versatility gene expression, it is characterised in that bag
The Primer composition included in the kit described in Primer composition or claim 4 described in usage right requirement 2 or 3 carries out
The step of PCR amplification.
6. according to the method described in claim 5, it is characterised in that it includes following steps：
(1) extracting RNA from sample；
(2) it is cDNA by RNA reverse transcriptions；
(3) Primer composition in the kit described in the Primer composition or claim 4 described in usage right requirement 1 or 2
Carry out PCR amplification；
(4) judged according to amplification.
7. according to the method described in claim 6, it is characterized in that, the method for extraction RNA is using Trizol to split in step (1)
Liquid is solved, chloroform is layered RNA, is precipitated with isopropanol, and then 75% ethanol dissolving removes organic solvent, and re-dry RNA sinks
Form sediment, finally dissolved with RNase-Free water.
8. according to the method described in claim 6, it is characterized in that, the reverse transcriptase used in step (2) is MMLV's or AMV
It is a kind of.
9. according to the method described in claim 6, it is characterized in that, fluorescent quantitative PCR is used in step (3).
10. according to the method described in claim 6, it is characterized in that, step (4) is specially：According to A primer sets and internal control primer
Amplification curve and solubility curve to amplification obtain Ct values, judge the relative expression quantity of multipotential stem cell endogenous multipotency gene；
Ct values, amplification curve and solubility curve further according to B primer sets and internal control primer to amplification, judge the multipotency base of multipotential stem cell
Because of overall relative expression quantity.
11. according to the method described in claim 9, it is characterized in that, the Ct values of multipotential stem cell sample to be detected within 35,
And total gene relative expression quantity of B primer sets amplification is greater than or equal to the endogenous gene relative expression quantity of A primer amplifications, then sentences
The testing result of breaking is errorless.
12. the method according to any one in claim 5~10, it is characterised in that the annealing temperature of Primer composition
For 60 ± 2 DEG C, the amplified production fragment is 150~220bp.
13. the method according to any one in claim 5~10, it is characterised in that using for Primer composition is dense eventually
Spend for 0.1~0.4 μM.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711118485.4A CN107988329A (en) | 2017-11-13 | 2017-11-13 | It is a kind of to be used to identify that multipotential stem cell is endogenous and detection primer group, kit and the detection method of external source versatility gene expression |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711118485.4A CN107988329A (en) | 2017-11-13 | 2017-11-13 | It is a kind of to be used to identify that multipotential stem cell is endogenous and detection primer group, kit and the detection method of external source versatility gene expression |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN107988329A true CN107988329A (en) | 2018-05-04 |
Family
ID=62030291
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201711118485.4A Pending CN107988329A (en) | 2017-11-13 | 2017-11-13 | It is a kind of to be used to identify that multipotential stem cell is endogenous and detection primer group, kit and the detection method of external source versatility gene expression |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107988329A (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108676855A (en) * | 2018-07-24 | 2018-10-19 | 内蒙古赛科星家畜种业与繁育生物技术研究院有限公司 | Calibration curve method quantitative fluorescent PCR identifies the method and primer of ox transgene copy number |
| CN110904232A (en) * | 2019-12-12 | 2020-03-24 | 上海东方肝胆外科医院 | Molecular marker for evaluating curative effect of sorafenib and detection kit thereof |
| CN113234805A (en) * | 2021-06-29 | 2021-08-10 | 杭州原生生物科技有限公司 | Low-cost and high-sensitivity method for in-vitro detection of hESC residues in hESC differentiation source functional cells |
| WO2023116616A1 (en) * | 2021-12-22 | 2023-06-29 | 北京泽辉辰星生物科技有限公司 | Method for testing expression level of pluripotency gene |
-
2017
- 2017-11-13 CN CN201711118485.4A patent/CN107988329A/en active Pending
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108676855A (en) * | 2018-07-24 | 2018-10-19 | 内蒙古赛科星家畜种业与繁育生物技术研究院有限公司 | Calibration curve method quantitative fluorescent PCR identifies the method and primer of ox transgene copy number |
| CN108676855B (en) * | 2018-07-24 | 2021-09-28 | 内蒙古赛科星家畜种业与繁育生物技术研究院有限公司 | Method and primer for identifying bovine transgenic copy number by standard curve fluorescent quantitative PCR (polymerase chain reaction) |
| CN110904232A (en) * | 2019-12-12 | 2020-03-24 | 上海东方肝胆外科医院 | Molecular marker for evaluating curative effect of sorafenib and detection kit thereof |
| CN110904232B (en) * | 2019-12-12 | 2022-05-27 | 上海东方肝胆外科医院 | Molecular marker for evaluating curative effect of sorafenib and detection kit thereof |
| CN113234805A (en) * | 2021-06-29 | 2021-08-10 | 杭州原生生物科技有限公司 | Low-cost and high-sensitivity method for in-vitro detection of hESC residues in hESC differentiation source functional cells |
| WO2023116616A1 (en) * | 2021-12-22 | 2023-06-29 | 北京泽辉辰星生物科技有限公司 | Method for testing expression level of pluripotency gene |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107988329A (en) | It is a kind of to be used to identify that multipotential stem cell is endogenous and detection primer group, kit and the detection method of external source versatility gene expression | |
| CN102925562B (en) | Kit and method for detecting aminoglycoside drug-induced deafness-sensitive gene | |
| CN102154503A (en) | Method for detecting DNA (deoxyribonucleic acid) content of CHO (cholesterol) cells by probe | |
| CN103397105B (en) | Kit for detecting GII type norovirus and applications thereof | |
| CN104561360A (en) | TOP2A gene abnormality detection probe, kit and method | |
| CN111778362A (en) | Novel freeze-dried nucleic acid detection kit and detection method for coronavirus, influenza virus and pneumonia virus | |
| CN102094074A (en) | Fluorescent reverse transcription-polymerase chain reaction (RT-PCR) kit for quantitatively detecting leukemia fusion gene TEL-AML1 | |
| CN104480202A (en) | Towel gourd reference gene and application thereof | |
| CN101363057B (en) | Detection method of miRNA absolute expression level in biological sample | |
| CN107338284B (en) | Human and mouse PDX model related cross contamination detection kit and detection method | |
| CN103820580B (en) | Porcine circovirus 2 type LAMP diagnostic kit | |
| CN107287320A (en) | The LAMP detections of GAPDH genes are combined and kit with primer | |
| CN103276099B (en) | Primer and kit for fluorescent quatititive PCR (polymerase chain reaction) detection of helicobacter pylori | |
| CN103757122B (en) | Based on hsa-miR-188-5p detection kit and the detection method thereof of AllGlo fluorescence probe quantitative PCR | |
| CN103789447B (en) | Method for detecting 5'end tRNA semi-molecules | |
| CN102181567A (en) | Real-time fluorescent quantitative PCR (polymerase chain reaction) kit for detecting candida glabrata | |
| CN103740850B (en) | Based on hsa-miR-9 detection kit and the detection method thereof of AllGlo fluorescence probe quantitative PCR | |
| CN107937616A (en) | Detect the LAMP primer composition thing and its kit and method of PCV3 | |
| CN103740845B (en) | Based on hsa-miR-513b detection kit and the detection method thereof of AllGlo fluorescence probe quantitative PCR | |
| CN103740852B (en) | Based on hsa-miR-137 detection kit and the detection method thereof of AllGlo fluorescence probe quantitative PCR | |
| CN103757121B (en) | Based on hsa-miR-489 detection kit and the detection method thereof of AllGlo fluorescence probe quantitative PCR | |
| CN104962610B (en) | Wilting germ LAMP quick determination methods in state in a kind of corn | |
| CN103740853B (en) | Based on hsa-miR-134 detection kit and the detection method thereof of AllGlo fluorescence probe quantitative PCR | |
| CN103757124B (en) | Based on hsa-miR-629-5p detection kit and the detection method thereof of AllGlo fluorescence probe quantitative PCR | |
| CN104328210B (en) | The primer of the loop-mediated isothermal amplification detection method of AML1/ETO fusion gene and test kit |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20180504 |
|
| RJ01 | Rejection of invention patent application after publication |