CN107974501A - Colorectal cancer prognosis microrna molecule marker and application thereof - Google Patents
Colorectal cancer prognosis microrna molecule marker and application thereof Download PDFInfo
- Publication number
- CN107974501A CN107974501A CN201610911120.6A CN201610911120A CN107974501A CN 107974501 A CN107974501 A CN 107974501A CN 201610911120 A CN201610911120 A CN 201610911120A CN 107974501 A CN107974501 A CN 107974501A
- Authority
- CN
- China
- Prior art keywords
- mir
- sequence
- seq
- colorectal cancer
- primer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/118—Prognosis of disease development
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/178—Oligonucleotides characterized by their use miRNA, siRNA or ncRNA
Abstract
The present invention provides a kind of colorectal cancer prognosis microRNA molecule marker combination, including more than one are selected from following microRNA nucleic acid molecules：MiR 520e, miR 221 5p, miR 339 5p, miR 26a 1 3p, miR 380 5p, miR 452 5p, miR 92a 3p and miR 18a 3p, and its purposes and colorectal cancer Prognosis kit in colorectal cancer Prognosis reagent is prepared.For the content of colorectal cancer prognosis bona patient's microRNA molecule marker in the tissue compared with its poor prognosis patient, there are significant difference, can effectively distinguish colorectal cancer prognosis bona and poor prognosis patient.Using the above-mentioned microRNA molecule marker of the present invention, predict prognosis, there is safety easy to operate, high sensitivity, high specific and the characteristics of be easy to a large amount of examinations.
Description
Technical field
The present invention relates to diagnosis of colorectal carcinoma field, the microRNA of one group of detection colorectal cancer prognosis is related in particular to
Molecular marker combines, it can be applied to colorectal cancer Prognosis.By colorectal cancer Prognosis, it is suitable to formulate in time
Regimen Chemotherapy colorectal cancer and predicted treatment effect, Morbidity control and healing for colorectal cancer are very helpful.It is right
For colorectal cancer patients, the accuracy of increase outcome diagnosis, it may be determined that targetedly control prece, is greatly improved
Its clinical cure rate and long-term surviving rate.It can be applied to tumour patient suspected and make a definite diagnosis the treatment and tracking of patient.
Background technology
MicroRNA (miRNA) is research hotspot in recent years, it be it is a kind of be widely present in it is single-stranded in eucaryote
MicroRNA, does not have an encoding function, but it can be incorporated into the flank region of gene order and check or suppress turning over for said target mrna
Translate, there is conservative, timing and the tissue specificity of height, at present in a variety of diseases such as tumour, blood disease, virus infection
The fields such as clinical diagnosis, treatment and prognostic evaluation have played important function.
Colorectal cancer (colorectal cancer, CRC) is one of most common malignant tumour in global range, seriously
Threaten human health.U.S.'s statistical report in 2012 shows, no matter male or women, the incidence and the death rate of colorectal cancer
The 3rd is occupied, estimated new cases are more than 140,000 within 2012, it is contemplated that death is more than 50,000.In Europe, new hair in 2008
Colorectal cancer case be all new knurls first of swelling more than 430,000, account for 13.6%；Death accounts for all tumours
12.2%, it is second tumour common cause of death to be only second to lung cancer.In China, the morbidity and mortality of colorectal cancer are current
The 4th is occupied, according to Beijing Cancer Bio-Centers data in 2012, the incidence annual growth rate of China's colorectal cancer increased to 5%,
Annual new cases are up to 400,000 people.
The length of colorectal cancer patients life cycle and clinical stages, are closely related, and discovery is more early, and the probability of healing is bigger.
As can early treatment, survival rate is up to 70-95% within 5 years；Intermediate period treatment, five-year survival rate is about 50-60%, but treatment of late stage
5 years survival rate only 5-10%.Therefore early detection and early treatment are most important.Most cancer patients in diseased early stage,
Imperceptible any symptom, otherwise symptom is slight, it is easily ignored；It is obvious to symptom Deng disease progression and have to see a doctor
When, best occasion for the treatment has often been had already passed by, complex treatment need to be taken, medical expense substantially increases, treatment side reaction increase,
And therapeutic effect is poor, survival rate is remarkably decreased within 5 years.
Examination and early diagnosis are one of main methods for improving colorectal cancer patients prognosis.The hair of most of colorectal cancers
Hair tonic exhibition is a multistage, multi-step, multifactor, polygenes participation complex process, is in external environment factor and body
Inherent cause interaction result.
In recent years, the research on colorectal cancer miRNA marker is more, but be concentrated mainly on Colorectal Carcinoma with just
The miRNA differential expressions of normal colorectal carcinoma, it is less to prognosis bona and the research of poor prognosis patient miRNA differential expressions, facing
In bed and research, the microRNA markers that can effectively judge colorectal cancer prognosis need to be found, are particularly used for colorectal cancer
The microRNA markers that prognosis bona is distinguished with poor prognosis.
The content of the invention
One aspect of the present invention provides a kind of colorectal cancer prognosis microRNA molecule marker combination, it includes one
Following microRNA nucleic acid molecules are selected from more than kind：MiR-520e, miR-221-5p, miR-339-5p, miR-26a-1-3p,
MiR-380-5p, miR-452-5p, miR-92a-3p and miR-18a-3p.
Preferably, more than one described are 2-8 kinds, more preferably 3 kinds, 4 kinds, 5 kinds, 6 kinds, 7 kinds or 8 kinds.
The present invention provides one group of new dividing as colorectal cancer prognosis with the relevant microRNA of colorectal cancer prognosis
Sub- marker, is made of one group of microRNA, its sequence is respectively selected from as follows more than one.
| MicroRNA titles | MicroRNA sequences |
| miR-520e | aaagugcuuccuuuuugaggg(SEQ ID NO.:1) |
| miR-221-5p | accuggcauacaauguagauuu(SEQ ID NO.:2) |
| miR-339-5p | ucccuguccuccaggagcucacg(SEQ ID NO.:3) |
| miR-26a-1-3p | ccuauucuugguuacuugcacg(SEQ ID NO.:4) |
| miR-380-5p | ugguugaccauagaacaugcgc(SEQ ID NO.:5) |
| miR-452-5p | aacuguuugcagaggaaacuga(SEQ ID NO.:6) |
| miR-92a-3p | uauugcacuugucccggccugu(SEQ ID NO.:7) |
| miR-18a-3p | acugcccuaagugcuccuucugg(SEQ ID NO.:8) |
In a preferred embodiment, at least one microRNA is at least one target tissue and extremely
Differential expression in a kind of few control tissue.
Preferably, the target tissue comes from colorectal cancer prognosis bona patient, and the control tissue comes from Colon and rectum
Cancer poor prognosis patient.
In more preferred embodiment, expression of at least one microRNA at least one target tissue
Raised compared with the expression at least one control tissue, and/or microRNA therein is at least one target tissue
Expression is lowered compared with the expression at least one control tissue.
Inventor has found that microRNA molecule marker is in colorectal cancer prognosis bona's patient tissue in colorectal cancer patients
In content compare colorectal cancer poor prognosis patient, there are significant difference, can effectively distinguish colorectal cancer prognosis bona and prognosis
Difference, it can be seen that, disease and prognosis of the colorectal cancer prognosis microRNA molecule marker expression level with colorectal cancer
Effect is closely related.
On the basis of above-mentioned discovery, the present invention provides the combination of colorectal cancer prognosis microRNA molecule marker to make
Purposes in the diagnostic reagent of standby colorectal cancer prognosis.
Therefore, the second aspect of the present invention provides a kind of colorectal cancer prognosis microRNA molecule marker combination and is making
Purposes in standby colorectal cancer Prognosis reagent.Preferably, the diagnosis is by colorectal cancer prognosis bona and poor prognosis area
Separate.
Specifically, the diagnostic reagent is by detecting colorectal cancer prognosis microRNA molecule marker in subject's tissue
Content, to diagnose colorectal cancer outcome, wherein, colorectal cancer prognosis microRNA molecule marker is pre- in colorectal cancer
The content in good patient tissue compares colorectal cancer poor prognosis patient afterwards, and there are significant difference, it is preferable that this species diversity can be with
It is that the latter raises than the former otherness or otherness reduces.In a specific embodiment, quantitative PCR is used
Method come detect subject tissue in colorectal cancer prognosis microRNA molecule marker content.
The third aspect of the present invention provides a kind of diagnostic kit, it includes the colorectal cancer prognosis microRNA points
The specific forward primer of sub- marker combination.
Preferably, the specific forward primer is selected from following sequence of primer including more than one：MiR-520e,
MiR-221-5p, miR-339-5p, miR-26a-1-3p, miR-380-5p, miR-452-5p, miR-92a-3p and miR-18a-
3p。
The diagnostic kit still further comprises：
(1) total tissue RNA extracts reagent,
(2) RNA adds polyA reagents,
(3) RT-PCR reagents,
(4) quantitative PCR reagent,
Wherein, quantitative PCR reagent includes the specificity of the colorectal cancer prognosis microRNA molecule marker combination
Forward primer.
Preferably, the total tissue RNA extracts reagent includes the exterior (External of control sequence -1 that sequence is EC-1
Control-1), the RNA adds polyA reagents to include the exterior (External of control sequence -2 that sequence is EC2
Control-2), the RT-PCR reagents include the reverse transcription primer (RT-Primer) that sequence is RT-Primer, the RT-
PCR reagent includes the reverse transcription primer (RT-Primer) that sequence is RT-Primer.
Preferably, it is respectively that the general of UPM-short and UPM-long reversely draws that the quantitative PCR reagent, which includes sequence,
Thing UPM-short and UPM-long.
The fourth aspect of the invention provides the purposes that the diagnostic kit is used for the diagnosis of colorectal cancer prognosis,
Preferably, the purposes is distinguishing the diagnosis of colorectal cancer prognosis bona and poor prognosis.
The specific forward direction that quantitative PCR reagent of the present invention includes colorectal cancer prognosis microRNA molecule marker is drawn
Thing, it is preferable that its sequence is as follows.
| MicroRNA titles | Primer sequence |
| miR-520e | GAAAGTGCTTCTCTTTTGA(SEQ ID NO.:9) |
| miR-221-5p | CCTGGCATACAATGTAGATT(SEQ ID NO.:10) |
| miR-339-5p | TCCCTGTCCTCCAGGAGC(SEQ ID NO.:11) |
| miR-26a-1-3p | CTATTCTTGGTTACTTGCAC(SEQ ID NO.:12) |
| miR-380-5p | GGTTGACCATAGAACATGC(SEQ ID NO.:13) |
| miR-452-5p | CTGTTTGCAGAGGAAACTGA(SEQ ID NO.:14) |
| miR-92a-3p | TGCACTTGTCCCGGC(SEQ ID NO.:15) |
| miR-18a-3p | CTGCCCTAAGTGCTCCTTC(SEQ ID NO.:16) |
In a specific embodiment, it is 5 '-CAACCTCCTA that the total tissue RNA extracts reagent, which includes sequence,
GAAAGAGTA-3’(SEQ ID NO.:17) the External Control-1 of (EC1)；The RNA adds polyA reagents to include
Sequence is 5 '-TGAGCAACGCGAACAA-2 ' (SEQ ID NO.:18) the External Control-2 of (EC2)；The RT-
It is 5 '-CAGTGGTATCAACGCACTCCTTTTTTTTTTTTTTTTTTTTTTTTTT that PCR reagent, which includes sequence,
TTTTVN-3’(SEQ ID NO.:19) (RT-Primer) RT-Primer (wherein, V be A or C or G, N be A or T or C or
G)；It is respectively 5 '-CTCACACGACTCACGACAC-3 ' (SEQ ID NO. that the quantitative PCR reagent, which includes sequence,:20)
(UPM-short) and 5 '-CTCACACGACTCACGACACCAGTGGTATCAACGCACTC-3 ' (SEQ ID NO.:21)(UPM-
Long general reverse primer UPM-short and UPM-long).
There is operation letter using the colorectal cancer prognosis microRNA molecule marker diagnosis colorectal cancer prognosis of the present invention
Single safety, high sensitivity, high specific and the characteristics of be easy to a large amount of examinations.
Brief description of the drawings
Fig. 1 is in colorectal cancer prognosis bona and poor prognosis patient, using Spss mapping softwares, with True Positive Rate (spirit
Sensitivity) be ordinate, false positive rate (1- specificity) be abscissa, drafting ROC (receiver operating
Characteristic) curve, 8 relevant miRNA and miRNA combination as a result, miRNA combination AUC (area under the curve)
Reach 0.733, it is good to illustrate that colorectal cancer prognosis microRNA molecule marker of the invention can effectively distinguish colorectal cancer prognosis
Good and poor prognosis patient.
Embodiment
As described herein, there is microRNA or miRNA its its ordinary meaning in the art (such as to see
CN102943108A).That is, microRNA represents the RNA molecule from genetic site, it is from can form part
The transcript processing of RNA precursor microRNA structures.Ripe microRNA normal lengths are 20,21,22,23,24 or 25
A nucleotide, although the nucleotide of other numbers also may be present, such as 18,19,26,27 or 28 nucleotide.
As described herein, " more than one " represent 2-8 kinds.
As described herein, diagnosis of colorectal carcinoma foundation《Colorectal cancer diagnosis and treatment specification (2015 editions)》, with reference to clinical manifestation,
Laboratory examination, image analysis and pathological examination diagnosis, and carry out TNM stage, need to differentiate with enteritis, polyp etc..
As described herein, according to the DFS phase (Disease-Free Survival, DFS) and Overall survival of 3 years
Patient is divided into 2 groups of prognosis bona and poor prognosis by (Overall survival, OS), and carries out clinical stages, while is recorded swollen
The associated treatment letter such as knurl position, size, organizational hierarchy and therapeutic process and related surgical, chemotherapy, radiotherapy, immune and cell therapy
Breath.
The present invention is by the specific embodiments and the drawings technical solution that the present invention is further explained, but the common skill in this area
Art personnel are understandable that：Detailed description below and embodiment are intended to illustrate the present invention, and should not be construed as to appoint
Where formula limitation is of the invention.
Embodiment 1：Tissue samples are gathered and prepared
During in January, -2016 in January, 2013,150 groups for meeting the patient that above colorectal cancer prognosis bona defines
Knit sample and 150 meet the paraffin tissue sections sample that above colorectal cancer poor prognosis defines, adopted in advance from 301 Hospital
Collection.(the paraffin section sample at least needing 3 40uM)
Mark is carried out to each sample.
The extraction of total serum IgE during embodiment 2. is organized
Using extracting total serum IgE in RNA extracts kits (Beijing Kuang Bo Biotechnology Ltd.) self-organizing, every part
The External Control-1 that 1 μ l (20nM) sequence is 5 '-CAACCTCCTAGAAAGAGTA-3 ' (EC1) are added in tissue
(synthesis of Shanghai Sheng Gong biotechnologies Co., Ltd) monitors the extraction quality of RNA in tissue.The total serum IgE of extraction uses
Thermo NanoDrop 2000c measured concentrations.
MicroRNA in 3. three-step approach quantitative determination tissue of embodiment
(1) polyA tails are added：
I. the reaction solution for adding polyA tails is prepared in the PCR pipe (Axygen companies, 200 μ l) of no RNase, system is 20 μ
l.The External that 1 μ l (20nM) sequence is 5 '-TGAGCAACGCGAACAA-3 ' (EC2) is added in every 20 μ l systems
Control-2 (synthesis of Shanghai Sheng Gong biotechnologies Co., Ltd) monitors the tailing of microRNA and reverse transcription quality.
(note：Enzyme used in this experiment is the product of Beijing Kuang Bo Biotechnology Ltd..)
Ii. by equipped with the PCR pipe for having configured reaction solution be put into PCR instrument (Thermo) 37 DEG C be incubated 1 it is small when.(2)RT-
It is single-stranded that PCR obtains cDNA：
I. it is 5 '-CAGTGGTATCAACGCACTCC that 0.5 μ l (0.5ng/ μ l) sequence is added in the reaction solution obtained to (1)
The RT-Primer of TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN-3 ' (RT-Primer) (gives birth to work bioengineering skill in Shanghai
Art Co., Ltd synthesizes), 70 DEG C of incubation 5min, are put into ice bath at least 2min on ice immediately.
Ii. inverse transcription reaction liquid is prepared：
(note：Product used is the product of Beijing Kuang Bo Biotechnology Ltd..)
Iii. i is mixed with the solution that ii is obtained, 50 DEG C are incubated 70 DEG C of insulation 15min after 50min, put cooled on ice, obtain
To cDNA.
Iv. -20 DEG C of preservations after product packing iii obtained.
(3) qPCR is quantitatively detected：
I. reaction solution is prepared in 2ml EP pipes (Axygen companies)：
(note：UPM-long, UPM-short are synthesized in Invitrogen companies, remaining reagent is all from the spacious rich life in Beijing
Thing technical concern Co., Ltd Green PCR Master Mix。)
Wherein, the sequence of general reverse primer UPM-short and UPM-long is respectively 5 '-CTCACACGACTCACGACA
C-3 ' (UPM-short) and 5 '-CTCACACGACTCACGACACCAGTGGTATCAACGCACTC-3 ' (UPM-long).
Ii. after the fully reverse mixing of the reaction solution configured, it is distributed into 96 hole point bottom PCR plates (Axygen companies), often
18 μ l of hole.
Iii. it is separately added into colorectal cancer prognosis microRNA molecule mark using the volley of rifle fire (Eppendoff companies, 1-10 μ l)
Will thing specific forward primer (synthesis of Invitrogen companies), per 2 μ l of hole (10 μM).
Iv. sealed after adding 10 μ l paraffin oil fluid-tights with special pad pasting (ABI companies).
V. it is put into ABI 7900PCR instruments, program setting is：
Vi. melting curve is drawn, checks the specificity of primer, program setting is：95℃15s,60℃15s,95℃15s.
Embodiment 4：Interpretation of result：
Data analysis is carried out using STATMINER, is standardized using U6 as internal reference.
On RT-PCR method and 2-ΔΔCT methods are shown in (the Analysis of relative such as Kenneth J Livak
gene expression data using real-time quantitative PCR and the 2-ΔΔCT
Method.Methods 25,402-408 (2001), introduce for reference in full herein.
According to embodiment, 150 colorectal cancer prognosis bona patients, 150 colorectal cancer poor prognosis patients have been carried out
The horizontal detection of microRNA molecule marker expression, find the significant difference between colorectal cancer prognosis bona and poor prognosis
MiRNA has 8, the results are shown in Table 1.
Table 1
| Detectable substance | DDCt |
| miR-520e | 0.14266 |
| miR-221-5p | 0.51335 |
| miR-339-5p | 0.41443 |
| miR-26a-1-3p | 0.18954 |
| miR-380-5p | 0.19034 |
| miR-452-5p | 0.35153 |
| miR-92a-3p | 0.53715 |
| miR-18a-3p | 0.50600 |
It is ordinate, false positive rate (1- specificity) for horizontal seat with True Positive Rate (sensitivity) using Spss mapping softwares
Mark, draws ROC (receiver operating characteristic) curve, wherein 8 relevant miRNA and miRNA groups
The result is shown in Figure 1 of conjunction, wherein miRNA combination AUC (area under the curve) reach 0.733, this shows that the colorectal cancer of the present invention is pre-
MicroRNA molecule marker can effectively distinguish colorectal cancer prognosis bona and poor prognosis patient afterwards.
Claims (9)
1. a kind of colorectal cancer prognosis microRNA molecule marker combination, it includes more than one and is selected from following microRNA
Nucleic acid molecules：Sequence is SEQ ID NO.:1 miR-520e, sequence are SEQ ID NO.:2 miR-221-5p, sequence are
SEQ ID NO.:3 miR-339-5p, sequence are SEQ ID NO.:4 miR-26a-1-3p, sequence are SEQ ID NO.:5
MiR-380-5p, sequence is SEQ ID NO.:6 miR-452-5p, sequence are SEQ ID NO.:7 miR-92a-3p and
Sequence is SEQ ID NO.:8 miR-18a-3p, it is preferable that more than one described are 2-8 kinds, more preferably 8 kinds.
2. the colorectal cancer prognosis microRNA molecule marker combination described in claim 1 is preparing colorectal cancer Prognosis
Purposes in reagent.
3. the purposes described in claim 2, wherein, the diagnostic reagent is by detecting the colorectal cancer described in subject's tissue
The content of prognosis microRNA molecule marker, to judge colorectal cancer outcome.
4. the purposes described in Claims 2 or 3, wherein, detect subject's group using the method or other methods of quantitative PCR
The content of colorectal cancer prognosis microRNA molecule marker described in knitting.
A kind of 5. colorectal cancer Prognosis kit, it is characterised in that：Including the colorectal cancer prognosis described in claim 1
The specific forward primer of microRNA molecule marker combination.
6. diagnostic kit according to claim 5, it is characterised in that the specific forward primer include it is a kind of with
It is upper to be selected from following sequence of primer：Sequence is SEQ ID NO.:The primer of 9 miR-520e, sequence are SEQ ID NO.:10
The primer of miR-221-5p, sequence are SEQ ID NO.:The primer of 11 miR-339-5p, sequence are SEQ ID NO.:12
The primer of miR-26a-1-3p, sequence are SEQ ID NO.:The primer of 13 miR-380-5p, sequence are SEQ ID NO.:14
MiR-452-5p primer, sequence is SEQ ID NO.:The primer and sequence of 15 miR-92a-3p is SEQ ID NO.:16
MiR-18a-3p primer, it is preferable that more than one described are 2-8 kinds, more preferably 8 kinds.
7. diagnostic kit according to claim 6, it is still further comprised：
(1) total tissue RNA extracts reagent,
(2) RNA adds polyA reagents,
(3) RT-PCR reagents,
(4) quantitative PCR reagent,
Wherein, quantitative PCR reagent includes the colorectal cancer prognosis microRNA molecule marker combination described in claim 6
Specific forward primer.
8. the diagnostic kit described in claim 7, wherein, it is SEQ ID that the total tissue RNA extracts reagent, which includes sequence,
NO.:17 exterior control sequence -1 (External Control-1), wherein, the RNA adds polyA reagents to include sequence
For SEQ ID NO.:18 exterior control sequence -2 (Exnternal Control-2), wherein, wrapped in the RT-PCR reagents
It is SEQ ID NO. to include sequence:19 reverse transcription primer (RT-Primer).
9. the diagnostic kit described in claim 7, wherein, it is respectively SEQ ID that the quantitative PCR reagent, which includes sequence,
NO.:20 and SEQ ID NO.:21 general reverse primer UPM-short and UPM-long.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610911120.6A CN107974501A (en) | 2016-10-19 | 2016-10-19 | Colorectal cancer prognosis microrna molecule marker and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610911120.6A CN107974501A (en) | 2016-10-19 | 2016-10-19 | Colorectal cancer prognosis microrna molecule marker and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN107974501A true CN107974501A (en) | 2018-05-01 |
Family
ID=62003535
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610911120.6A Pending CN107974501A (en) | 2016-10-19 | 2016-10-19 | Colorectal cancer prognosis microrna molecule marker and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107974501A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109580948A (en) * | 2018-11-30 | 2019-04-05 | 中国科学院上海有机化学研究所 | Application of the combination based on dihydrothymine metabolin in diagnosis of colorectal carcinoma and prognosis prediction |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2014022852A1 (en) * | 2012-08-03 | 2014-02-06 | Aptamir Therapeutics, Inc. | Cell-specific delivery of mirna modulators for the treatment of obesity and related disorders |
| CN104774914A (en) * | 2014-01-09 | 2015-07-15 | 复旦大学附属儿科医院 | Detection and applications of microRNA serum marker of biliary atresia and cholestatic infant hepatitis syndrome |
| CN105177174A (en) * | 2015-11-02 | 2015-12-23 | 赵顺英 | miRNA (microribonucleic acid) biomarkers and detection kit for colon cancer diagnosis |
| WO2016034715A2 (en) * | 2014-09-05 | 2016-03-10 | Prestizia | Method for predicting the development of colorectal cancer |
-
2016
- 2016-10-19 CN CN201610911120.6A patent/CN107974501A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2014022852A1 (en) * | 2012-08-03 | 2014-02-06 | Aptamir Therapeutics, Inc. | Cell-specific delivery of mirna modulators for the treatment of obesity and related disorders |
| CN104774914A (en) * | 2014-01-09 | 2015-07-15 | 复旦大学附属儿科医院 | Detection and applications of microRNA serum marker of biliary atresia and cholestatic infant hepatitis syndrome |
| WO2016034715A2 (en) * | 2014-09-05 | 2016-03-10 | Prestizia | Method for predicting the development of colorectal cancer |
| CN105177174A (en) * | 2015-11-02 | 2015-12-23 | 赵顺英 | miRNA (microribonucleic acid) biomarkers and detection kit for colon cancer diagnosis |
Non-Patent Citations (6)
| Title |
|---|
| CHANG ZHOU等: "MiR-339-5p Regulates the Growth, Colony Formation and Metastasis of Colorectal Cancer Cells by Targeting PRL-1", 《PLOS ONE》 * |
| G ZHENG等: "Serum microRNA panel as biomarkers for early diagnosis of colorectal adenocarcinoma", 《BR J CANCER. 》 * |
| GUANG-HUI LIU等: "Serum miR-21 and miR-92a as biomarkers in the diagnosis and prognosis of colorectal cancer", 《TUMOR BIOLOGY VOLUME》 * |
| 温淑娴: "microRNA-92a-3p 在结直肠癌患者血清中的表达及其临床意义", 《中国优秀硕士学位论文全文数据库》 * |
| 温淑娴等: "结直肠癌患者血清miR-92a-3p表达水平及其临床", 《临床检验杂志》 * |
| 薛亚晶等: "粪便微RNA-141、-17-3p和-92a-3p对结直肠癌诊断及预后判断的价值", 《肿瘤》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109580948A (en) * | 2018-11-30 | 2019-04-05 | 中国科学院上海有机化学研究所 | Application of the combination based on dihydrothymine metabolin in diagnosis of colorectal carcinoma and prognosis prediction |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107034296A (en) | A kind of composition and its application for early stage of lung cancer non-invasive screening | |
| CN108949990A (en) | A kind of kit and method detecting EGFR genetic mutation | |
| Koutova et al. | The impact of standard chemotherapy on miRNA signature in plasma in AML patients | |
| CN107779504A (en) | Colorectal cancer microRNA molecule mark and application thereof | |
| CN106755344A (en) | Molecular marked compound and its application for the diagnosis of cancer of pancreas clinical prognosis | |
| CN108103198A (en) | A kind of and the relevant blood plasma miRNA marker of cancer of pancreas auxiliary diagnosis and its application | |
| CN109897855A (en) | A kind of serum miRNA marker and its application in the cancer of pancreas early diagnosis that pancreatitis mediates | |
| CN107586842A (en) | A kind of biomarker for clear cell carcinoma of kidney diagnosis and treatment | |
| CN110484625A (en) | For detecting primer combination of probe object, kit and the detection method of PRKY gene methylation | |
| CN107574248A (en) | A kind of the non-small cell lung cancer auxiliary diagnosis based on GALNT2 genes, prognostic evaluation kit and its application method | |
| CN108130362A (en) | Kit and application for EGFR genetic mutation detection | |
| CN111808963A (en) | Composition for noninvasive screening of early lung cancer, application and kit and sample processing method | |
| CN107974501A (en) | Colorectal cancer prognosis microrna molecule marker and application thereof | |
| CN109182528A (en) | A kind of glioblastoma auxiliary diagnosis based on ITGB5 gene, prognostic evaluation kit and its application method | |
| CN109852698A (en) | Detect application and the kit of the reagent of 32 expression of ring finger protein | |
| CN109136373A (en) | It is a kind of for early diagnosing the lncRNA detection kit and its application of lung cancer metastasis | |
| CN112226507B (en) | Papillary thyroid carcinoma serum marker and application | |
| CN107858425A (en) | Applications and detection method of the miRNA 4741 as primary hepatic carcinoma diagnosis mark | |
| CN108165546A (en) | A kind of miRNA biomarker, composition and application thereof | |
| Ahmed et al. | Implication of circulating microRNA-21 as a potential non-invasive diagnostic predictor of prostate cancer patients | |
| CN106434968B (en) | Application of the CCDC168 as marker in detection cancer of pancreas reagent | |
| CN111566229A (en) | Breast cancer molecular typing and distant metastasis risk gene group, diagnosis product and application | |
| CN105505934B (en) | The relevant special miRNA of M5 type acute myeloid leukemias and its application | |
| CN110358829A (en) | Detect application and the kit of the reagent of recombined human peptidyl prolyl cis-trans isomerase-H expression | |
| CN109280706A (en) | A kind of circular rna hsa-circ-0102618 and its specificity amplification primer and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20180501 |