CN107937569A - A kind of molecular labeling and its application for stichopus japonicus growth traits assisted selection - Google Patents
A kind of molecular labeling and its application for stichopus japonicus growth traits assisted selection Download PDFInfo
- Publication number
- CN107937569A CN107937569A CN201810039145.0A CN201810039145A CN107937569A CN 107937569 A CN107937569 A CN 107937569A CN 201810039145 A CN201810039145 A CN 201810039145A CN 107937569 A CN107937569 A CN 107937569A
- Authority
- CN
- China
- Prior art keywords
- breeding
- stichopus japonicus
- parent
- molecular labeling
- snp40
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/124—Animal traits, i.e. production traits, including athletic performance or the like
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Abstract
The invention discloses a kind of molecular labeling for stichopus japonicus growth traits assisted selection and its application.Belong to molecular mark field, which marks for SNP40, and the primer pair of the mark is SNP40F:5 ' GGGTGGACTTGGAGCAGAAG 3 ' and SNP40R:5 ' ACCAACGTCCTCTCTGGTTATCA 3 ', the preponderant genotype which is used for growth traits assist-breeding is CC, and the present invention also discloses the step of above-mentioned marker-assisted breeding.The present invention provides effective molecular labeling to grow this economic characters from genetically raising stichopus japonicus, assisted Selection is marked to stichopus japonicus with the genetic marker, carry out hereditary and selection, the speed of growth of juvenile stichopus can be effectively improved, be of great significance to improving culture benefit.
Description
Technical field
The invention belongs to molecular mark field, is used for stichopus japonicus growth traits assisted Selection more particularly to one kind
The molecular labeling of breeding and its application.
Background technology
Stichopus japonicus belongs to Echinodermata Echinodermata, Holothuroidea Holothuroidea, is that northern China is important
One of precious marine product.In recent years, China's apostichopus japonicus culture is able to tremendous development, and scale expands swift and violent, the direct economy output value about 30,000,000,000
Member, is the species of single output value maximum in China's sea-farming industry, is the adjustment and fisherman's employment of inshore fishing economic structure
And increasing both production and income provides important channel.But as the continuous of stichopus japonicus industry size is expanded, germplasm degenerates, is slow-growing, foster
Grow a series of restrictions such as the cycle is long, resist environmental change energy force difference, disease takes place frequently or the potential bottleneck problem for restricting industry development
Also it is increasingly prominent.Genetic improvement is carried out to stichopus japonicus, the new varieties for waiting merit soon with the speed of growth is cultivated, is that stichopus japonicus is supported
Grow the important guarantee of industry sound development.
The fine-variety breeding work of stichopus japonicus relative to other economic aquatic biologicals carry out later, current selection and breeding mode still with
Based on selection and use and crossbreeding, other such as marker assisted selections, genome selection and use core breeding technique are studied still
It is in the junior stage.
With the increase (Sun Guohua etc., 2011) of stichopus japonicus research temperature, stichopus japonicus character related SNP is excavated at present more next
More, Gao etc. (2013) develops 26 relevant SNP sites of defense mechanism with stichopus japonicus；Dong etc. (2016) is to wild
Explained with 51 associated SNP positions have been excavated using HRM in the stichopus japonicus genetic diversity of artificial breeding and the research of population structure
The reason for genetic diversity reduces；Li et al. (2016) has been cloned stichopus japonicus myostain genes and has been found that related to stichopus japonicus dry weight
3 SNP sites；Dong Yu etc. (2016) is found that 10 growth traits are significantly correlated in association analysis of the SNP with growth
Site.But these marks do not carry out the expansion verification and productivity verification of next step, its feasibility and accuracy for applying
Need further to be verified.
In order to develop the stichopus japonicus growth traits related molecular marker that can be used for actual selection and breeding production practices, applicant constructs
Stichopus japonicus high density genetic linkage maps, QTL positioning, selective body are carried out using variance analysis and composite interval mapping to weight character
Weigh QTL sections and may be adapted to the SNP site of design of primers, SNP marker is carried out in widened colony using designed primer
Verification, filters out growth traits related locus and the preponderant genotype in site, and productivity verification has been carried out in Breeding Practice,
The mark and its preponderant genotype available for stichopus japonicus growth traits molecular marker assisted selection breeding are finally obtained.Utilize the mark
Note establishes stichopus japonicus marker assisted selection method, and applies it to stichopus japonicus fine-variety breeding process, cultivates the fast thorn of the speed of growth
Join new varieties, by effective germplasm degenerate problem for solving apostichopus japonicus culture industry and facing at present, and effectively promote apostichopus japonicus culture breeding
Change process.
The content of the invention
The technical problem to be solved in the present invention is to provide a kind of molecule mark for stichopus japonicus growth traits assisted selection
Note and its application, including the preponderant genotype and detection method of molecular labeling primer and mark of correlation, and it is fast to use it for growth
The selection and breeding of stichopus japonicus material.
The present invention is realized by following technical solution：
A kind of molecular labeling for stichopus japonicus growth traits assisted selection, which marks for SNP40, described
SNP40 marks are (CC) for the preponderant genotype of growth traits assist-breeding.
Further, the primer pair of the mark is SNP40F:5 '-GGGTGGACTTGGAGCAGAAG-3 ' and SNP40R:
5’-ACCAACGTCCTCTCTGGTTATCA-3’。
Further, which is with system：DNA profiling 50ng/ μ L1 μ L, 4.5 μ 2 × ES of L Taq
Master Mix, each 0.5 μ L of upstream and downstream primer, 10 μm of ol/L, 3.5 μ L ddH2O；Mark parting be with PCR response procedures：95
DEG C pre-degeneration 5min；94 DEG C of denaturation 30s, 60.5 DEG C of annealing 30s, 72 DEG C of extension 30s, totally 35 circulate；Last 72 DEG C of extensions
7min, 4 DEG C of preservations；Parting is carried out using high-resolution melting curve analysis technology (HRM) method.
Further, carrying out stichopus japonicus growth traits assistant breeding using the mark includes (1) parent DNA extractions and parting；(2)
Juvenile stage；(3) 3 parts of filial generation seed breeding.
Further, the parent DNA extractions described in previous step and parting are from candidate's parent's pipe foot or spine with invasive methods
Pierce and DNA is extracted at tissue, parting is carried out to the genotype of parent's corresponding site with SNP40 marks.
Further, in the Juvenile stage, the advantage parent of selection is in the individual that the loci gene type is (CC).Into
One step, the filial generation seed breeding, is to state the parent selected using step (2) to carry out filial generation seed breeding as parent's breeding population.
The beneficial effect of the present invention compared with prior art：
1st, the present invention for stichopus japonicus growth traits breeding work molecular marking supplementary breeding provide one more efficiently and accurately,
Easy-to-use molecular genetic marker, for the raising stichopus japonicus speed of growth, this important character provides effective molecular marker breeding
Means.Verified in family, expansion development colony and breeding practice at the same time using respective markers and combinations thereof, with this
Assisted Selection is marked to stichopus japonicus growth in mark combination, can effectively alleviate the problems such as speed of growth in actual production is slow,
It is of great significance to improving culture benefit.
2nd, combined using the molecular labeling and carry out molecule selection and breeding, with clearly defined objective, efficiency of selection is high, and Breeding Traits are steady after selection and breeding
It is fixed.
3rd, detection method is easy to operate, and expense is more cheap, and accuracy is high, and can realize that automated proceduresization are examined
Survey, will play a great role in stichopus japonicus breeding for disease resistance.
Brief description of the drawings
Fig. 1 is stichopus japonicus high density genetic linkage maps and weight QTL；
Fig. 2 is the growing state that different genotype parent breeds filial generation seed.
Embodiment
Describe the technology contents of the present invention in detail below by embodiment, but protection scope of the present invention is appointed from embodiment
What formal limitation.
Embodiment 1：The acquisition and its verification in family progeny that the selection and breeding of stichopus japonicus growth traits are marked with genetic molecule
Stichopus japonicus family is built, with 2 parents and 142 sons of the family on behalf of mapping population, is put down by high-flux sequence
Platform, exploitation SLAF marks, the stichopus japonicus high density genetic linkage maps using HighMap software buildings.After high-flux sequence, open altogether
Send out 264,810 SLAF labels, wherein 112,322, the SLAF labels of polymorphism.Depth is sequenced in SLAF labels parental mean
23.67 ×, offspring mean sequencing depth for 5.44 ×.Bioinformatic analysis is crossed in promoting menstruation, can be used for genetic map construction
Label has 50,905, after mass filter, obtains sequencing depth, integrity degree height and no partially separated polymorphism label
4629.By filter out 4629 SLAF labels, make linkage analysis, calculate recombination fraction and MLOD values between label two-by-two,
23 linkage groups are obtained, altogether figure 4 above, 002, be positioned as icon note, upper figure rate 86.45%.In units of linkage group, use
HighMap software analysis obtains the linear array of Marker in linkage group, and estimates the genetic distance between adjacent Marker, builds
Dense genetic map is shown in Fig. 2.Wherein, neutral collection of illustrative plates includes 4002 marks, and total figure is away from for 3223.84cM；Male collection of illustrative plates is total to
Comprising 2228 upper icons notes, total figure is away from for 3864.73cM；Female collection of illustrative plates altogether comprising 2307 upper icons notes, total figure away from for
2075.84cM。
According to the measurement result of 142 filial generation weight, with reference to the collection of illustrative plates and typing data of 23 linkage groups, to weight this
Character carries out quantitative character association analysis.Qtl analysis is carried out using the Internal Mapping methods of software MapQTL5.Knot
Fruit shows, there are 1 and trait-associated regions in LG22 linkage groups, is marked altogether containing 4 SLAF.According to this 4 SLAF marks
The sequencing sequence screening of note can be used for 3 SNP markers of the primer sequence of design SNP amplifications, be located at wherein including
SNP40 sites on marker26440, to the site, the analysis of the Multiple range test of different genotype and weight character is shown in family
Table 1.It can be seen that in offspring individual used in structure family, SNP40 site primers to (CT) and (CC) 2 kinds of genotype are different
There are significant difference, the seed weight of (CC) genotype to be significantly higher than (CT) genotype individuals body for the offspring individual weight of genotype
Weight, the preponderant genotype for showing the site are respectively (CC).
1 SNP40 sites of table Multiple range test of different genotype and weight character in family is analyzed
Embodiment 2：Stichopus japonicus grows verification of the related SNP molecular labeling in colony is expanded
The both sides flanking sequence in the SNP40 sites obtained according to high-flux sequence, design SNP site augmentation detection is with drawing
Thing, corresponding primer sequence are SNP40F:5 '-GGGTGGACTTGGAGCAGAAG-3 ' and SNP40R:5’-
ACCAACGTCCTCTCTGGTTATCA-3’.HRM small fragments method is utilized to this SNP in colony is expanded using corresponding sequence
Point carries out parting and the correlated traits data of combination expansion colony have carried out QTL site verification.Expansion colony used is with a collection of
The 10 monthly age seeds cultivated in secondary extensive nursery and same breeding environment, randomly select 96 individuals, determine the body of individual
Weight.The genotype detection of individual is carried out using HRM methods, the augmentation detection of the mark is with system：1 μ L (50ng/ μ of DNA profiling
L), 4.5 μ L 2 × ES Taq Master Mix, each 0.5 μ L of upstream and downstream primer (10 μm of ol/L), 3.5 μ L ddH2O；PCR reacts
Program：95 DEG C of pre-degeneration 5min；94 DEG C of denaturation 30s, 60.5 DEG C of annealing 30s, 72 DEG C of extension 30s, totally 35 circulate；Last 72 DEG C
Extend 7min, 4 DEG C of preservations；The parting of mark is carried out using high-resolution melting curve analysis technology (HRM) method.To expanding group
Body juvenile stichopus weight character draws with the mark correlation analysis result, the SNP40 and extremely significantly correlated (P of weight character<
0.01)。
2 are shown in Table to the Multiple range test analysis result of the different genotype Yu weight in SNP40 sites this character.It can be seen that
Genotype is substantially less than (CC) type seed for the seed average weight of (CT), and the preponderant genotype for showing the site is respectively
(CC)。
The Multiple range test analysis of different genotype in association character in colony is expanded of 2 SNP40 sites of table
Embodiment 3：Application of the molecular labeling of growth traits assisted selection in stichopus japonicus breeding production
In stichopus japonicus spring nursery stage, 100 parent participations are randomly choosed from the parent participation cultivated, using HRM technologies to 100
Genotype of the parent participation in SNP40 sites carries out parting.Primer sequence used is SNP40F:5’-
GGGTGGACTTGGAGCAGAAG-3 ' and SNP40R:5 '-ACCAACGTCCTCTCTGGTTATCA-3 ', augmentation detection system
For：1 μ L of DNA profiling (50ng/ μ L), 4.5 μ L 2 × ES Taq Master Mix, each 0.5 μ L of upstream and downstream primer (10 μm of ol/
L), 3.5 μ L ddH2O；PCR response procedures：95 DEG C of pre-degeneration 5min；94 DEG C of denaturation 30s, 60.5 DEG C of annealing 30s, 72 DEG C extend
30s, totally 35 circulations；Last 72 DEG C of extensions 7min, 4 DEG C of preservations；The parting of mark uses high-resolution melting curve analysis skill
Art (HRM) method carries out.According to genotyping result, choose genotype shown as in the site (CC) individual 10 (5 female 5 hero) and
(CT) individual 10 (5 female 5 is male) carries out filial generation seed breeding.2 batch seed same period nursery, ensure during seed rearing to support
The uniformity of management and breeding environment is grown, randomly selects seed 500 at 5 monthly age of seed, 6 monthly ages, 7 monthly ages and August age respectively
Head carries out body weight determination, draws the body weight increase curve map of different seeds (see Fig. 2).As seen from Figure 2, it is by genotype
(CC) average weight of the filial generation of parent's breeding during seed rearing is significantly higher than the filial generation seedling bred by (CT) type parent
Kind.The filial generation seed speed of growth that individual of the proof using SNP40 sites as (CC) is bred is faster.
Sequence table
<110>Inst of Huanghai Sea Marine Products, Chinese Academy of Aquatic Product Science
<120>A kind of molecular labeling and its application for stichopus japonicus growth traits assisted selection
<160> 2
<170> SIPOSequenceListing 1.0
<210> 1
<211> 20
<212> DNA
<213>The primer sequence SNP40F (artifical) of engineer
<400> 1
gggtggactt ggagcagaag 20
<210> 2
<211> 23
<212> DNA
<213>The primer sequence SNP40R (artifical) of engineer
<400> 2
accaacgtcc tctctggtta tca 23
Claims (6)
1. a kind of molecular labeling for stichopus japonicus growth traits assisted selection, it is characterised in that the molecular labeling is
SNP40 is marked, and the SNP40 marks are CC for the preponderant genotype of growth traits assist-breeding.
2. molecular labeling according to claim 1, it is characterised in that the primer pair for expanding the molecular labeling is SNP40F:
5 '-GGGTGGACTTGGAGCAGAAG-3 ' and SNP40R:5’-ACCAACGTCCTCTCTGGTTATCA-3’.
3. molecular labeling according to claim 1, it is characterised in that the mark augmentation detection is with system：DNA profiling
50ng/ μ L1 μ L, 4.5 μ L 2 × ES Taq Master Mix, each 0.5 μ L of upstream and downstream primer, 10 μm of ol/L, 3.5 μ L ddH2O；
Mark parting be with PCR response procedures：95 DEG C of pre-degeneration 5min；94 DEG C of denaturation 30s, 60.5 DEG C of annealing 30s, 72 DEG C of extension 30s,
Totally 35 circulations；Last 72 DEG C of extensions 7min, 4 DEG C of preservations；Parting is carried out using high-resolution melting curve analysis technical method.
4. the method for carrying out stichopus japonicus growth traits assistant breeding using mark described in claim 1, step include (1) parent DNA
Extraction and parting；(2) Juvenile stage；(3) 3 parts of filial generation seed breeding；In the Juvenile stage, the advantage parent of selection
For the individual for being CC in SNP40 marker site genotype.
5. according to the method described in claim 4, it is characterized in that described parent DNA extractions and parting be with invasive methods from
DNA is extracted at candidate's parent's pipe foot or quil tissue, the genotype of parent's corresponding site is divided with SNP40 marks
Type.
6. according to the method described in claim 4, it is characterized in that the filial generation seed breeding, is stated with step (2) and selected
Parent carries out filial generation seed breeding for parent's breeding population.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810039145.0A CN107937569B (en) | 2018-01-16 | 2018-01-16 | A kind of molecular labeling and its application for stichopus japonicus growth traits assisted selection |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810039145.0A CN107937569B (en) | 2018-01-16 | 2018-01-16 | A kind of molecular labeling and its application for stichopus japonicus growth traits assisted selection |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN107937569A true CN107937569A (en) | 2018-04-20 |
| CN107937569B CN107937569B (en) | 2018-10-30 |
Family
ID=61937617
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810039145.0A Active CN107937569B (en) | 2018-01-16 | 2018-01-16 | A kind of molecular labeling and its application for stichopus japonicus growth traits assisted selection |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107937569B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113151487A (en) * | 2021-02-09 | 2021-07-23 | 大连海洋大学 | Molecular identification marker primer combination for quantitative character of stichopus japonicus and thorn and application method thereof |
| CN114525362A (en) * | 2022-03-18 | 2022-05-24 | 大连海洋大学 | Primer combination for identifying Anyuan No. 1 stichopus japonicus population and application thereof |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102732624A (en) * | 2012-06-20 | 2012-10-17 | 山东省海洋水产研究所 | Screening method of SRAP labels related to apostichopus japonicus fast-growing characteristics |
| CN102912015A (en) * | 2012-09-25 | 2013-02-06 | 宁波大学 | Molecular marker and method for identifying excellent stichopus japonicus selenka variety |
| CN103088120A (en) * | 2012-11-29 | 2013-05-08 | 北京百迈客生物科技有限公司 | Large-scale genetic typing method based on SLAF-seq (Specific-Locus Amplified Fragment Sequencing) technology |
| CN106834439A (en) * | 2016-12-26 | 2017-06-13 | 中国科学院海洋研究所 | A kind of related molecular labeling of Growth of Litopenaeus vannamei and its application |
-
2018
- 2018-01-16 CN CN201810039145.0A patent/CN107937569B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102732624A (en) * | 2012-06-20 | 2012-10-17 | 山东省海洋水产研究所 | Screening method of SRAP labels related to apostichopus japonicus fast-growing characteristics |
| CN102912015A (en) * | 2012-09-25 | 2013-02-06 | 宁波大学 | Molecular marker and method for identifying excellent stichopus japonicus selenka variety |
| CN103088120A (en) * | 2012-11-29 | 2013-05-08 | 北京百迈客生物科技有限公司 | Large-scale genetic typing method based on SLAF-seq (Specific-Locus Amplified Fragment Sequencing) technology |
| CN106834439A (en) * | 2016-12-26 | 2017-06-13 | 中国科学院海洋研究所 | A kind of related molecular labeling of Growth of Litopenaeus vannamei and its application |
Non-Patent Citations (2)
| Title |
|---|
| ZHANG XJ ET AL.: "The sea cucumber genome provides insights into morphological evolution and visceral regeneration", 《PLOS BIOL》 * |
| 董玉 等: "刺参SNP标记与生长性状的关联分析", 《海洋湖沼通报》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113151487A (en) * | 2021-02-09 | 2021-07-23 | 大连海洋大学 | Molecular identification marker primer combination for quantitative character of stichopus japonicus and thorn and application method thereof |
| CN114525362A (en) * | 2022-03-18 | 2022-05-24 | 大连海洋大学 | Primer combination for identifying Anyuan No. 1 stichopus japonicus population and application thereof |
| CN114525362B (en) * | 2022-03-18 | 2023-05-23 | 大连海洋大学 | Primer combination for identifying Apostichopus japonicus population of Anyuan No. 1 and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN107937569B (en) | 2018-10-30 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105385697B (en) | Sesame inflorescence finite basis is because of Sidt1 and its SNP marker | |
| CN109971865A (en) | It is a kind of to the significant relevant SNP marker of litopenaeus vannamei weight character and application | |
| CN107201404A (en) | A kind of molecular biology identification method and its application for Asparagus dioecian plant sex | |
| CN107988420A (en) | The molecular labeling of corn male nuclear sterile gene ms39 and its application | |
| CN110117673A (en) | The molecular labeling of the short bar character site of cabbage type rape and its application | |
| CN110468218A (en) | A kind of detection method of goat IGF2BP1 gene insertion/deletion label | |
| CN104313155B (en) | One kind support osmanthus type chrysanthemum floral organ trait associations method for screening molecular markers and application | |
| CN109234431A (en) | The molecular labeling of Maize Resistance To Stalk Rot QTL and its application | |
| CN109055580A (en) | Litopenaeus vannamei c-type scavenger receptor is interior and grows related molecular marker and application | |
| CN107937569B (en) | A kind of molecular labeling and its application for stichopus japonicus growth traits assisted selection | |
| CN106498048B (en) | One kind QTL relevant to soybean nodulation number, SNP marker and application | |
| CN104736721B (en) | The molecular labeling and its application method of the low palmitic acid content of sunflower (Helianthus annuus) | |
| CN107937397A (en) | SNP marker and its preparation method and application with tomato male sterility gene close linkage | |
| CN104830849A (en) | Molecular markers of soybean mosaic virus resistant gene (RSC8) and applications thereof | |
| BR112020006195A2 (en) | maize plants with better disease resistance | |
| CN106498063B (en) | Breeding method for directionally improving tobacco black shank resistance through molecular marker-assisted selection | |
| CN108866202A (en) | The detection method and its application of Chinese Cattle PLAG1 gene 19-bp repetition deletion polymorphism | |
| CN113046462A (en) | Molecular marker closely linked with major QTL (quantitative trait locus) of corn ear length, primer and application | |
| CN104762298B (en) | A kind of rice seedling resistant gene of salt qST11 and its molecule labelling method | |
| CN105734057B (en) | With the SSR marker and its application of muskmelon downy mildew resistance main effect QTL linkage | |
| CN110468229A (en) | Rice wide spectrum high resistance to hoja blanca gene Xa45's (t) isolates molecular labeling Hxjy-1 | |
| CN110358861A (en) | R13I14 is marked with rice wide spectrum high resistance to hoja blanca gene Xa45 (t) compact linkage molecule | |
| CN113122653B (en) | Main effect QTL for regulating and controlling brown rice rate of rice, molecular marker and application | |
| CN107937570B (en) | A kind of genetic molecule label and application for fast growing bechedemer breeding | |
| CN105624277B (en) | Method for obtaining molecular marker closely linked with tobacco plant height development character |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |