CN107937560A - A kind of siphonopods mitochondrial COI gene universal primer and design and amplification method - Google Patents

A kind of siphonopods mitochondrial COI gene universal primer and design and amplification method Download PDF

Info

Publication number
CN107937560A
CN107937560A CN201711161134.1A CN201711161134A CN107937560A CN 107937560 A CN107937560 A CN 107937560A CN 201711161134 A CN201711161134 A CN 201711161134A CN 107937560 A CN107937560 A CN 107937560A
Authority
CN
China
Prior art keywords
cuttlefish
siphonopods
octopus
squid
universal primer
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201711161134.1A
Other languages
Chinese (zh)
Inventor
龚理
吕振明
刘立芹
陈永久
杜珣
姜辉
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Zhejiang Ocean University ZJOU
Original Assignee
Zhejiang Ocean University ZJOU
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Zhejiang Ocean University ZJOU filed Critical Zhejiang Ocean University ZJOU
Priority to CN201711161134.1A priority Critical patent/CN107937560A/en
Publication of CN107937560A publication Critical patent/CN107937560A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/686—Polymerase chain reaction [PCR]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The present invention relates to a kind of universal primer and design and amplification method for being capable of a variety of cephalopodous siphonopods mitochondrial COI genes of efficient quick amplification; by the universal primer for designing siphonopods COI genes; a variety of siphonopods COI genes can be disposably expanded in batches; some independent species design specific primer need not be directed to; both time cost is saved; greatly improve work efficiency again; there is efficient quick, important Molecular tools and data accumulation are provided for cephalopodous Identification of Species, phyletic evolution, plasm resource protection and Sustainable Development and Utilization.

Description

A kind of siphonopods mitochondrial COI gene universal primer and design and amplification method
Technical field
The present invention relates to a kind of siphonopods mitochondrial genomes research field, more particularly to one kind being capable of efficient quick amplification The universal primer and design and amplification method of a variety of cephalopodous siphonopods mitochondrial COI genes.
Background technology
Siphonopods is the important monoid of software work(thing door, is widely distributed in world's three big oceans-the Pacific Ocean, the Atlantic Ocean and the Indian Ocean and South Pole marine site, not only has Very high economic value, and occupy critical role in marine ecology.Siphonopods shares 2 subclasses, 11 mesh, 50 sections, 154 Belong to about 718 kinds, since century 70, due to the generally decline of world's traditional economy species resource, be in food chain low side Resources of Cephalopods causes the attention in countries in the world and area.Counted according to FAO, since 2000, Cephalopods In The World yield is about For 310X 104More than, predominantly squid section (Ommastrephidae), Sepiidae (Sepiidae), squid section ( ) and Octopodidae (Octopodidae) Loliginidae.Siphonopods usually has the characteristics that growth is fast, life cycle is short, together When species is various, population structure is also complex.Thus, cephalopodous population structure is studied, for protection, reasonable development cephalopodium Class resource has considerable meaning.
One emerging skill of the species identification that DNA bar code (DNA barcoding) technology is got up as developed recently Art, has received more and more attention.Its principle is usually to utilize one section of short mitochondrial COI (cytochrome c Oxidase subunit I) gene order progress species identification, fish, birds, reptiles, lactation are widely used at present The biological groups such as class, but be not very common in siphonopods., can be once by designing the universal primer of siphonopods COI genes Property batch expand a variety of siphonopods COI genes, it is not necessary to design specific primer for some independent species, both save the time Cost, and greatly improve work efficiency, there is efficient quick.For cephalopodous Identification of Species, phyletic evolution, germplasm Protection of resources and Sustainable Development and Utilization provide important Molecular tools and data accumulation.
Patent Office of the People's Republic of China disclosed a kind of spider mitochondrial genome complete sequence amplimer and expansion on the 29th in September in 2017 The invention mandate of increasing method, authorizes publication number：CN104531688B, the invention are passed through using the STb gene of extraction spider genome Long PCR (L-PCR) amplifications and sequencing of mitochondrial genomes DNA identifies spider have with the present invention and play the same tune on different musical instruments it It is wonderful, but it is only capable of identification spider mitochondrial DNA, it is impossible to identify siphonopods mitochondrial COI gene, and need to design multipair primer pair Genom sequence is expanded, and takes longer inadequate convenience and high-efficiency.
The content of the invention
To solve the above-mentioned method do not identified in the prior art using DNA bar code technology siphonopods, this Invention provide it is a kind of the universal primer of a variety of siphonopods mitochondrial COI genes can be expanded with efficient quick, and provide its design And amplification method.
To achieve the above object, the present invention uses following technical scheme：
A kind of siphonopods mitochondrial COI gene universal primer, the siphonopods mitochondrial COI gene universal primer can be disposable Batch expands a variety of siphonopods COI genes, and forward primer is SEQ ID NO.1：5’-TCHACAAAYCAYAAAGAYATTGG- 3 ', reverse primer is SEQ ID NO.2：5’-TANACTTCTGGGTGNCCAAAAAATCA-3’.
Preferably, the siphonopods includes northwest Pacific squid, fluorescence cuttlefish, Argentinian squid, king's squid, volume shell crow Thief, deep-sea cuttlefish, half monk head cuttlefish, Lai Shi intend cuttlefish, opalescence squid, Sepiella maindroni, maroon octopus, swordtip squid, Symeplectoteuthis oualaniensis, Philippine's Nototodarus sloani, Loligo beka, Chinese squid, Japanese squid, Du Shi squids, You Shi squids, Kobe Squid, tiger spot cuttlefish, hickie cuttlefish, mesh cuttlefish, plan mesh cuttlefish, Piao Shi cuttlefishes, pearl cuttlefish, Sepia andreana, ellipse cuttlefish, thin wrist crow Crafty, long wrist cuttlefish, parrot cuttlefish, straight line leopard line cuttlefish, lobate wrist cuttlefish, crooked needle cuttlefish, golden spot cuttlefish, water chestnut fin cuttlefish, short octopus, Crow after long octopus, true octopus, striped octopus, ovum octopus, eastern octopus, husky octopus, tubule octopus, more hook hook wrist cuttlefishes, Andaman Sea hook wrist cuttlefish and Tu Shi Thief.
A kind of design of siphonopods mitochondrial COI gene universal primer, download is all at present from Genbank databases These sequences are carried out multiple alignment, found out than more conservative region and change by the siphonopods species COI gene orders through announcement Different larger region, and universal primer is designed in two sections of conservative regions, amplify the series of variation of centre, universal primer amplification length Spend for 600~700bp.
A kind of amplification method of siphonopods mitochondrial COI gene universal primer, the siphonopods mitochondrial COI gene are general The amplification method of primer comprises the following steps：（1）DNA extraction agent boxes method extracts siphonopods sample mitochondrial COI gene to be measured； （2）Using the siphonopods mitochondrial COI gene universal primer described in claim 1；（3）With siphonopods mitochondrial COI gene For masterplate, PCR amplification is carried out；（4）Amplified production is tapped and recovered amplified fragments with 1.0% agarose gel electrophoresis, RNA isolation kit, It is sequenced.
Preferably, the step（1）In for avoid siphonopods intestinal contents pollute, cast out its incidence, only from its Extract DNA in tentacle portion.
Preferably, step（3）The reaction system of the PCR amplification forms：DNTP2 μ L, the 10 × TaqDNA of 2.5mM Polymerase Buffer2.5 μ L, 10 μM of forward primer SEQ ID NO.1 and each 1 μ L of reverse primer SEQ ID NO.2,5U/ μ L 17.3 μ L of 0.2 μ L of Taq DNA polymerase, the 1 μ L of DNA masterplates solution of 100g/ μ L and sterilizing distilled water；
The PCR amplification condition is：95 DEG C of pre-degeneration 5min, subsequent 95 DEG C of denaturation 30s, 56 DEG C of annealing 30s, 72 DEG C extend 45s, 35 circulations are carried out altogether, are finally carried out 72 DEG C and are extended 5min, are preserved under the conditions of 4 DEG C.
Preferably, the siphonopods sample to be measured includes northwest Pacific squid, fluorescence cuttlefish, Argentinian squid, king Squid, volume shell cuttlefish, deep-sea cuttlefish, half monk head cuttlefish, Lai Shi intend cuttlefish, opalescence squid, Sepiella maindroni, maroon octopus, sword Sharp squid, Symeplectoteuthis oualaniensis, Philippine's Nototodarus sloani, Loligo beka, Chinese squid, Japanese squid, Du Shi squids, You Shi rifles Cuttlefish, Kobe squid, tiger spot cuttlefish, hickie cuttlefish, mesh cuttlefish, plan mesh cuttlefish, Piao Shi cuttlefishes, pearl cuttlefish, Sepia andreana, ellipse crow Crafty, thin wrist cuttlefish, long wrist cuttlefish, parrot cuttlefish, straight line leopard line cuttlefish, lobate wrist cuttlefish, crooked needle cuttlefish, golden spot cuttlefish, water chestnut fin Cuttlefish, short octopus, long octopus, true octopus, striped octopus, ovum octopus, eastern octopus, husky octopus, tubule octopus, more hook hook wrist cuttlefishes, Andaman Sea hook wrist cuttlefish With cuttlefish after Tu Shi.
The beneficial effects of the invention are as follows：
1）Siphonopods mitochondrial COI gene universal primer provided by the invention, can be disposably efficiently in batches to a variety of siphonopods Expanded, great convenience can be provided for siphonopods species identification；
2）The present invention designs universal primers in two sections of conservative regions of siphonopods mitochondrial COI gene, amplifies the variation sequence of centre Row, in 600-700 bp or so, existing enough informative sites are used for material evidence identification and distinguish amplification length, and can guarantee that a survey Sequence reaction can just be completed, easy to operate, cost-effective.
Brief description of the drawings
Fig. 1 expands different siphonopods mitochondrial COIs for siphonopods mitochondrial COI gene universal primer provided by the present invention The agarose gel electrophoretogram of gene；
Wherein M：DL2000；1：Northwest Pacific squid（Ommastrephes bartramii）；2 fluorescence cuttlefishes （Watasenia scintillans）；3 Argentinian squids（Illex argentinus）；4 king Squid (Architeuthis dux)；The shell cuttlefishes of volume 5（Spirula spirula）；6；Deep-sea cuttlefish（Bathyteuthis abyssicola）；7Half monk head crow Thief（Semirossia patagonica）；8 Lai Shi plans cuttlefish (Sepioteuthis lessoniana)；9 opalescence squids （Doryteuthis opalescens）；10 Sepiella maindronis (Sepiella maindroni)；11 maroon octopus（Octopus conispadiceu）.
Embodiment
The technical solution in the embodiment of the present invention is clearly and completely retouched with reference to the embodiment of the present invention and attached drawing State, it is clear that described embodiment only part of the embodiment of the present invention, rather than whole embodiments.Based on the implementation in the present invention Example, those of ordinary skill in the art's all other embodiments obtained without making creative work, belongs to Protection scope of the present invention.
Embodiment
（1）Collection, identification and the preservation of siphonopods sample
Siphonopods sample used is picked up from the natural environment of field in embodiment, is adopted sample and is taken back laboratory and is stepped on into row information Note, is identified with stereomicroscope, to determine species.The good siphonopods sample of Identification of Species is soaked and protected with 100% absolute alcohol It is stored in spare in 4 DEG C of refrigerator.The siphonopods species gathered includes：Northwest Pacific squid, fluorescence cuttlefish, Argentinian squid, King Squid, volume shell cuttlefish, deep-sea cuttlefish, half monk head cuttlefish, Lai Shi intend cuttlefish, opalescence squid, Sepiella maindroni and maroon Octopus.
（2）The extraction of siphonopods mitochondrial COI gene
Siphonopods sample mitochondrial COI gene to be measured is extracted using DNA extraction agent boxes method, to avoid intestinal contents from polluting, Cast out its incidence, only extract DNA from its tentacle portion.DNA extractions are directly extracted using DNA extraction kit, extraction Mitochondrial COI gene is spare under the conditions of being stored in -20 DEG C.
（3）The design and synthesis of the universal primer of siphonopods mitochondrial COI gene
From Genbank databases download at present all siphonopods species COI gene orders announced, to these sequences into Row multiple alignment, finds out the region more larger than more conservative region and variation, and designs universal primer in two sections of conservative regions, Amplify the series of variation of centre.Synthesized universal primer is：
Shown in forward primer SEQ ID NO.1：5’-TCHACAAAYCAYAAAGAYATTGG-3’
Shown in reverse primer SEQ ID NO.2：5’-TANACTTCTGGGTGNCCAAAAAATCA-3’.
（4）PCR amplification mitochondrial COI gene
The reaction system of PCR amplification forms：DNTP2 μ L of 2.5mM, 10 × Taq DNA polymerase Buffer2.5 μ L, 10 μM Forward primer SEQ ID NO.1 and each 1 μ L of reverse primer SEQ ID NO.2,0.2 μ L of Taq DNA polymerase, the 100g/ μ of 5U/ μ L The 17.3 μ L of 1 μ L of DNA masterplates solution and sterilizing distilled water of L；
PCR amplification condition is：95 DEG C of pre-degeneration 5min, subsequent 95 DEG C of denaturation 30s, 56 DEG C of annealing 30s, 72 DEG C of extension 45s, altogether into 35 circulations of row, finally carry out 72 DEG C and extend 5min, preserved under the conditions of 4 DEG C.
（5）The sequencing of PCR product
1.0% agarose gel electrophoresis of PCR product, gel electrophoresis spectrum is as shown in Figure 1, obtain size in 600~700bp Between fragment, the fragment expanded is tapped and recovered using RNA isolation kit, recovery product is sequenced, sequencing result with The upper homologous sequences of GenBank are compared, it was demonstrated that are the amplified production of siphonopods mitochondrial COI gene.Acquired results are sequenced such as Under：
The sequencing result of North Pacific squid is as shown in SEQ ID NO.3：
5'-TATTTGAGCAGGCCTATTGGGGACTTCTCTAAGCCTAATAATCCGTACTGAACTAGGTCAACCTGGATCC CTTCTGAATGATGATCAACTATACAACGTAGTAGTTACTGCGCACGGTTTTATTATAATTTTCTTTCTAGTTATACC TATTATAATTGGAGGGTTCGGGAATTGACTAGTTCCCTTGATGCTAGGGGCCCCAGATATGGCTTTTCCACGTATAA ACAATATGAGCTTTTGGTTGCTTCCCCCCTCTTTAACTCTATTACTAGCTTCTTCTGCGGTTGAAAGAGGGGCAGGA ACGGGTTGGACAGTATATCCTCCCCTATCTAGCAATCTCTCCCATGCAGGCCCTTCAGTTGACCTAGCTATTTTCTC TCTTCATCTTGCTGGGATTTCCTCCATTCTAGGGGCAATTAACTTCATTACTACTATCTTAAATATACGATGAGAAG GGCTTCAAATGGAGCGACTACCTCTGTTTGCCTGATCTGTATTTATTACTGCCATCCTTTTACTACTATCATTACCT GTTTTGGCCGGGGCTATTACTATGCTATTAACTGACCGGAACTTTAATACCACTTTTTTTGACCCTAGGGGAGGGGG GG-3'；
The sequencing result of fluorescence cuttlefish is as shown in SEQ ID NO.4：
5'-TATTTGATCAGGACTATTAGGCACATCATTAAGCCTAATAATCCGAACCGAACTAGGACAGCCAGGGTCT CTCCTAAATGATGACCAGCTTTACAATGTAGTGGTCACTGCCCATGGATTTATTATAATTTTTTTTATAGTTATACC TATTATAATTGGGGGTTTTGGTAATTGGCTTGTCCCTCTTATGTTAGGAGCCCCTGATATAGCTTTTCCCCGTATAA ACAATATGAGGTTTTGGCTTCTTCCCCCTTCATTGACACTACTATTAGCTTCTTCAGCTGTTGAAAGGGGGGCTGGC ACAGGATGAACTGTCTACCCCCCTCTATCTAGTAACTTATCTCATGCTGGACCTTCTGTGGATTTAGCTATTTTTTC CCTTCATCTGGCAGGAGTCTCTTCTATCCTGGGAGCTATTAACTTTATTACAACAATTCTTAATATACGGTGAGAAG GTCTTCAAATGGAACGACTACCTTTATTTGCTTGATCAGTGTTTATTACCGCTATCCTTCTACTCCTTTCTTTACCT GTACTAGCAGGAGCTATTACTATATTATTAACAGACCGTAACTTTAACACTACATTCTTTGACCCTAGAGGAGGAGG GG-3'；
The sequencing result of Argentinian squid is as shown in SEQ ID NO.5：
5'-TATTTGATCAGGACTATTAGGTACTTCTTTAAGACTAATAATCCGAACTGAATTAGGGCAACCTGGATCA TTACTAAATGATGATCAACTTTACAATGTAGTAGTTACAGCTCATGGATTTATTATAATTTTTTTCATAGTTATACC TATTATAATTGGAGGGTTTGGTAATTGATTAGTACCCCTAATATTAGGAGCCCCAGATATGGCTTTCCCACGTATAA ACAATATAAGATTTTGATTACTTCCACCATCTTTAACTATATTACTAGCTTCTTCAGCAGTAGAAAGAGGGGCCGGT ACAGGTTGAACGGTATATCCTCCTTTATCTAGAAACTTATCTCATGCTGGACCCTCTGTTGATTTAGCTATTTTTTC ATTACACCTTGCAGGTGTCTCTTCTATTCTAGGAGCAATTAATTTTATTACAACTATTATAAATATACGATGGGAAG GTCTCCAAATAGAACGTTTACCTTTATTTGTATGATCTGTATTTATTACTGCTATTTTATTACTATTATCCCTACCT GTTCTAGCTGGAGCTATTACAATATTACTAACAGATCGAAATTTTAATACCACTTTTTTTGATCCTAGAGGTGGAGG AG -3'；
The sequencing result of king's squid is as shown in SEQ ID NO.6：
5'-TATTTGAGCAGGACTTCTAGGAACCTCCTTAAGATTAATAATTCGTACTGAATTAGGACAACCAGGGTCA TTATTAAACGATGACCAACTATATAATGTAGTAGTTACTGCCCATGGTTTCATTATAATTTTCTTCTTAGTTATACC TATTATAATTGGAGGATTTGGTAATTGATTAGTACCCCTAATATTAGGAGCACCCGATATAGCTTTTCCACGAATAA ATAACATAAGATTCTGATTACTACCCCCTTCCTTAACACTACTTCTAGCTTCTTCAGCCGTAGAGAGAGGGGCTGGA ACAGGATGAACAGTTTATCCCCCTTTATCTAGAAATCTCTCCCACGCGGGCCCATCAGTAGACTTAGCCATTTTCTC ACTTCATTTAGCAGGGGTATCTTCCATTTTAGGAGCCATTAACTTTATTACAACAATCTTAAATATACGATGAGAAG GTCTACAAATAGAACGTTTACCTCTATTTGCCTGATCCGTATTTATTACCGCAATCCTACTACTCCTATCCTTACCT GTACTAGCAGGGGCTATTACAATATTACTAACTGACCGAAACTTTAATACTACTTTTTTTGACCCAAGGGGAGGTGG AG -3'；
The sequencing result of shell cuttlefish is rolled up as shown in SEQ ID NO.7：
5'-AATTTGAGCAGGATTACTAGGTACTTCCTTAAGCTTAATAATCCGAACTGAGTTAGGACAACCAGGATCA CTATTAAATGATGATCAATTATATAATGTAGTAGTTACCGCCCACGGATTTATTATAATTTTTTTTTTGGTTATACC TATTATAATTGGGGGGTTTGGAAACTGATTAGTACCTTTAATACTAGGAGCCCCAGATATAGCCTTCCCACGAATAA ATAATATAAGATTTTGACTACTACCTCCTTCTCTTACTTTACTACTAATATCTGCAGCTGTTGAAAGAGGGGCTGGA ACAGGTTGAACAGTATACCCACCCTTATCTAGAAATATTTCCCACGCAGGTCCCTCAGTTGATTTAGCCATTTTCTC CCTTCACTTAGCAGGGGTATCTTCTATTTTAGGAGCAATTAACTTCATCACTACAACTTTAAATATACGCTGAGGAG GGCTACAAATAGAACGAGTACCACTTTTTGTTTGATCAGTATTTATTACTGCTATTTTATTACTTCTATCACTTCCA GTTTTAGCAGGAGCAATTACTATACTATTAACAGACCGAAATTTTAATACCACCTTTTTTGACCCAAGGGGGGGAGG GG-3'；
The sequencing result of deep-sea cuttlefish is as shown in SEQ ID NO.8：
5'-TATTTGAGCAGGATTACTAGGTACTTCTTTAAGATTAATAATCCGAACGGAATTAGGACAACCTGGTTCC TTACTAAATGATGATCAACTCTATAATGTAGTTGTTACTGCCCATGGATTTATTATAATTTTCTTTTTAGTAATACC AATTATAATTGGAGGATTTGGTAACTGATTAGTCCCTTTAATATTAGGAGCCCCAGATATAGCATTCCCTCGAATAA ATAATATAAGATTTTGATTGCTTCCTCCTTCATTAACTTTGCTTTTAGCTTCTTCAGCTGTAGAAAGAGGAGCAGGG ACAGGCTGAACAGTATACCCTCCTTTATCTAGAAATTTATCCCACGCAGGACCTTCAGTAGACCTAGCCATTTTTTC CCTTCATCTAGCTGGAGTTTCTTCTATTTTAGGAGCAATTAATTTTATTACAACAATTTTAAATATACGATGAGAAG GGCTACAAATAGAACGACTACCCCTCTTTGCTTGATCAGTTTTTATTACTGCAATTCTACTACTACTTTCCCTTCCC GTTCTAGCTGGAGCAATTACTATGCTATTAACTGATCGAAACTTTAATACTACTTTTTTTGATCCTAGAGGAGGAGG AG-3'；
The sequencing result of half monk head cuttlefish is as shown in SEQ ID NO.9：
5'-TATTTGATCAGGATTACTTGGTACTTCACTAAGTTTAATAATTCGTACTGAATTAGCTAAACCAGGATCA TTATTAAATGACGATCAATTATATAACGTAGTAGTTACCGCACACGGGTTCGTTATAATTTTTTTTCTAGTTATACC TATTATAATTGGAGGTTTCGGTAATTGATTAGTACCCTTAATACTAGGAGCCCCTGATATAGCATTCCCACGAATAA ATAATATAAGATTTTGATTACTTCCTCCTTCCTTAACCCTATTATTAGCTTCATCAGCCGTAGAAAGAGGTGCAGGA ACAGGCTGAACTGTATACCCTCCCTTATCTAGAAATATTTCACATGCAGGACCATCAGTTGACTTAGCCATTTTTTC TCTTCATTTAGCTGGAGTATCTTCAATCCTAGGGGCTATCAATTTTATCACAACAATTCTTAATATACGATGAGAAG GTTTACAAATAGAACGTTTACCTTTATTTGTCTGATCAGTTTTTATTACTGCTATTCTATTACTTTTATCCCTTCCT GTTTTAGCCGGAGCAATTACAATACTATTAACTGATCGAAATTTTAATACAACTTTCTTTGATCCAAGAGGAGGAGG AG-3'；
Lai Shi intends the sequencing result of cuttlefish as shown in SEQ ID NO.10：
5'-TATTTGAGCAGGATTAGTTGGTACTTCATTAAGTCTAATAATTCGAACCGAATTAGGTAAACCTGGTTCG TTATTAAATGATGACCAATTATATAATGTTGTAGTTACTGCACACGGTTTTATTATAATTTTCTTTATAGTAATACC TATCATGATTGGGGGTTTTGGTAACTGGCTTGTTCCTCTTATATTAGGAGCACCTGATATGGCATTCCCGCGAATAA ATAATATAAGATTCTGATTGTTACCTCCATCCCTCACACTCCTTTTAGCATCTTCAGCAGTTGAAAGAGGAGCAGGG ACAGGCTGGACAGTCTACCCCCCTCTTTCAAGTAACTTATCCCATGCTGGACCTTCAGTTGATCTTGCTATTTTCTC ACTCCATCTAGCTGGTATCTCTTCCATTTTAGGTGCAATTAATTTTATTACAACTATTATTAACATACGATGAGAAG GTTTGCTTATGGAACGTTTACCCTTATTTGCCTGATCTGTCTTTATTACTGCTATTTTACTTCTTCTCTCATTACCT GTCCTAGCAGGTGCTATTACAATACTACTTACAGATCGAAACTTCAATACTACCTTTTTTGATCCAAGAGGCGGAGG AG-3'；
The sequencing result of opalescence squid is as shown in SEQ ID NO.11：
5'-TATTTGAGCAGGGCTAGTAGGTACATCATTAAGATTGATAATCCGTACAGAGTTAGGGAAACCTGGCTCC TTATTAAATGATGATCAATTATACAATGTAGTAGTTACTGCACATGGTTTCATTATAATTTTTTTTATAGTTATACC TATTATAATTGGAGGATTTGGTAATTGACTAGTACCTTTAATATTAGGTGCTCCAGACATAGCCTTTCCTCGAATAA ACAACATAAGATTTTGACTATTACCACCTTCACTCACTCTTCTTTTAGCATCCTCGGCTGTTGAAAGCGGAGCCGGA ACAGGTTGAACAGTCTACCCACCCCTATCTAGAAATCTCTCTCATGCTGGTCCTTCAGTAGACCTCGCCATTTTCTC ACTTCACTTAGCAGGTATCTCCTCTATTTTAGGGGCTATTAACTTTATCACAACTATTATAAATATACGATGAGAAG GTCTATTAATGGAACGACTCTCTTTATTTATCTGATCAGTATTTATTACTGCTATCCTATTACTACTATCCCTTCCA GTTCTAGCAGGTGCTATTACAATACTTTTATCTGACCGAAATTTTAATACTACTTTCTTTGACCCTAGTGGAGGAGG AG-3'；
The sequencing result of Sepiella maindroni is as shown in SEQ ID NO.12：
5'-TATTTGATCAGGTTTATTAGGTACTTCATTAAGTTTAATAATTCGAAGAGAATTAGGAAAACCAGGTACT CTATTAAATGATGATCAATTATATAATGTTGTAGTAACCGCCCACGGTTTTATCATAATTTTCTTTTTAGTTATACC TATTATAATTGGAGGTTTTGGTAATTGGTTAGTTCCCTTAATATTAGGGGCACCAGACATAGCCTTCCCTCGAATAA ATAATATAAGTTTTTGGTTATTACCTCCATCTTTAACTCTTTTATTATCATCCTCAGCTGTAGAAAGAGGTGCTGGA ACTGGATGAACAGTATATCCTCCCTTATCTAGTAATCTATCTCATGCTGGCCCATCTGTAGATTTAGCTATTTTTTC TTTACATTTAGCTGGTGTTTCCTCAATCTTAGGTGCTATTAATTTTATTACAACTATTTTAAATATACGGTGAGAGG GTTTACAAATAGAACGACTTCCTTTATTTGTTTGATCCGTATTTATTACAGCTATTTTACTACTATTATCCTTACCA GTTTTAGCTGGAGCCATTACTATATTATTAACCGATCGAAATTTTAATACAACATTTTTTGATCCTAGAGGAGGAGG TG-3'；
The sequencing result of maroon octopus is as shown in SEQ ID NO.13：
5'-AATTTGATCAGGTTTACTAGGTACATCATTAAGATTAATAATTCGAACAGAACTAGGACAACCTGGATCT TTACTAAATGATGATCAACTTTATAACGTTATTGTTACTGCCCACGCTTTTGTAATAATTTTCTTTTTAGTTATACC CGTAATAATTGGAGGATTTGGAAACTGATTAGTCCCTTTAATATTAGGAGCTCCAGATATAGCATTCCCACGAATAA ACAATATAAGATTTTGGTTACTTCCCCCCTCTTTAACTCTCCTATTAACTTCAGCAGCAGTAGAAAGAGGAGCAGGA ACAGGTTGAACTGTATACCCTCCATTATCTAGAAATTTAGCCCATATAGGTCCTTCTGTAGATCTAGCAATTTTTTC CCTTCATTTAGCAGGTATTTCCTCTATTTTAGGAGCTATTAATTTCATCACAACTATTATTAATATACGATGAGAAG GGATACAAATAGAACGTCTTCCACTATTTGTATGATCTGTTCTAATTACAGCAGTTCTTCTTCTACTATCTTTACCA GTATTAGCAGGTGCCATTACTATACTTCTTACTGATCGTAACTTCAATACAACTTTTTTTGACCCAAGAGGAGGAGG AG-3'。
Sequence table
<110>Zhejiang Ocean university
<120>The universal primer and design and amplification method of a kind of siphonopods mitochondrial COI gene
<160> 13
<170> SIPOSequenceListing 1.0
<210> 1
<211> 23
<212> DNA
<213>Universal primer (consensus primer)
<400> 1
tchacaaayc ayaaagayat tgg 23
<210> 2
<211> 26
<212> DNA
<213>Universal primer (consensus primer)
<400> 2
tanacttctg ggtgnccaaa aaatca 26
<210> 3
<211> 611
<212> DNA
<213>The sequencing result (Ommastrephes bartramii sequencing results) of North Pacific squid
<400> 3
tatttgagca ggcctattgg ggacttctct aagcctaata atccgtactg aactaggtca 60
acctggatcc cttctgaatg atgatcaact atacaacgta gtagttactg cgcacggttt 120
tattataatt ttctttctag ttatacctat tataattgga gggttcggga attgactagt 180
tcccttgatg ctaggggccc cagatatggc ttttccacgt ataaacaata tgagcttttg 240
gttgcttccc ccctctttaa ctctattact agcttcttct gcggttgaaa gaggggcagg 300
aacgggttgg acagtatatc ctcccctatc tagcaatctc tcccatgcag gcccttcagt 360
tgacctagct attttctctc ttcatcttgc tgggatttcc tccattctag gggcaattaa 420
cttcattact actatcttaa atatacgatg agaagggctt caaatggagc gactacctct 480
gtttgcctga tctgtattta ttactgccat ccttttacta ctatcattac ctgttttggc 540
cggggctatt actatgctat taactgaccg gaactttaat accacttttt ttgaccctag 600
gggagggggg g 611
<210> 4
<211> 611
<212> DNA
<213>The sequencing result (Watasenia scintillans sequencing results) of fluorescence cuttlefish
<400> 4
tatttgatca ggactattag gcacatcatt aagcctaata atccgaaccg aactaggaca 60
gccagggtct ctcctaaatg atgaccagct ttacaatgta gtggtcactg cccatggatt 120
tattataatt ttttttatag ttatacctat tataattggg ggttttggta attggcttgt 180
ccctcttatg ttaggagccc ctgatatagc ttttccccgt ataaacaata tgaggttttg 240
gcttcttccc ccttcattga cactactatt agcttcttca gctgttgaaa ggggggctgg 300
cacaggatga actgtctacc cccctctatc tagtaactta tctcatgctg gaccttctgt 360
ggatttagct attttttccc ttcatctggc aggagtctct tctatcctgg gagctattaa 420
ctttattaca acaattctta atatacggtg agaaggtctt caaatggaac gactaccttt 480
atttgcttga tcagtgttta ttaccgctat ccttctactc ctttctttac ctgtactagc 540
aggagctatt actatattat taacagaccg taactttaac actacattct ttgaccctag 600
aggaggaggg g 611
<210> 5
<211> 611
<212> DNA
<213>The sequencing result (Illex argentinus sequencing results) of Argentinian squid
<400> 5
tatttgatca ggactattag gtacttcttt aagactaata atccgaactg aattagggca 60
acctggatca ttactaaatg atgatcaact ttacaatgta gtagttacag ctcatggatt 120
tattataatt tttttcatag ttatacctat tataattgga gggtttggta attgattagt 180
acccctaata ttaggagccc cagatatggc tttcccacgt ataaacaata taagattttg 240
attacttcca ccatctttaa ctatattact agcttcttca gcagtagaaa gaggggccgg 300
tacaggttga acggtatatc ctcctttatc tagaaactta tctcatgctg gaccctctgt 360
tgatttagct attttttcat tacaccttgc aggtgtctct tctattctag gagcaattaa 420
ttttattaca actattataa atatacgatg ggaaggtctc caaatagaac gtttaccttt 480
atttgtatga tctgtattta ttactgctat tttattacta ttatccctac ctgttctagc 540
tggagctatt acaatattac taacagatcg aaattttaat accacttttt ttgatcctag 600
aggtggagga g 611
<210> 6
<211> 611
<212> DNA
<213>The sequencing result (Architeuthis dux sequencing results) of king's squid
<400> 6
tatttgagca ggacttctag gaacctcctt aagattaata attcgtactg aattaggaca 60
accagggtca ttattaaacg atgaccaact atataatgta gtagttactg cccatggttt 120
cattataatt ttcttcttag ttatacctat tataattgga ggatttggta attgattagt 180
acccctaata ttaggagcac ccgatatagc ttttccacga ataaataaca taagattctg 240
attactaccc ccttccttaa cactacttct agcttcttca gccgtagaga gaggggctgg 300
aacaggatga acagtttatc cccctttatc tagaaatctc tcccacgcgg gcccatcagt 360
agacttagcc attttctcac ttcatttagc aggggtatct tccattttag gagccattaa 420
ctttattaca acaatcttaa atatacgatg agaaggtcta caaatagaac gtttacctct 480
atttgcctga tccgtattta ttaccgcaat cctactactc ctatccttac ctgtactagc 540
aggggctatt acaatattac taactgaccg aaactttaat actacttttt ttgacccaag 600
gggaggtgga g 611
<210> 7
<211> 611
<212> DNA
<213>Roll up the sequencing result (Spirula spirula sequencing results) of shell cuttlefish
<400> 7
aatttgagca ggattactag gtacttcctt aagcttaata atccgaactg agttaggaca 60
accaggatca ctattaaatg atgatcaatt atataatgta gtagttaccg cccacggatt 120
tattataatt ttttttttgg ttatacctat tataattggg gggtttggaa actgattagt 180
acctttaata ctaggagccc cagatatagc cttcccacga ataaataata taagattttg 240
actactacct ccttctctta ctttactact aatatctgca gctgttgaaa gaggggctgg 300
aacaggttga acagtatacc cacccttatc tagaaatatt tcccacgcag gtccctcagt 360
tgatttagcc attttctccc ttcacttagc aggggtatct tctattttag gagcaattaa 420
cttcatcact acaactttaa atatacgctg aggagggcta caaatagaac gagtaccact 480
ttttgtttga tcagtattta ttactgctat tttattactt ctatcacttc cagttttagc 540
aggagcaatt actatactat taacagaccg aaattttaat accacctttt ttgacccaag 600
ggggggaggg g 611
<210> 8
<211> 611
<212> DNA
<213>The sequencing result (Bathyteuthis abyssicola sequencing results) of deep-sea cuttlefish
<400> 8
tatttgagca ggattactag gtacttcttt aagattaata atccgaacgg aattaggaca 60
acctggttcc ttactaaatg atgatcaact ctataatgta gttgttactg cccatggatt 120
tattataatt ttctttttag taataccaat tataattgga ggatttggta actgattagt 180
ccctttaata ttaggagccc cagatatagc attccctcga ataaataata taagattttg 240
attgcttcct ccttcattaa ctttgctttt agcttcttca gctgtagaaa gaggagcagg 300
gacaggctga acagtatacc ctcctttatc tagaaattta tcccacgcag gaccttcagt 360
agacctagcc attttttccc ttcatctagc tggagtttct tctattttag gagcaattaa 420
ttttattaca acaattttaa atatacgatg agaagggcta caaatagaac gactacccct 480
ctttgcttga tcagttttta ttactgcaat tctactacta ctttcccttc ccgttctagc 540
tggagcaatt actatgctat taactgatcg aaactttaat actacttttt ttgatcctag 600
aggaggagga g 611
<210> 9
<211> 611
<212> DNA
<213>The sequencing result (Semirossia patagonica sequencing results) of half monk head cuttlefish
<400> 9
tatttgatca ggattacttg gtacttcact aagtttaata attcgtactg aattagctaa 60
accaggatca ttattaaatg acgatcaatt atataacgta gtagttaccg cacacgggtt 120
cgttataatt ttttttctag ttatacctat tataattgga ggtttcggta attgattagt 180
acccttaata ctaggagccc ctgatatagc attcccacga ataaataata taagattttg 240
attacttcct ccttccttaa ccctattatt agcttcatca gccgtagaaa gaggtgcagg 300
aacaggctga actgtatacc ctcccttatc tagaaatatt tcacatgcag gaccatcagt 360
tgacttagcc attttttctc ttcatttagc tggagtatct tcaatcctag gggctatcaa 420
ttttatcaca acaattctta atatacgatg agaaggttta caaatagaac gtttaccttt 480
atttgtctga tcagttttta ttactgctat tctattactt ttatcccttc ctgttttagc 540
cggagcaatt acaatactat taactgatcg aaattttaat acaactttct ttgatccaag 600
aggaggagga g 611
<210> 10
<211> 611
<212> DNA
<213>Lai Shi intends the sequencing result (Sepioteuthis lessoniana sequencing results) of cuttlefish
<400> 10
tatttgagca ggattagttg gtacttcatt aagtctaata attcgaaccg aattaggtaa 60
acctggttcg ttattaaatg atgaccaatt atataatgtt gtagttactg cacacggttt 120
tattataatt ttctttatag taatacctat catgattggg ggttttggta actggcttgt 180
tcctcttata ttaggagcac ctgatatggc attcccgcga ataaataata taagattctg 240
attgttacct ccatccctca cactcctttt agcatcttca gcagttgaaa gaggagcagg 300
gacaggctgg acagtctacc cccctctttc aagtaactta tcccatgctg gaccttcagt 360
tgatcttgct attttctcac tccatctagc tggtatctct tccattttag gtgcaattaa 420
ttttattaca actattatta acatacgatg agaaggtttg cttatggaac gtttaccctt 480
atttgcctga tctgtcttta ttactgctat tttacttctt ctctcattac ctgtcctagc 540
aggtgctatt acaatactac ttacagatcg aaacttcaat actacctttt ttgatccaag 600
aggcggagga g 611
<210> 11
<211> 611
<212> DNA
<213>The sequencing result (Doryteuthis opalescens sequencing results) of opalescence squid
<400> 11
tatttgagca gggctagtag gtacatcatt aagattgata atccgtacag agttagggaa 60
acctggctcc ttattaaatg atgatcaatt atacaatgta gtagttactg cacatggttt 120
cattataatt ttttttatag ttatacctat tataattgga ggatttggta attgactagt 180
acctttaata ttaggtgctc cagacatagc ctttcctcga ataaacaaca taagattttg 240
actattacca ccttcactca ctcttctttt agcatcctcg gctgttgaaa gcggagccgg 300
aacaggttga acagtctacc cacccctatc tagaaatctc tctcatgctg gtccttcagt 360
agacctcgcc attttctcac ttcacttagc aggtatctcc tctattttag gggctattaa 420
ctttatcaca actattataa atatacgatg agaaggtcta ttaatggaac gactctcttt 480
atttatctga tcagtattta ttactgctat cctattacta ctatcccttc cagttctagc 540
aggtgctatt acaatacttt tatctgaccg aaattttaat actactttct ttgaccctag 600
tggaggagga g 611
<210> 12
<211> 611
<212> DNA
<213>The sequencing result (Sepiella maindroni sequencing results) of Sepiella maindroni
<400> 12
tatttgatca ggtttattag gtacttcatt aagtttaata attcgaagag aattaggaaa 60
accaggtact ctattaaatg atgatcaatt atataatgtt gtagtaaccg cccacggttt 120
tatcataatt ttctttttag ttatacctat tataattgga ggttttggta attggttagt 180
tcccttaata ttaggggcac cagacatagc cttccctcga ataaataata taagtttttg 240
gttattacct ccatctttaa ctcttttatt atcatcctca gctgtagaaa gaggtgctgg 300
aactggatga acagtatatc ctcccttatc tagtaatcta tctcatgctg gcccatctgt 360
agatttagct attttttctt tacatttagc tggtgtttcc tcaatcttag gtgctattaa 420
ttttattaca actattttaa atatacggtg agagggttta caaatagaac gacttccttt 480
atttgtttga tccgtattta ttacagctat tttactacta ttatccttac cagttttagc 540
tggagccatt actatattat taaccgatcg aaattttaat acaacatttt ttgatcctag 600
aggaggaggt g 611
<210> 13
<211> 611
<212> DNA
<213>The sequencing result (Octopus conispadiceu sequencing results) of maroon octopus
<400> 13
aatttgatca ggtttactag gtacatcatt aagattaata attcgaacag aactaggaca 60
acctggatct ttactaaatg atgatcaact ttataacgtt attgttactg cccacgcttt 120
tgtaataatt ttctttttag ttatacccgt aataattgga ggatttggaa actgattagt 180
ccctttaata ttaggagctc cagatatagc attcccacga ataaacaata taagattttg 240
gttacttccc ccctctttaa ctctcctatt aacttcagca gcagtagaaa gaggagcagg 300
aacaggttga actgtatacc ctccattatc tagaaattta gcccatatag gtccttctgt 360
agatctagca attttttccc ttcatttagc aggtatttcc tctattttag gagctattaa 420
tttcatcaca actattatta atatacgatg agaagggata caaatagaac gtcttccact 480
atttgtatga tctgttctaa ttacagcagt tcttcttcta ctatctttac cagtattagc 540
aggtgccatt actatacttc ttactgatcg taacttcaat acaacttttt ttgacccaag 600
aggaggagga g 611

Claims (7)

1. a kind of siphonopods mitochondrial COI gene universal primer, it is characterised in that the siphonopods mitochondrial COI gene is general Primer can disposably expand a variety of siphonopods COI genes in batches, and forward primer is SEQ ID NO.1：5’- TCHACAAAYCAYAAAGAYATTGG-3 ', reverse primer are SEQ ID NO.2：5’- TANACTTCTGGGTGNCCAAAAAATCA-3’。
A kind of 2. siphonopods mitochondrial COI gene universal primer according to claim 1, it is characterised in that the cephalopodium Class includes northwest Pacific squid, fluorescence cuttlefish, Argentinian squid, king's squid, volume shell cuttlefish, deep-sea cuttlefish, half monk head cuttlefish, Lay Family name intends cuttlefish, opalescence squid, Sepiella maindroni, maroon octopus, swordtip squid, Symeplectoteuthis oualaniensis, Philippine's Nototodarus sloani, firelock crow Thief, Chinese squid, Japanese squid, Du Shi squids, You Shi squids, Kobe squid, tiger spot cuttlefish, hickie cuttlefish, Mesh cuttlefish, intend mesh cuttlefish, Piao Shi cuttlefishes, pearl cuttlefish, Sepia andreana, ellipse cuttlefish, thin wrist cuttlefish, long wrist cuttlefish, parrot cuttlefish, straight line Leopard line cuttlefish, lobate wrist cuttlefish, crooked needle cuttlefish, golden spot cuttlefish, water chestnut fin cuttlefish, short octopus, long octopus, true octopus, striped octopus, ovum octopus, east Cuttlefish after octopus, husky octopus, tubule octopus, more hook hook wrist cuttlefishes, Andaman Sea hook wrist cuttlefish and Tu Shi.
A kind of 3. design of siphonopods mitochondrial COI gene universal primer as claimed in claim 1, it is characterised in that from All siphonopods species COI gene orders announced at present are downloaded in Genbank databases, these sequences are carried out multiple Compare, find out the region more larger than more conservative region and variation, and universal primer is designed in two sections of conservative regions, amplify Middle series of variation, universal primer amplification length is 600~700bp.
A kind of 4. amplification method of siphonopods mitochondrial COI gene universal primer as claimed in claim 1, it is characterised in that The amplification method of the siphonopods mitochondrial COI gene universal primer comprises the following steps：（1）DNA extraction agent boxes method is extracted Siphonopods sample mitochondrial COI gene to be measured；（2）Draw using the siphonopods mitochondrial COI gene described in claim 1 is general Thing；（3）Using siphonopods mitochondrial COI gene as masterplate, PCR amplification is carried out；（4）Amplified production 1.0% Ago-Gel electricity Swimming, RNA isolation kit are tapped and recovered amplified fragments, are sequenced.
5. a kind of amplification method of siphonopods mitochondrial COI gene universal primer according to claim 4, its feature exist In the step（1）In for avoid siphonopods intestinal contents pollute, cast out its incidence, only from its tentacle portion extract DNA.
6. a kind of amplification method of siphonopods mitochondrial COI gene universal primer according to claim 4, its feature exist In step（3）The reaction system of the PCR amplification forms：DNTP2 μ L of 2.5mM, 10 × Taq DNA polymerase Buffer2.5 μ L, 10 μM of forward primer SEQ ID NO.1 and each 1 μ L of reverse primer SEQ ID NO.2, the TaqDNA of 5U/ μ L 17.3 μ L of 0.2 μ L of polymerase, the 1 μ L of DNA masterplates solution of 100g/ μ L and sterilizing distilled water；
The PCR amplification condition is：95 DEG C of pre-degeneration 5min, subsequent 95 DEG C of denaturation 30s, 56 DEG C of annealing 30s, 72 DEG C extend 45s, 35 circulations are carried out altogether, are finally carried out 72 DEG C and are extended 5min, are preserved under the conditions of 4 DEG C.
7. a kind of amplification method of siphonopods mitochondrial COI gene universal primer according to claim 4, its feature exist In the siphonopods sample to be measured includes northwest Pacific squid, fluorescence cuttlefish, Argentinian squid, king's squid, volume shell cuttlefish, depth Extra large cuttlefish, half monk head cuttlefish, Lai Shi intend cuttlefish, opalescence squid, Sepiella maindroni, maroon octopus, swordtip squid, kite crow Thief, Philippine's Nototodarus sloani, Loligo beka, Chinese squid, Japanese squid, Du Shi squids, You Shi squids, Kobe rifle crow Thief, tiger spot cuttlefish, hickie cuttlefish, mesh cuttlefish, intend mesh cuttlefish, Piao Shi cuttlefishes, pearl cuttlefish, Sepia andreana, ellipse cuttlefish, thin wrist cuttlefish, Long wrist cuttlefish, parrot cuttlefish, straight line leopard line cuttlefish, lobate wrist cuttlefish, crooked needle cuttlefish, golden spot cuttlefish, water chestnut fin cuttlefish, short octopus, length Cuttlefish after octopus, true octopus, striped octopus, ovum octopus, eastern octopus, husky octopus, tubule octopus, more hook hook wrist cuttlefishes, Andaman Sea hook wrist cuttlefish and Tu Shi.
CN201711161134.1A 2017-11-20 2017-11-20 A kind of siphonopods mitochondrial COI gene universal primer and design and amplification method Pending CN107937560A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201711161134.1A CN107937560A (en) 2017-11-20 2017-11-20 A kind of siphonopods mitochondrial COI gene universal primer and design and amplification method

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201711161134.1A CN107937560A (en) 2017-11-20 2017-11-20 A kind of siphonopods mitochondrial COI gene universal primer and design and amplification method

Publications (1)

Publication Number Publication Date
CN107937560A true CN107937560A (en) 2018-04-20

Family

ID=61929291

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201711161134.1A Pending CN107937560A (en) 2017-11-20 2017-11-20 A kind of siphonopods mitochondrial COI gene universal primer and design and amplification method

Country Status (1)

Country Link
CN (1) CN107937560A (en)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN109234409A (en) * 2018-11-01 2019-01-18 浙江海洋大学 A kind of Portumidae mitochondrial COI gene universal primer and design and amplification method
CN109266645A (en) * 2018-09-21 2019-01-25 浙江海洋大学 A kind of universal primer and amplification method for squid section species mitochondria whole genome amplification
CN109536618A (en) * 2018-12-13 2019-03-29 河南师范大学 A kind of Jian Dings the methods of Minnow subfamily fish

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101979536A (en) * 2010-09-26 2011-02-23 中国海洋大学 Method for screening veneridae mitochondria COI gene amplification primers
CN102199597A (en) * 2011-03-09 2011-09-28 中国海洋大学 Screening method of bivalve mitochondrion COI gene amplification primers
CN102827839A (en) * 2012-09-04 2012-12-19 中国海洋大学 Cockle shellfish mitochondria COI (cytochrome c oxidase I) gene amplification primer

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101979536A (en) * 2010-09-26 2011-02-23 中国海洋大学 Method for screening veneridae mitochondria COI gene amplification primers
CN102199597A (en) * 2011-03-09 2011-09-28 中国海洋大学 Screening method of bivalve mitochondrion COI gene amplification primers
CN102827839A (en) * 2012-09-04 2012-12-19 中国海洋大学 Cockle shellfish mitochondria COI (cytochrome c oxidase I) gene amplification primer

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
沈彦君等: "DNA条形码技术促进我国水产领域信息化进程", 《科技成果管理与研究》 *
王鹤等: "中国近海习见头足类DNA条形码及其分子系统进化", 《中国水产科学》 *

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN109266645A (en) * 2018-09-21 2019-01-25 浙江海洋大学 A kind of universal primer and amplification method for squid section species mitochondria whole genome amplification
CN109234409A (en) * 2018-11-01 2019-01-18 浙江海洋大学 A kind of Portumidae mitochondrial COI gene universal primer and design and amplification method
CN109536618A (en) * 2018-12-13 2019-03-29 河南师范大学 A kind of Jian Dings the methods of Minnow subfamily fish

Similar Documents

Publication Publication Date Title
KR101211068B1 (en) Identifying Method of Marine Fishes in Southern Sea of Korea, Polynucleotide Probe, DNA Chip and Kit for Identifying The Same
CN101696452B (en) Method for identifying molecules of recessive white feather genes of chicken
CN107937560A (en) A kind of siphonopods mitochondrial COI gene universal primer and design and amplification method
CN111394445B (en) Indel marker for sex identification of channa maculata and application thereof
Wen et al. Genetic identification of global commercial sea cucumber species on the basis of mitochondrial DNA sequences
KR101047322B1 (en) DNA marker for the identification of Anguilla eel species
CN104988135A (en) Method for amplifying Tianjin tip lamprotula F-type mitochondrial genome sequence
CN107868849A (en) Detect primer sets and its application of prawn IHHNV viruses
CN107034290A (en) A kind of black porgy DNA bar code standard detection sequence and its application
CN107287296B (en) Functional gene EST-SSR (expressed sequence tag-simple sequence repeat) marker of litopenaeus vannamei as well as specific primer and detection method thereof
Chen et al. Sequencing and characterization of mitochondrial DNA genome for Brama japonica (Perciformes: Bramidae) with phylogenetic consideration
Noh et al. Rapid and specific identification of genus Cynoglossus by multiplex PCR assays using species-specific derived from the COI region
CN107858350A (en) A kind of universal primer of Pleuronectiformes Soleidae fish ribosomes the Internal Transcribed Spacer 2 and design and amplification method
CN103436612A (en) PCR-FRLP quick detecting method of common sturgeons
CN103484459A (en) Primer group, marking method and application of EST-SSR (Expressed Sequence Tag-Simple Sequence Repeats) molecular marker of macrobrachium nipponense
CN109234409A (en) A kind of Portumidae mitochondrial COI gene universal primer and design and amplification method
CN108239675B (en) Molecular marker TJcM02 for identifying melon unisexual flower and application thereof
CN111850138A (en) Molecular marker, kit and method for distinguishing triangular bream and megalobrama amblycephala in Heilongjiang and hybrid thereof
Krishna et al. Identification of selected estuarine fishes by DNA barcoding from river Krishna region, Andhra Pradesh, India
CN102352415A (en) Preparation method of gene chip responding Xanthomonas oryzae, gene chip and application of gene chip
KR101508689B1 (en) Markers for origin discrimination of the northern mauxia shrimp(Acetes chinensis)
Chen et al. Characterization and identification of the Diophrys species (Protozoa, Ciliophora, Hypotrichida) based on RAPD fingerprinting and ARDRA riboprinting
CN108103229B (en) Candida krusei STR molecular marker and application thereof
CN111118130A (en) Method for rapidly identifying sex of macrobrachium rosenbergii
CN104357574A (en) Specific primers for bloody parrot EST (expressed sequence tags) microsatellite markers and application of specific primers

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
RJ01 Rejection of invention patent application after publication
RJ01 Rejection of invention patent application after publication

Application publication date: 20180420