CN107937419A - Rice ABA8 ' hydroxylase OsABA8ox1 gene coded sequences and its application - Google Patents

Abstract

The invention belongs to gene engineering technology field, is specially rice ABA8 ' hydroxylasesOsABA8ox1Gene coded sequence and its application.The present invention specifically includes：OsABA8ox1The clone of the nucleotide coding sequence of gene, the homologous comparison of sequence, Different Organs endogenous to rice this gene, the spatial expression pattern of tissue, expression pattern change after arid, high-salt stress and Plant hormone treatment is analyzed and identified, and Tilling mutant is obtained based on rice Zhonghua11, Molecular Identification and stress experiment are carried out, detects the change of its gene expression amount and resistance change etc..Invention additionally discloses geneOsABA8ox1Tilling mutantaba8ox1‑1、 aba8ox1‑2, the mutant is found compared with wild type, the aging quickening under dark condition.The geneOsABA8ox1Available for plant species improvement, including improve Rice Resistance aging performance, the ability of rice reply dark condition is improved, so as to improve rice yield.

Description

Rice ABA8 '-hydroxylaseOsABA8ox1Gene coded sequence and its application

Technical field

The invention belongs to gene engineering technology field, and in particular to express in riceOsABA8ox1Gene code sequence Row and its application.Specifically include：ABA8 '-'-hydroxylase geneOsABA8ox1Nucleotide coding sequence clone, sequence it is same Source compares, and the Different Organs endogenous to rice this gene, the spatial expression pattern of tissue, arid, high-salt stress and plant swash Expression pattern change after element processing is analyzed and identified, and Tilling mutant is obtained in rice Zhonghua11, into Row Molecular Identification and stress experiment, detect the change of its gene expression amount and resistance change etc..

Background technology

In higher plant, the content of plant hormone ABA is synthesized by it and decomposition reaction regulates and controls and reaches balance (Nambara and Marion-Poll, 2005).Regulate and control ABA yield key enzyme include participate in remove lutein 9- it is cis-epoxies recklessly Radish element dioxygenase (NCEDs) (Tan et al., 2003), is changed into violaxanthin by zeaxanthin by antheraxanthin Zeaxanthin epoxidase (ZEP) (Oliver et al., 2007), and participate in the ABA aldehyde of ABA synthesis final steps Oxidizing ferment (AAO3) (Yang et al., 2014).ABA is oxidized to phaseic acid (PA) by ABA 8 '-hydroxylase catalysis Reaction, have in rice three kinds of gene codes enzymes (OsABA8ox1, 2 and 3) (Saika et al., 2007)。

ABA is corresponding and developmental regulation all plays an important role for plant stress, including seed dormancy, with ripe, organ takes off Fall and leaf senile etc. (Chandler and Robertson, 1994; Cutler et al., 2010；Becker and Apel, 1993).ABA can induce the expression of some SAGs, such asNYC1 (Kusaba et al., 2007), SGR (Park et al., 2007), PPH (Schelbert et al., 2009) andPaO (Pruzinská et al., 2005), so as to promote plant senescence.Some NAC transcription factors have notable up-regulation after ABA processing, includingVNI2 (Yang et al., 2011), SNAC-As (Takasaki et al., 2015), ORE1 (Kim et al., 2011), andOsNAP(Liang et al., 2014), but the molecular mechanism of its behind is still not clear.AtNAP can be combined specificallyAAO3Promoter, so as to promote the transcription (Yang et al., 2014) of chlorophyll degradation gene.Although the life on ABA Thing synthesis path, downstream signal mechanism and the induction to leaf senile have had many researchs, but the transcriptional control net of upstream Network and the mechanism contacted with leaf senile are still not clear.

OsABA8ox1 is one of most important enzyme in ABA catabolics pathway of metabolism, also have impact on plant drought ability, so that Influence setting percentage and yield.The precursor that ABA is produced by carotenoid path synthesizes in cytoplasm, is urged afterwards by ABA hydroxylases Change inactivation.The accumulation of endogenous ABA is regulated and controled be subject to its synthesis with decomposition reaction, and the activity of ABA8ox enzymes is exactly important shadow The factor of sound.Have now been found that in cornABA8oxGene has expression in each organ, and under drought stress, for jade The decomposition of meter Gen Zhong ABA has important regulating and controlling effect.Also have in other cereal crops pairABA8oxGene family member carries out phase The evolution of pass and the analysis of function.

The content of the invention

It is an object of the invention to propose a kind of new paddy gene, the albumen coded sequence of the paddy gene is also provided, and carry For the application of the paddy gene.

The ABA8 ' expressed in rice provided by the invention-'-hydroxylase geneOsABA8ox1Sequence and its application, specifically Including：OsABA8ox1The clone of the nucleotide coding sequence of gene, the homologous comparison of sequence, to rice, this gene is endogenous not The spatial expression pattern of same organ, tissue, the expression pattern change after arid, high-salt stress and Plant hormone treatment are divided Analysis identification, and Tilling mutant is obtained based on rice Zhonghua11, Molecular Identification and stress experiment are carried out, detects it Gene expression amount changes and resistance changes etc..

The gene that the present invention passes through coding ABA8 '-hydroxylase in cloning riceOsABA8ox1, to its spatial and temporal expression profile And stress response mode is determined, the results show gene expression quantity in root and two leaves, three leaves is on the low side, is expressed in five leaves Amount is higher.After ABA HORMONE TREATMENTs are received,OsABA8ox1Expression quantity be remarkably decreased, reach minimum in 24h；Salt stress processing After 8-2h, expression quantity significantly raises；After Osmotic treatment 2h,OsABA8ox1Expression quantity be remarkably decreased, hereafter fluctuated, but It is overall on a declining curve.Based on rice Zhonghua11'sOsABA8ox1In mutant, it was observed that mutant strain plant height becomes Short, mass of 1000 kernel, setting percentage are relatively low, and the sensitivity of dark processing is raised, and aging is accelerated, this is ABA in rice at it The effect that is played in aging course and how to improve yield using the effect and provide gene source and technical support.

The present invention clones a kind of gene of coding ABA8 '-hydroxylase from rice first, is named asOsABA8ox1.For DNA molecular with particular sequence, wherein open reading frame are 1416bp, its nucleotides sequence is classified as shown in SEQ ID NO.1.

The present invention also provides this rice Os ABA8ox1 albumen coded sequences, there is 471 amino acid residues, molecular weight 52.93kDa, isoelectric point 9.65, its amino acid sequence is shown in SEQ ID NO.2.

The present invention also provides obtain gene in rice sample for transferringOsABA8ox1A pair of of nucleotide primer.This draws Thing is according to geneOsABA8ox1Design, carrying out PCR amplification to primer pair rice sample cDNA using this can obtain long 1416bp's Genetic fragment.Specifically primer sequence is：

Forward Primer：5' ATGGGTGCTTTTCTTCTGTTCGTGT3' （SEQ ID NO.3）

Reverse Primer：5' TCACTCCTGCTCGGTGTTCTTGCGG 3' （SEQ ID NO.4）.

The present invention is also for detection paddy geneOsABA8ox1In the method for Different Organs expression pattern, that is, utilize the base CauseOsABA8ox1Conservative section of the nucleotide sequence as design probe primer, transfer the primer sequence of its sequence：

Forward Primer：5' CCAAGAACCCCAACGTGTTC 3' （SEQ ID NO.5）

Reverse Primer：5' CGGGCTGGACACCATCA 3' （SEQ ID NO.6）,

Real-timePCR is carried out to rice cDNA sample, then detects expression of the gene in stem, leaf, root；Sample is water The RNA of rice gained cDNA after reverse transcription；Its step is as follows：

（1）Extract the total serum IgE of rice organ（Trizol, it is commercially available）；

（2）Utilize reverse transcription reagent box（It is commercially available）By total serum IgE reverse transcription into cDNA, according to SEQ ID NO.5 and SEQ ID NO.6 designs primer, according to SEQ ID NO.1, across the 100bp of ORF areas and 3`UTR as PCR product, carries out real-time quantitative PCR is detected.

The present invention also provides detection paddy geneOsABA8ox1Expression under high salt, drought stress and HORMONE TREATMENT The method of patterns of change, i.e., after rice being carried out high salt, drought stress and HORMONE TREATMENT, extract the RNA in rice leaf；Profit RNA reverse transcriptions, using primer SEQ ID NO.5 and SEQ ID NO.6, are subjected to quantitative PCR into cDNA with reverse transcription reagent box Detection.Its step is as follows：

（1）Two weeks big rice seedlings are placed in 150 μM of sodium chloride solutions, 28 DEG C are cultivated 1d to carry out high-salt stress process；Put In 20 μM of ABA, 28 DEG C are cultivated 24h to carry out HORMONE TREATMENT；It is placed in dry air, 28 DEG C of culture 1d, to carry out the arid side of body Compel processing；It is placed in water, 28 DEG C of culture 1d are as control；

（2）Extract the total serum IgE in the leaf and root of the rice seedlings of foregoing processing（Trizol, it is commercially available）；

（3）Utilize reverse transcription reagent box（It is commercially available）By total serum IgE reverse transcription into cDNA, according to SEQ ID NO.5 and SEQ ID NO.6 designs primer, according to SEQ ID NO.1, across the 100bp of ORF areas and 3`UTR as PCR product, carries out real-time quantitative PCR is detected.

The present invention also provides detectionOsABA8ox1The rice and wild rice of mutant（Zhonghua11）Dark is coerced Compel the method for sensitivity, aging rate and volume variance, its step is as follows：

（1）The seed of mutant strain and wild type immersion 24h in water, allows the abundant imbibition of seed.Then seed glass is trained Support in ware, being placed on 37 DEG C of vernalization in rice constant incubator, to showing money or valuables one carries unintentionally, changing water daily prevents mildew.Choose and sprout consistent kind Son, transfers them in kind of subrack, is placed in basic nutrient solution, 28 DEG C of incubator cultures；

（2）The STb gene in mutant and wild type control group is extracted respectively, and real time fluorescent quantitative is carried out using using primer PCR is detected, and determines mutated site and screening homozygous lines.Corresponding primer sequence is：

Forward Primer：5' CTTCCTCTTCTTCTTCCTTCTCCT 3' （SEQ ID NO.7）

Reverse Primer：5' CTATGAGATATGAGGAGGCGAACT 3' （SEQ ID NO.8）；

（3）Clip 28 DEG C of cultures, two weeks big mutant seedlings in culture dish, are put respectively with wild type seedlings control group blade Handled into normal illumination and dark；

（4）After above-mentioned experiment carries out 5d, the phenotypic difference for the treatment of group and control group is observed, carries out DAB, NBT dyeing, measurement turns base Because of seedling and electrical conductivity of the wild type seedlings under two kinds of condition of culture（Conductivity meter：Upper Nereid section, thunder magnetic DDS-307）And Chlorophyll content.

The present invention also providesOsABA8ox1 Tilling Mutant Rices are with wild rice in maturity period plant height and yield The method of change, its step are as follows：

（1）The seed of mutant strain and wild type immersion 24h in water, allows the abundant imbibition of seed.Then seed glass is trained Support in ware, being placed on 37 DEG C of vernalization in rice constant incubator, to showing money or valuables one carries unintentionally, changing water daily prevents mildew；

（2）Seed after vernalization is equably dispersed on seedbed, surface is unable to ponding, after seed is sowed, is smoothed out with hand, allows seed Poach, should not be too deep；

（3）After nursery 3-4 weeks, seedling is in three leaves, and well developed root system can transplant seedlings.Root damage, later stage depauperation can be caused too early. It can apply fertilizer on a small quantity by every seedling 0.5g urea within 1-2 weeks after transplanting seedlings.Watering is general to be in advance placed on water in greenhouse after 1 day warm again Pour；

（4）Maturity period measures the plant height of mutant and wild rice, and counts mass of 1000 kernel and setting percentage.

As it can be seen that paddy gene provided by the inventionOs ABA8ox1Available for plant species improvement, such as it is used to improve rice Anti-aging performance, improves the ability of rice reply dark condition, so as to improve rice yield.

Brief description of the drawings

Fig. 1 isOsABA8ox1Express spectra in rice Different Organs.Wherein, A is rice root, stem, two leaves, three leaves, four Leaf, five leaves, the structure chart of six leaves；B is two leaf of rice, three leaves, four leaves, five leaves, the representative graph of six leaves；C is in each organOsABA8ox1Expression quantity.

Fig. 2 for wild rice after high salt, arid and HORMONE TREATMENT,OsABA8ox1The expression quantity of gene is at any time Between situation of change.Wherein, A rice after 150mM NaCl processing 0-24hOsABA8ox1Gene expression amount changes；B is The rice after processing 0-24h in dry airOsABA8ox1Gene expression amount changes；C is with after 20uM ABA processing 0-24h RiceOsABA8ox1Gene expression amount changes.

Fig. 3 isOsABA8ox1 The Molecular Identification of tilling Mutant Rices.Wherein, x-0 WT, x-34 areaba8ox1。

Fig. 4 is mutantaba8ox1-1、aba8ox1-2Strain and wild rice aging situation under dark condition Phenotype compares.

Fig. 5 is mutantaba8ox1-1、aba8ox1-2Strain and wild rice aging situation under dark condition Compare.Wherein, A is the contrast of DAB, NBT staining conditions；B is dark processing conductivity variations contrast after 5 days；C is dark processing 5 The contrast of chlorophyll content after it.

Fig. 6 is mutantaba8ox1Plant height, setting percentage contrast with wild type Zhonghua11.Wherein, A is plant height pair According to phase；B counts for mass of 1000 kernel；C contrasts for setting percentage.

Embodiment

The present invention is further explained with reference to specific implementation example.It is to be understood that these examples are only for illustrating this hair It is bright rather than limit the scope of the invention.Specific experimental method is not specified in following Examples, can conventionally into OK.As Sambrook equimoleculars are cloned：Laboratory manual（New York: Cold Spring Harbor Laboratory Press, 1989）Described in condition, or according to manufacture production firm operation instruction.

Embodiment 1, paddy geneOsABA8ox1Clone

1. rice varieties Zhonghua11 cultures in incubator (SPX-250-GB, Shanghai, China)：Growth conditions For photoperiod 16h/8h (L/D), 28 DEG C；

2, RNA are extracted.100 milligrams or so fresh rice plants organization materials are taken, liquid nitrogen is fully ground.Add 1 ml Trizol reagents, be vortexed 15 s after room temperature place 5 min.Add 0.2 ml chloroforms, deproteinized, 12000rpm is centrifuged on after 10min New centrifuge tube is transferred to clearly, adds isometric isopropanol, is fully mixed, and room temperature places 10 min, and 12k rpm centrifugation 10min, are abandoned Supernatant, 75% ethanol, 1 ml prepared with the processed water of DEPC wash precipitation, are repeated once.Drying at room temperature 5-10 min, are dissolved in In 20 μ l DEPC water, OD values, electrophoresis detection are surveyed；

3. the clone of gene.Using the first chain of rice cDNA of reverse transcription as template, carried out using forward primer and reverse primer PCR, obtains full length gene, particular sequence information is referring to SEQ ID NO.1.

Embodiment 2, riceOsABA8ox1Gene organ expression pattern analysis

Rice stem, root, two leaves, three leaves, four leaves, five leaves, six leaves are extracted respectively（Figure 1A, B）In total serum IgE, tried using reverse transcription Total serum IgE reverse transcription into cDNA, using primer SEQ ID NO.5 and SEQ ID NO.6, is carried out real-time fluorescence quantitative PCR by agent box Detection（Fig. 1 C）.The results show that the gene is constitutive expression, and the expression quantity highest in five leaves, root, two leaves, three leaves, four leaf tables It is all less up to measuring.

Embodiment 3, paddy geneOsABA8ox1Expression pattern under arid, high-salt stress and Plant hormone treatment Analysis

The rice seedling big to two weeks carries out 150 μM of NaCl, dry air and 20 μM of ABA processing 24h respectively, extracts respectively Total serum IgE in processing 0,2,4,8,12, the leaf after 24h, using reverse transcription reagent box by total serum IgE reverse transcription into cDNA, using drawing Thing SEQ ID NO.5 and SEQ ID NO.6, carry out real-time fluorescence quantitative PCR detection.The results show that NaCl processing 8-24h expression Amount significantly rise（Fig. 2, A）, 2h expression quantity significantly reduces under arid (dry air)（Fig. 2, B）, expression quantity is shown after ABA handles 2h Writing reduces（Figure, 2C）.

Embodiment 4,OsABA8ox1 The Molecular Identification of tilling mutant

The STb gene in mutant and wild type control group is extracted respectively, using primer SEQ ID NO.7 and SEQ ID NO.8, Carry out real-time fluorescence quantitative PCR detection（Fig. 3）.The results show that mutantaba8ox1The bases G of 497 sport A, password Son is changed into GAT from GGT, and amino acid is aspartic acid by glycine mutation, and 789 bit base G are lacked.

Embodiment 5, aba8ox1Mutant anti-aging ability detects

Clip respectivelyAba8ox1-1, aba8ox1-2And the blade of two week old rice seedlings of wild type control group, it is placed in culture dish In, control group and dark processing group are set, and processing is taken pictures after 5 days contrasts leaf senile phenotype（Fig. 4）.Typical phenotype is chosen respectively Blade, carry out DAB, NBT dyeing, counterstain degree（Fig. 5, A）.The blade of typical phenotype is chosen, carries out electrical conductivity（Fig. 5, B）With the measure of chlorophyll content（Fig. 5, C）.The result shows that after dark processing, mutant aging degree is higher than wild type, blade Yellow, hydrogen peroxide accumulation, peroxidase accumulation will be more than wild type, Conductivity Ratio wild type higher, chlorophyll content It is lower, all illustrate that mutant aging is accelerated.

Embodiment 6 aba8ox1The change of Mutant Rice plant height and yield

Earth culture mutant strainaba8ox1Take a picture with wild type Zhonghua11 control groups（Fig. 6, A）, mass of 1000 kernel statistics （Fig. 6, B）And setting percentage statistics（Fig. 6, C）.The results show that Mutant Riceaba8ox1With wild type Zhonghua11 phases Than plant height is shorter, and mass of 1000 kernel, setting percentage are all lower.

Bibliography

1.Nambara, E., & Marion-Poll, A. (2005). Abscisic acid biosynthesis and catabolism. ann rev plant biol. Annual Review of Plant Biology,56(1), 165- 185.

2.Oliver, S. N., Dennis, E. S., & Dolferus, R. (2007). Aba regulates apoplastic sugar transport and is a potential signal for cold-induced pollen sterility in rice. Plant & Cell Physiology,48(9), 1319-30.

3.Yang, R., Yang, T., Zhang, H., Qi, Y., Xing, Y., & Zhang, N., et al. (2014). Hormone profiling and transcription analysis reveal a major role of aba in tomato salt tolerance. Plant Physiology & Biochemistry,77(2), 23-34.

4.Saika, H., Okamoto, M., Miyoshi, K., Kushiro, T., Shinoda, S., & Jikumaru, Y., et al. (2007). Ethylene promotes submergence-induced expression of osaba8ox1, a gene that encodes aba 8'-hydroxylase in rice. Plant & Cell Physiology,48(2), 287-98.

5.And, P. M. C., & Robertson, M. (1994). Gene expression regulated by abscisic acid and its relation to stress tolerance. Annual Review of Plant Biology,45(1), 113-141.

6.Jaradat, M. R., Feurtado, J. A., Huang, D., Lu, Y., & Cutler, A. J. (2013). Multiple roles of the transcription factor atmybr1/atmyb44 in aba signaling, stress responses, and leaf senescence. Bmc Plant Biology,13(1), 192.

7.Becker, W., & Apel, K. (1993). Differences in gene expression between natural and artificially induced leaf senescence. Planta,189(1), 74-79.

8.Bown, L., Kusaba, S., Goubet, F., Codrai, L., Dale, A. G., & Zhang, Z., et al. (2007). The ectopically parting cells 1-2 (epc1-2) mutant exhibits an exaggerated response to abscisic acid. Journal of Experimental Botany,58(7), 1813-1823.

9.Park, S. Y., Yu, J. W., Park, J. S., Li, J., Yoo, S. C., & Lee, N. Y., et al. (2007). The senescence-induced staygreen protein regulates chlorophyll degradation. Plant Cell,19(5), 1649.

10.Schelbert, S., Aubry, S., Burla, B., Agne, B., Kessler, F., & Krupinska, K., et al. (2009). Pheophytin pheophorbide hydrolase (pheophytinase) is involved in chlorophyll breakdown during leaf senescence in arabidopsis. Plant Cell,21(3), 767-85.

11.Pruzinská, A., Tanner, G., Aubry, S., Anders, I., Moser, S., & Müller, T., et al. (2005). Chlorophyll breakdown in senescent arabidopsis leaves. characterization of chlorophyll catabolites and of chlorophyll catabolic enzymes involved in the degreening reaction. Plant Physiology,139(1), 52-63.

12.Takasaki, H., Maruyama, K., Takahashi, F., Fujita, M., Yoshida, T., & Nakashima, K., et al. (2015). Snac‐as, stress‐responsive nac transcription factors, mediate aba‐inducible leaf senescence. Plant Journal for Cell & Molecular Biology,84(6), 1114.

13.Liang, C., Wang, Y., Zhu, Y., Tang, J., Hu, B., & Liu, L., et al. (2014). Osnap connects abscisic acid and leaf senescence by fine-tuning abscisic acid biosynthesis and directly targeting senescence-associated genes in rice. Proceedings of the National Academy of Sciences of the United States of America,111(27), 10013-8.

14.Ratnakar Vallabhaneni, & Eleanore T. Wurtzel. (2010). From epoxycarotenoids to aba: the role of aba 8′-hydroxylases in drought-stressed maize roots. Archives of Biochemistry & Biophysics,504(1), 112.。

Sequence table

<110>Fudan University

<120>Rice ABA8'- hydroxylase OsABA8ox1 gene coded sequences and its application

<130> 001

<160> 8

<170> SIPOSequenceListing 1.0

<210> 1

<211> 2865

<212> DNA

<213>Rice (Oryza sativa)

<400> 1

tccacacccc ccccaacaac accaccgccc atttcccttt ctcttcctct tcttcttcct 60

tctcctccta ctcctctgcg attgacaaag ataagtgaag tgagcaggcg ccaatgggtg 120

cttttcttct gttcgtgtgc gtgctcgcgc ctttcttgct tgtctgcgcc gtccgcggcc 180

gccgccggca ggcgggctcg tcggaagcgg cggcgtgcgg cctgccgctg ccgccggggt 240

cgatggggtg gccgtacgtc ggggagacgt tccagctgta ctcgtccaag aaccccaacg 300

tgttcttcaa caagaagcgg aacaagtacg gtcccatctt caagacgcac atcctgggat 360

gcccctgcgt gatggtgtcc agcccggagg cggcgcggtt cgtgctggtg acgcaggcgc 420

acctcttcaa gcccaccttc ccggcgagca aggagcggat gctgggtccc caggccatct 480

tcttccagca gggcgactac cacgcccacc tccgccgcat cgtctcccgc gccttctccc 540

ccgagtccat ccgcgcctcc gtcccggcca tcgaggccat cgcgctccgc tccctccact 600

cctgggacgg ccagttcgtc aacaccttcc aagagatgaa gactgtgagt tcttactgcc 660

taactcctct tcccactctg ctttgctctg ctctactctg ctttgctgat cgatccgatg 720

tgtttgttgt tgatggcata tacaacagta cgcgctgaat gtggcattgc tgtccatctt 780

cggggaggag gagatgcgct acatcgagga gctgaagcag tgctacctga cgctggagaa 840

ggggtacaac tcgatgccgg tgaacctgcc gggcaccctg ttccacaagg ccatgaaggc 900

ccggaagagg ctgggcgcca ttgtggccca catcatctct gcccggcgcg agcggcagcg 960

ggggaacgac ctgctagggt cgttcgtgga cggccgcgag gccctcaccg acgcccagat 1020

cgccgacaac gtcatcggcg tcatcttcgc cgcccgcgac accaccgcca gcgtcctcac 1080

ctggatggtc aagttcctcg gcgaccaccc cgccgtcctc aaggccgtca ccgtaagttc 1140

gcctcctcat atctcatagt atatcaaagt ccttgatggt gaggctgacc gcgggtgcca 1200

tggatggaac aggaagagca gctgcagatt gccaaggaga aagaggcgtc gggcgagccg 1260

ctgtcatggg cggacacgcg gcggatgaag atgacgagcc gggtcatcca ggagacgatg 1320

agggtggcgt ccatcctctc cttcaccttc agggaggccg tggaggacgt ggaataccaa 1380

ggtgagcagc agagcagagc tgtccggtgg cagcctgtcc gtccctttcg agacagcctc 1440

gcgcttctct tccgctgcga gtgaactgga ccgaatgggg cagactggtt ccttaactga 1500

aatagactaa ctcgatcagt cgtcccagaa tctaacctcg ttcgatcgtc tgctctgtgc 1560

agggtacctg atccccaagg gctggaaagt gctacctctg ttccgcaaca tccaccacaa 1620

ccccgaccac ttcccctgcc cggaaaagtt cgacccgtcc cggttcgagg tcagcatcac 1680

gaacccactc ttccgtgttt ttgttccctt ccctcccttt cctttcccgg tgcggccgac 1740

ttcctagcca agtcggtccg cggtttgcga gcagtggccg gtatgggttt tcctgacccc 1800

gcgtccgtcc cgtcactgtt gcaggtggcg cccaagccca acacgttcat gccgttcggg 1860

aacgggaccc actcgtgccc gggcaacgag ctcgccaagc tggagatgct cgtgctcttc 1920

caccacctcg caaccaagta caggtggtcc acgtccaagt ccgagagcgg cgtccagttc 1980

ggccccttcg cgctgccgct caacggcctc cccatgagct tcacccgcaa gaacaccgag 2040

caggagtgaa aaccgaacag ggagacaaaa agaagaagaa gaatactagc atcagctaag 2100

ctggggaaag ctggcaaaac caacatcaac ggcgggcagc ggcgccacgc agcgcgcgcg 2160

agtccatttt cgcggcggtc accgtccggg gggacacctg ttggcgccgc agtgggagcg 2220

ggagaccgaa cggtggattc cgtattagca cggatcatca gagtccttgt acagattctt 2280

cagctaggac cacggttggc aatcgagagg aggagcagag gagttgatga aaaaaaccaa 2340

acactacgta gacatctgag ctagggagcg ccacaaagaa gtggccctta attgtaaaac 2400

caaccatttt ttatcctttt ttgcttagtt ttttttttgg ccaacaacta taggagaaga 2460

gtagagaaga gaagagaaat tggggagaaa atacagggag gatgaagagg ccctgattgg 2520

gatgtaagct aggttgcccg cctgaaagca ggctggcatg cagatgcagc tataggtcga 2580

ataatcgagg cgagcgatga tggacggatg gatcgattca tcgatcgcca gagtcaaaag 2640

ggaagaacgt cgtgatcccc cgcgggctaa gccaggccac gggagagcga ctcctctgta 2700

ccgtttcgtc caactcaaga gaaaatgacc ttcttgagaa aagtattgaa ttgtccctat 2760

acacgcgcac acaggaattg ctacccagca ccctatattg cagttgagca agcgattttt 2820

tcgatcactt cttgtgtgta agcatgcatg catgcttcca ataaa 2865

<210> 2

<211> 471

<212> PRT

<213>Rice (Oryza sativa)

<400> 2

Met Gly Ala Phe Leu Leu Phe Val Cys Val Leu Ala Pro Phe Leu Leu

1 5 10 15

Val Cys Ala Val Arg Gly Arg Arg Arg Gln Ala Gly Ser Ser Glu Ala

20 25 30

Ala Ala Cys Gly Leu Pro Leu Pro Pro Gly Ser Met Gly Trp Pro Tyr

35 40 45

Val Gly Glu Thr Phe Gln Leu Tyr Ser Ser Lys Asn Pro Asn Val Phe

50 55 60

Phe Asn Lys Lys Arg Asn Lys Tyr Gly Pro Ile Phe Lys Thr His Ile

65 70 75 80

Leu Gly Cys Pro Cys Val Met Val Ser Ser Pro Glu Ala Ala Arg Phe

85 90 95

Val Leu Val Thr Gln Ala His Leu Phe Lys Pro Thr Phe Pro Ala Ser

100 105 110

Lys Glu Arg Met Leu Gly Pro Gln Ala Ile Phe Phe Gln Gln Gly Asp

115 120 125

Tyr His Ala His Leu Arg Arg Ile Val Ser Arg Ala Phe Ser Pro Glu

130 135 140

Ser Ile Arg Ala Ser Val Pro Ala Ile Glu Ala Ile Ala Leu Arg Ser

145 150 155 160

Leu His Ser Trp Asp Gly Gln Phe Val Asn Thr Phe Gln Glu Met Lys

165 170 175

Thr Tyr Ala Leu Asn Val Ala Leu Leu Ser Ile Phe Gly Glu Glu Glu

180 185 190

Met Arg Tyr Ile Glu Glu Leu Lys Gln Cys Tyr Leu Thr Leu Glu Lys

195 200 205

Gly Tyr Asn Ser Met Pro Val Asn Leu Pro Gly Thr Leu Phe His Lys

210 215 220

Ala Met Lys Ala Arg Lys Arg Leu Gly Ala Ile Val Ala His Ile Ile

225 230 235 240

Ser Ala Arg Arg Glu Arg Gln Arg Gly Asn Asp Leu Leu Gly Ser Phe

245 250 255

Val Asp Gly Arg Glu Ala Leu Thr Asp Ala Gln Ile Ala Asp Asn Val

260 265 270

Ile Gly Val Ile Phe Ala Ala Arg Asp Thr Thr Ala Ser Val Leu Thr

275 280 285

Trp Met Val Lys Phe Leu Gly Asp His Pro Ala Val Leu Lys Ala Val

290 295 300

Thr Glu Glu Gln Leu Gln Ile Ala Lys Glu Lys Glu Ala Ser Gly Glu

305 310 315 320

Pro Leu Ser Trp Ala Asp Thr Arg Arg Met Lys Met Thr Ser Arg Val

325 330 335

Ile Gln Glu Thr Met Arg Val Ala Ser Ile Leu Ser Phe Thr Phe Arg

340 345 350

Glu Ala Val Glu Asp Val Glu Tyr Gln Gly Tyr Leu Ile Pro Lys Gly

355 360 365

Trp Lys Val Leu Pro Leu Phe Arg Asn Ile His His Asn Pro Asp His

370 375 380

Phe Pro Cys Pro Glu Lys Phe Asp Pro Ser Arg Phe Glu Val Ala Pro

385 390 395 400

Lys Pro Asn Thr Phe Met Pro Phe Gly Asn Gly Thr His Ser Cys Pro

405 410 415

Gly Asn Glu Leu Ala Lys Leu Glu Met Leu Val Leu Phe His His Leu

420 425 430

Ala Thr Lys Tyr Arg Trp Ser Thr Ser Lys Ser Glu Ser Gly Val Gln

435 440 445

Phe Gly Pro Phe Ala Leu Pro Leu Asn Gly Leu Pro Met Ser Phe Thr

450 455 460

Arg Lys Asn Thr Glu Gln Glu

465 470

<210> 3

<211> 25

<212> DNA

<213>Rice (Oryza sativa)

<400> 3

atgggtgctt ttcttctgtt cgtgt 25

<210> 4

<211> 25

<212> DNA

<213>Rice (Oryza sativa)

<400> 4

tcactcctgc tcggtgttct tgcgg 25

<210> 5

<211> 20

<212> DNA

<213>Rice (Oryza sativa)

<400> 5

ccaagaaccc caacgtgttc 20

<210> 6

<211> 17

<212> DNA

<213>Rice (Oryza sativa)

<400> 6

cgggctggac accatca 17

<210> 7

<211> 24

<212> DNA

<213>Rice (Oryza sativa)

<400> 7

cttcctcttc ttcttccttc tcct 24

<210> 8

<211> 24

<212> DNA

<213>Rice (Oryza sativa)

<400> 8

ctatgagata tgaggaggcg aact 24

Claims (8)

1. a kind of DNA molecular isolated, it is characterised in that for the gene cloned from rice, be denoted asOsABA8ox1, entirely Long 2865bp, wherein open reading frame are 1416bp, its nucleotides sequence is classified as SEQ ID NO.1.

A kind of 2. gene as claimed in claim 1OsABA8ox1The protein molecule of coding, it is characterised in that the sequence is compiled 471 amino acid residues of code, molecular weight 52.93kDa, isoelectric point 9.65, amino acid sequence is SEQ ID NO.2.

3. a pair, which is used to transfer, obtains gene in rice sampleOsABA8ox1Primer sequence, it is characterised in that according to right It is required that 1 geneOsABA8ox1Design, sequence is as shown in SEQ ID NO.3 and SEQ ID NO.4.

4. one kind detection paddy geneOsABA8ox1 The method of mRNA expression patterns, it is characterised in that utilize claim 1 Conservative section of the nucleotide sequence of the DNA molecular as design probe primer, the primer sequence for transferring its sequence are shown in SEQ ID NO.5 and SEQ ID NO.6, to rice cDNA sample carry out Real-time PCR, then detect the gene stem, leaf, Expression in root；Sample is RNA cDNA obtained by after reverse transcription of rice；Its step is as follows：Extract rice Different Organs Total serum IgE；Using reverse transcription reagent box by total serum IgE reverse transcription into cDNA, using primer SEQ ID NO.5 and SEQ ID NO.6, Carry out quantitative PCR detection.

5. one kind detection rice is after arid, high-salt stress and Plant hormone treatment, geneOsABA8ox1Expression contents become The method of change, it is characterised in that concretely comprise the following steps：After rice is carried out arid, high-salt stress and Plant hormone treatment, extraction The total serum IgE of rice；Total serum IgE reverse transcription is utilized into primer SEQ ID NO.5 and SEQ ID into cDNA using reverse transcription reagent box NO.6, carries out quantitative PCR detection.

6. gene in one kind detection rice Tilling mutantOsABA8ox1The method of expression contents change, it is characterised in that Concretely comprise the following steps：Mutant and wild type control group rice total dna are extracted, utilizes primer SEQ ID NO.7 and SEQ ID NO.8, carries out quantitative PCR detection.

7. paddy gene as claimed in claim 1OsABA8ox1Application in plant species improvement.

8. application as claimed in claim 7, the plant species improvement, to improve Rice Resistance aging performance, improving rice should To the ability of dark condition, so as to improve rice yield.