CN114032244B

CN114032244B - Tobacco NtPIF1 gene and its coding protein and application

Info

Publication number: CN114032244B
Application number: CN202110105752.4A
Authority: CN
Inventors: 李依婷; 刘少华; 潘旭浩; 杨爱国; 蒋彩虹; 冯全福; 王元英
Original assignee: Qingzhou Tobacco Research Institute of China National Tobacco Corp of Institute of Tobacco Research of CAAS
Current assignee: Qingzhou Tobacco Research Institute of China National Tobacco Corp of Institute of Tobacco Research of CAAS
Priority date: 2021-01-26
Filing date: 2021-01-26
Publication date: 2023-01-13
Anticipated expiration: 2041-01-26
Also published as: CN114032244A

Abstract

The invention discloses a tobacco NtPIF1 gene, a coding protein and application thereof. The CDS sequence of the tobacco NtPIF1 gene is shown as SEQ ID No. 1. The amino acid sequence of the protein coded by the tobacco NtMYB1 gene is shown in SEQ ID No. 2. The application of the tobacco NtMYB1 gene in adjusting tobacco carotenoid substances, adjusting the quality of the flue-cured tobacco leaves and adjusting the stress resistance of the tobacco; preferably in the application of improving the content of carotenoid in tobacco, improving the quality of the flue-cured tobacco and improving the stress resistance of the tobacco; further preferably applied to improving the ABA stress and drought stress resistance of tobacco.

Description

Tobacco NtPIF1 gene and its coding protein and application

Technical Field

The invention relates to the technical field related to plant molecular biology and genetic engineering, in particular to a tobacco NtPIF1 gene and a coding protein and application thereof.

Background

Tobacco is one of the main economic crops in China. Due to large biomass, mature and complete genetic transformation system and simple planting and cultivation technology, tobacco is considered as an ideal model plant for developing plant bioreactor research and producing beneficial compounds (such as astaxanthin, carotene, anthocyanin and the like) and proteins (such as collagen, influenza vaccine and the like).

The carotene compounds are the general term of natural pigments in nature, and are commonly found in yellow, orange yellow or red pigments in animals, higher plants, fungi and algae. In the plant body, the carotenoid has the functions of promoting photomorphogenesis, participating in non-photochemical inhibition reaction, lipid peroxidation, attracting insects to pollinate and the like, and is a kind of secondary metabolite necessary for plant growth; carotenoids have antioxidant activity in animal cells, where beta-carotene is a precursor substance for the human body to synthesize vitamin a, which is vital to the optic nerve and immune system. However, since animal cells cannot synthesize carotenoids themselves, carotenoids in plants become the most important source of uptake in humans. Due to the covalent polyene structure, the carotenoid has super-strong antioxidant activity and is widely applied in the fields of functional nourishment, cosmetics, food additives, animal feed and the like. The global market value of carotenoids has been estimated to reach $ 15 billion in 2018. The production of carotenoids currently relies mainly on chemical and microbial synthesis, but the synthesis yields are low, the process is cumbersome, and the chemical contamination during production is large.

As a main economic crop, the content of carotene substances in tobacco leaves is important to the quality of flue-cured tobacco and is an important aroma precursor in the flue-cured tobacco. For example, beta-cyclocitral, beta-ionone, beta-damascenone, dihydroactinidiolide and the like generated by degrading beta-carotene are important raw materials of flavors and fragrances; megastigmatrienone and isophorone generated by degradation of lutein are precursors of tobacco flavor substances. The flavoring substances have relatively low threshold value, small irritation and large contribution rate to the fragrance of tobacco leaves, and are main components for forming fine, elegant and fresh fragrance of the flue-cured tobacco. Damascone and ionone can increase the floral aroma of tobacco, and dihydroactinidiolide and megastigmatrienone can eliminate irritation and increase the floral aroma and costustoot characteristics in tobacco leaf. Therefore, the synthesis and accumulation of carotene substances in tobacco are improved, the bioavailability of the tobacco can be improved, and the fragrance quality of the tobacco leaves can be improved.

Drought stress is one of the major problems restricting global agricultural production, and is also an important research field of abiotic stress. When the plant meets drought stress, the water content of the cells is reduced, the active oxygen balance is broken, and the cell membrane system is damaged, so that the growth and development of the plant are retarded, and serious plants even die. Tobacco is an important model plant with a large planting scale, and is widely used for the research of drought stress resistance in recent years.

The Phytochrome interacting factor PIF (Phytochrome interacting factors) belongs to subfamily 15 of the plant basic-helix-loop-helix (bHLH) transcription factor family. Is an important regulating factor in plant light signal reaction, and plays an important role in regulating seed germination, seedling morphogenesis, shade-avoiding reaction, circadian rhythm and various plant hormone response processes. However, due to the diversity of species evolution, the PIF gene functions in different plants are not identical. In tobacco, studies on a photochromic-pigment interacting factor have not been reported, and the function of the family gene is still unclear. The tobacco NtPIF1 gene excavated and identified by the invention not only plays an important role in regulating and controlling the synthesis and accumulation of carotene substances in tobacco leaves, but also has an obvious effect of improving the stress resistance of the tobacco.

Disclosure of Invention

The invention aims to provide a tobacco NtPIF1 gene.

Another purpose of the invention is to provide an application of the tobacco transcription factor NtPIF1 gene.

The purpose of the invention can be realized by the following technical scheme:

the CDS sequence of the tobacco NtPIF1 gene is shown as SEQ ID No. 1.

The amino acid sequence of the protein coded by the tobacco NtPIF1 gene is shown in SEQ ID No. 2.

The application of the tobacco NtPIF1 gene in regulating the content of carotenoid in tobacco, the aroma quality of roasted tobacco leaves and/or the drought resistance of tobacco, preferably in improving the content of purplish yellow, new yellow, lutein and beta-carotene in tobacco, the aroma quality of roasted tobacco leaves and/or the drought resistance of tobacco; further preferably applied to improving the ABA stress and drought stress resistance of tobacco.

Preferably, the tobacco NtPIF1 gene is silenced, knocked out or mutated, and the application of the gene in improving the carotenoid of tobacco, improving the aroma quality of flue-cured tobacco leaves and/or improving the drought resistance of tobacco is realized.

The invention utilizes the gene editing technology and the transgenic technology to inactivate or excessively express the protein coded by the endogenous NtPIF1 gene in tobacco, and after three homozygous NtPIF1 gene editing and over-expressing materials are obtained, the gene editing and over-expressing materials have the following 1) 2) 3) 4) applications:

1) Regulating the content of endogenous carotenoid substances in the tobacco;

2) Participating in the germination and growth development of tobacco seeds under the stress treatment of ABA and mannitol;

3) Participating in the growth and development of tobacco under drought stress;

4) And (5) adjusting the aroma quality of the flue-cured tobacco leaves.

The content of the substances participating in the regulation of the endogenous carotenoid substances in the tobacco is the content of the substances of carotenoid compounds such as violaxanthin, neoxanthin, lutein, beta-carotene and the like.

After ABA treatment with different concentrations participating in ABA and mannitol stress, the germination rates of the NtPIF1 mutant materials are both obviously increased, and the germination rates of over-expressed materials are obviously reduced; and after transferring the normally growing seedlings to 3. Mu.M ABA and 250mM mannitol treatment, the dominant root length of the NtPIF1 mutant material was found to be significantly longer than that of the WT, and the dominant root length of the over-expressed material was found to be significantly shorter than that of the WT.

Under the condition of normal water supply treatment, the relative water content, the survival rate, MDA, PRO, POD, CAT, SOD and the like of the NtPIF1 overexpression and the mutant material have no significant difference compared with the respective wild type control. After taking part in drought stress and carrying out water cut-off treatment for 2 weeks, compared with a wild type control, the physiological indexes of the NtPIF1 overexpression material, such as relative water content, survival rate, PRO, POD, CAT, SOD, and the like, are all obviously reduced, and the physiological indexes of the NtPIF1 mutant material, such as relative water content, survival rate, PRO, POD, CAT, SOD, and the like, are all obviously higher than those of the wild type material.

After the tobacco leaves after being baked are subjected to the regulation of the aroma quality, the aroma component content generated by the degradation of the plastid pigment in the baked tobacco leaves is obviously increased and the aroma quality is obviously improved after the mutation of the NtPIF1 gene in the genome of the common tobacco; after the NtPIF1 gene is over-expressed, the content of aroma components generated by the degradation of plastid pigment in the baked tobacco leaves is obviously reduced, and the quality of aroma is obviously reduced.

Has the advantages that:

experiments prove that the content of endogenous carotenoid substances in tobacco can be increased or reduced by inhibiting or over-expressing the protein level of the NtPIF1 gene expressed in the tobacco, the quality of the tobacco leaves after the tobacco is baked is improved or reduced, and the tolerance of the tobacco to stresses such as ABA, mannitol, drought and the like is improved or reduced. Therefore, the invention discovers the key gene NtPIF1 which can simply and effectively regulate the content of carotenoid substances in plants, the aroma quality of the roasted tobacco leaves, the response to ABA, drought and other stresses, the gene can be applied to the high-efficiency cultivation of new tobacco varieties with high carotenoid and strong drought resistance, and a new method is provided for cultivating the tobacco genetic engineering strains with carotenoid differences. Has very important value and significance in the fields of food science, medicine and molecular plant breeding.

Drawings

FIG. 1 cloning of the NtPFIF1 Gene

FIG. 2 NtPFIF1 Gene editing homozygous insertion site and coding protein sequence

FIG. 3 pCAMBIA1305 vector map

FIG. 4 identification of NtPFIF1 overexpression Material

FIG. 5 identification of carotenoid content in NtPIFIF 1 mutants and over-expressed materials

FIG. 6 statistics of aroma components of degradation of plastid pigment in tobacco leaves after roasting of NtPIFIF 1 mutant materials

FIG. 7 significant difference of aroma components in tobacco leaves after roasting of NtPEFIF 1 mutant materials

FIG. 8 significant differences in aroma components in tobacco leaves after baking with NtPFIF1 overexpression material

FIG. 9 statistics of aroma components of degradation of plastid pigment in tobacco leaves after baking of NtPIFIF 1 overexpression material

FIG. 10 total score and quality grade of flue-cured tobacco leaf of NtPIFIF 1 mutant material C3F

FIG. 11 general score and quality grade of tobacco leaves after roasting of NtPIFI1 overexpression material C3F

FIG. 12 germination rates of NtPEFIFO 1 mutant materials after ABA and mannitol stress

FIG. 13 germination rates of NtPEFIFO 1 overexpression materials after ABA and mannitol stress

FIG. 14 root length of NtPEFIFO 1 mutant Material after ABA and mannitol stress

FIG. 15 root length of NtPEFIF 1 overexpression Material after ABA and mannitol stress

FIG. 16 significant decrease in drought resistance of NtPFIF1-overexpressed tobacco

FIG. 17 significant improvement of drought resistance of NtPEFIF 1 knockout mutant tobacco

FIG. 18 Effect of drought on photosynthetic Properties of NtPIF1 mutant Material

FIG. 19 Effect of drought on photosynthetic Properties of NtPIF1 overexpression Material

FIG. 20 influence of drought on chlorophyll content and chlorophyll fluorescence kinetic parameters of NtPIF1 overexpression material

FIG. 21 influence of drought on chlorophyll content and chlorophyll fluorescence kinetic parameters of NtPIF1 mutant material

Detailed Description

The technical solutions of the present invention are further described below with reference to the following examples and accompanying drawings, which are used for illustrating the present invention and are not intended to limit the scope of the present invention. The examples were carried out under conventional conditions, if indicated otherwise.

Example 1 tobacco seedling culture and NtPIF1 Gene amplification

Wild type WT tobacco seeds were sterilized with 75% ethanol for 30s, then soaked in 15% H2O2 solution for 10min, washed with distilled water 3 times, sown on 1/2MS (Murashigeand Skoog) solid medium, and placed in a 22 ℃ light incubator for germination and growth under the conditions of (25 +/-1) ° C and light for 16h/d.

When the tobacco seedling grows to be 'two leaves and one heart', about 0.1g of tobacco leaves are cut by sterilized scissors, and after the tobacco leaves are rapidly ground by liquid nitrogen, the tobacco leaves are used for RNA extraction: the experimental drugs were purchased from Guangzhou Rui Bo Biotech, inc. The mortar, the gun head, the centrifuge tube and other articles are soaked in 1% DEPC water for one night in advance and then sterilized at high temperature and high pressure for standby. Taking about 0.1g of fresh seedlings, grinding into powder in liquid nitrogen, adding 1ml of TRIZOL extracting solution, mixing, and standing for 10min; centrifuging at 4 deg.C for 10min at 12,000r/min; taking supernatant, adding 300 μ l chloroform, mixing, standing for 5min, centrifuging at 4 deg.C for 15min at 000r/min for 3 layers, and placing RNA in upper water phase; transferring 500 mul of water phase into a new centrifugal tube, adding equal volume of isopropanol for precipitation for 10-20 min; centrifuging at 12,000r/min for 10min, and discarding the supernatant; washing with 75% alcohol for 1-2 times, centrifuging for 2min at 7,000r/min, drying for about 3min, adding 60 μ l RNase-free water, shaking gently to dissolve RNA, performing reverse transcription according to PrimeScript RT-PCR Kit (TaKaRa, dalian, china) instructions provided by Vazyme, performing PCR amplification on the product by using NtPIF1-F/R (Table 1) primers, performing 1% agarose gel electrophoresis detection, and finding that the size of the band is consistent with that of the target product (figure 1), wherein the sequencing result is consistent with the result shown in SEQ ID No. 1.

TABLE 1 primers of example 1

EXAMPLE 2 obtaining of tobacco NtPIF1 homozygous mutant material and homozygous overexpressed material

The PCR product in example 1 was detected by 1% agarose gel electrophoresis, purified, ligated into pEASY-Blunt Zero Cloning kit vector, transformed into E.coli DH 5. Alpha. Competent cells, transformants were screened and cultured for 12h with LB solid medium containing kanamycin (50 mg/L), single clones were picked for bacterial liquid PCR validation, positive clones were subjected to bidirectional sequencing to obtain positive plasmid Blunt-NtPIF1 containing NtPIF1 gene sequence.

The method is characterized in that a Blunt-NtPIF1 positive plasmid obtained by cloning is used as a template, three NtPIF1 homozygous insertion mutant materials are obtained by utilizing CRISPR/Cas9 technology through conventional operation, the gene editing sites are shown in Table 2, the amino acid coded by the NtPIF1 gene after mutation is completely different from the amino acid normally coded by the NtPIF1 (figure 2), and the result can cause the activity deletion or inhibition of the tobacco NtPIF1 gene coding protein.

Mutant tobacco genome DNA is extracted by an SLS method, high-fidelity PCR amplification is carried out by using ntpif1-F/R primers, 1% agarose gel electrophoresis detection is carried out, sequencing is carried out by trui Bo biotechnology limited, and three homozygous mutant materials are obtained by screening and identifying.

The modified plant binary expression vector PCAMBIA1305.1 is used as a skeleton vector for constructing an NtPIF1 overexpression vector, the used primer is NtPIF1-1305-F/R, the bacterial screening resistance is kanamycin, and the vector map is shown in figure 3. The Blunt-NtPIF1 positive plasmid obtained by cloning is taken as a template, and the three NtPIF1 over-expression materials are obtained by utilizing the conventional operation of a transgenic technology. As shown in fig. 4, the amount of expression of the ntpi 1 gene after overexpression was significantly higher than that of the control.

TABLE 2 NtPIFIF 1 Gene editing sites

TABLE 3 primers of example 2

Primer name	5’-3’
		ntpif1-F	TTAGGTTTACCCGCCAATA
ntpif1-R	TCCTGTGGTTGGCATGCACATACAA
		NtPIF1-1305-F	gaacgataggagctcggtaccATGAATCATTCAGTTCCTGATTTTGA
NtPIF1-1305-R	tttgcggacctgcaggtcgacTCACCATATGCAACAACTAGACTTTTC
		qActin-F	CAAGGAAATCACCGCTTTGG
qActin-R	AAGGGATGCGAGGATGGA
		NtPIF1-qPCR-F	CAAGATCCAATGCTAAATCCACGCCG
NtPIF1-qPCR-R	TGGTTTCTACATGAACATAGTCGG

Example 3 determination of carotenoid content in tobacco NtPIF1 mutants and over-expressed Material and determination of Gene expression level of carotenoid biosynthetic pathway

Treating the three mutant materials of ntpif1-1, ntpif1-2 and ntpif1-3 and WT seeds obtained by identification in example 2 by 0.1 AgNO3 for 10min, washing with clear water and drying in the air, then raising seedlings and performing temporary planting according to a tray seedling raising method, selecting 6-week-old tobacco seedlings with consistent growth vigor, quickly freezing by liquid nitrogen and freeze-drying, grinding to powder, accurately weighing 0.05g, placing in a 15mL centrifuge tube, adding 90% acetone (containing 0.1 BHT), inverting and mixing uniformly, performing ultrasonic 20min,12000rpm centrifugation for 5min, taking the supernatant by using a 1mL filter, passing through a 0.22um organic membrane, injecting into a 1mL brown sample bottle, and injecting 10ul samples. Mobile phase: isopropanol, 80% acetonitrile, flow rate 0.5ml/min. A chromatographic column: waters Nova-Pak C18 column, 3.9X 150mm,4 μm. The instrument comprises the following steps: HPLC HITACHI5430 DAD detector.

The results are shown in FIG. 5A. The content of beta-carotene, violaxanthin, lutein and neoxanthin in the materials of the three mutants of NtPIF1-1, ntPIF1-2 and NtPIF1-3 is obviously higher than that of WT, and the result shows that the deletion of the protein coded by the NtPIF1 gene in the tobacco leads to the increase of the content of carotenoid substances in the tobacco. In contrast, the β -carotene, violaxanthin, lutein and neoxanthin contents in the material of the 3 over-expressed lines OE3, OE7 and OE16 of ntpi 1 were all significantly lower than WT, which suggests that overexpression of the ntpi 1 gene in tobacco results in a decrease in the carotenoid content in tobacco (fig. 5B).

In order to further clarify the influence of NtPIF1 on the synthesis and accumulation of carotenoid substances in tobacco, RNA of the tobacco leaf is extracted, and the structural genes of carotenoid biosynthesis pathways in NtPIF1 mutants and overexpression materials are determined. After the NtPIF1 is over-expressed, the expression levels of PSY, PDS, ZDS, LCYB and CRTISO are obviously reduced, especially the gene expression levels of PDS, ZDS and LCYB are reduced by about 1 time compared with the wild type; the expression level of the ZEP gene involved in the conversion from the neoxanthin to the violaxanthin in different transgenic lines has no significant difference compared with the control, which is probably related to the generation of the zeaxanthin and the violaxanthin through the interconversion in the metabolic flux. In contrast, the expression levels of PDS, ZDS, LCYB and CRTISO were significantly up-regulated in the ntpi 1 mutant material.

This example illustrates that the NtPIF1 gene negatively regulates the synthesis of beta-carotene, violaxanthin, neoxanthin, lutein, and other substances in the metabolic pathway of tobacco carotenoid biosynthesis. Quantitative results show that the NtPIF1 can systematically and negatively regulate the whole carotenoid metabolic pathway, and provide a research basis for researching the participation of the NtPIF1 in regulating the terpene metabolism. Therefore, the gene has important application in cultivating plant materials with high carotenoid substances.

The above-mentioned gene expression level measurement method

The reagent kit and the operation instruction of Premix Ex TaqTM (Perfect Real Time) (TakaPa company) were performed in three times, the POD, SOD and CAT enzyme activities were performed with reference to the reagent kit instruction provided by Baijin technology Co., ltd. In Beijing equation, and slightly modified, and the MDA content was measured with reference to the plant Malondialdehyde (MDA) detection reagent kit (Beijing Lei Gen Biotechnology Co., ltd.).

TABLE 4 fluorescent quantitative primer of example 3

Example 4

4.1 identification of tobacco fragrance component of tobacco after baking tobacco carotenoid functional gene module material

In order to further analyze the aroma quality of the carotene aroma component functional gene module material, the neutral aroma components generated by the degradation of plastid pigments in the baked tobacco leaves of the C3F grade are detected and analyzed. Distilling the baked tobacco powder with steam, extracting neutral aroma components with dichloromethane solvent, and detecting aroma components quantitatively by LC-MS. In the post-cured tobacco powder of the ntpi 1 mutant material, a total of 19 aroma components generated by the degradation of plastid pigments were detected, of which 74% of the aroma components, amounting to 14, were significantly higher than in the wild-type control (fig. 6). Compared with the tobacco 300 in the wild control, the neutral aroma components such as 6-methyl-5-hepten-2-ol, beta-damascenone, geranylacetone, megastigmatrienone, beta-dihydrodamascenone, farnesylacetone, neophytadiene, solanone and the like in the roasted tobacco leaves of the NtPIF1 mutant materials pif1-1 and pif1-2 are obviously increased (figure 7).

In contrast, in tobacco powder after the ntpi 1 overexpression material was cured, various aroma components generated by the degradation of plastid pigments were significantly lower than those of the wild-type control. Of the 18 aroma components detected, there were 61% aroma components, 11 in total, which were significantly lower than the wild-type control (fig. 9). Compared with the wild control K326, the neutral aroma components such as beta-damascenone, geranylacetone, megastigmatrienone, beta-damascenone, farnesylacetone and neophytadiene in the baked tobacco leaves with the NtPIF1 overexpression materials OE3 and OE7 are remarkably reduced (figure 8).

4.2 evaluation of tobacco fragrance quality after baking tobacco leaf with tobacco carotenoid functional gene module material

Tobacco leaves subjected to tobacco cutting and rolling after the tobacco leaves are baked, wherein the tobacco leaves are subjected to overexpression of NtPIF1 and mutant material C3F, and the tobacco leaves are balanced in a constant temperature and humidity box for 48 hours and then evaluated by a tobacco industry product quality supervision and inspection test center of Ministry of agriculture. Results as shown in tables 4 and 5, both ntpi 1 overexpression and mutant and their respective controls smoke 300 and K326 belong to the middle notes. The NtPIF1 mutant material, particularly NtPIF1-1, has no obvious difference in concentration, aroma quality, combustibility and ash content compared with the smoke 300 in the control, and the aroma quantity and aftertaste are obviously higher than those of the smoke 300 in the control. The overall score and quality grade were significantly better than the control smoke 300 (figure 10).

The NtPIF1 overexpression materials OE3 and OE7 were significantly lower than the control K326 in terms of concentration, aroma quality, aroma amount and aftertaste, and the overall score and quality grade were significantly lower than the control K326 (fig. 11). The result shows that the tobacco aroma quality can be effectively adjusted by the NtPIF1 gene, and the aroma quantity and aftertaste of the tobacco are improved by knocking out the NtPIF1 gene.

TABLE 4 aroma quality evaluation results of flue-cured tobacco leaves of NtPFIF1 mutant material C3F

TABLE 5 fragrance quality evaluation result of flue-cured tobacco leaf of NtPFIF1 overexpression material C3F

Example 5 different ntpi 1 mutants, overexpression and WT material seed germination under ABA and mannitol stress and major root length variation

After 14 days of growth on medium containing 3. Mu.M ABA, 250mM mannitol and normal 1/2MS, the phenotype and statistical germination were observed, as shown in FIGS. 12-13. The germination rates of NtPIF1-1, ntPIF1-2 and NtPIF1-3 in a normal 1/2MS culture medium are not obviously different, but the germination rates of mutant materials are obviously higher than that of WT under the treatment of 3 mu M ABA and 250mM mannitol, which shows that the deletion of the NtPIF1 gene causes the increase of the germination rate of the seeds of the tobacco after the stress of ABA and mannitol; in contrast, the germination rates of OE3, OE7 and OE16 in normal 1/2MS culture medium are not obviously different, but the germination rates of over-expressed materials are all significantly higher than that of WT under the treatment of 3 mu M ABA and 250mM mannitol, which indicates that the over-expression of the NtPIF1 gene causes the reduction of the seed germination rate of tobacco after the stress of ABA and mannitol.

To further investigate the response of the ntpi 1 gene to ABA and mannitol stress, the present invention observed phenotype and determined major root length after 2 weeks of transplanting tobacco seedlings grown to 1 week old by normal 1/2MS into 1/2MS medium containing 3 μ M ABA and 250mM concentration, as shown, the major root length of mutant material was significantly higher than WT (fig. 14) and the major root length of over-expressed material was significantly lower than WT (fig. 15) no matter under 3 μ M ABA stress or under 250mM mannitol stress. This example thus demonstrates that the tobacco ntpi 1 gene functions to be sensitive to ABA and mannitol stress.

Example 6 variation of phenotype, physiological indices of different NtPIF1 mutants, overexpression and WT Material after drought treatment

After the mutant and the wild type material with the age of 4 weeks obtained by seedling culture according to the method of the embodiment 2 are subjected to water shortage treatment for 2 weeks, the phenotype is observed, as shown in the figure, the water is cut off after the seeds germinate for 4 weeks, the NtPIF1 expression quantity is detected after 2 weeks, and the drought resistance indexes such as the relative water content and the survival rate are counted; meanwhile, physiological indexes such as Malondialdehyde (MDA), proline (PRO), peroxidase (POD), catalase (CAT), superoxide dismutase (SOD) and the like are detected.

The results show that under normal water treatment conditions, there were no significant differences between the relative water content, survival rate, MDA, PRO, POD, CAT, SOD, etc. of the ntpi 1 overexpression and mutant materials, compared to their respective wild-type controls. In contrast, under drought treatment, the relative water content, the survival rate, and physiological indicators such as PRO, POD, CAT, and SOD of the ntpi 1 overexpression material were all significantly reduced compared to the wild-type control (fig. 16), while the relative water content, the survival rate, and physiological indicators such as PRO, POD, CAT, and SOD of the ntpi 1 mutant material were all significantly higher than those of the wild-type material (fig. 17). The results show that the NtPIF1 gene can negatively regulate the drought resistance of tobacco.

The existing research shows that drought stress mainly influences the physiological processes of stomata aperture, cell metabolism, photosynthesis and the like of plants, so that the growth and development of the plants are inhibited, and the yield and the quality are influenced. Photosynthesis is the most important chemical reaction on the earth, and the strength of photosynthesis under adversity stress reflects the capability of plants in resisting the adversity stress. To explore the effects of drought on the overexpression of ntpi 1 and the photosynthetic properties of mutant materials, we examined the overexpression of ntpi 1 and the photosynthetic intensity of mutant materials before and after drought treatment using a Li-Cor 6400 photosynthesizer. The light intensity was set to 1500. Mu. Mol/(m 2. S-1), the flow rate was set to 500mL/s, and the measurement time was 9-12 a.m..

The results show that under the condition of normal water supply treatment, the photosynthesis indexes of the overexpression of the NtPIF1, the photosynthetic rate of the mutant material, the stomatal conductance, the transpiration rate and the like have no obvious difference compared with the respective wild type control. Under drought stress conditions, compared with wild type controls, the photosynthetic rate, stomatal conductance and transpiration rate of the NtPIF1 overexpression material are all significantly lower than those of the wild type controls WT (fig. 19), which indicates that the photosynthesis intensity of tobacco under drought conditions is significantly reduced by the NtPIF1 gene overexpression. In contrast, under drought conditions, in the ntpi 1 mutant material, the photosynthetic rate, stomatal conductance and transpiration rate of the leaves are all significantly higher than those of the wild-type control (fig. 18), indicating that the mutation of the ntpi 1 gene significantly enhances the photosynthetic intensity of tobacco under drought conditions.

Chloroplast is a place where plants carry out photosynthesis, and in order to further explore the influence of drought on the overexpression of NtPIF1 and the photosynthesis of mutant materials, the chlorophyll content and chlorophyll fluorescence kinetic parameters of the materials under drought treatment are detected and analyzed. The results show that under drought treatment, compared with wild type control, the chlorophyll content in the ntpi 1 overexpression material is significantly reduced, and the corresponding chlorophyll fluorescence kinetic parameters Fv/Fm, NPQ, qN and Rfd are also significantly reduced, which indicates that the overexpression material has reduced ability to absorb, transmit, convert and utilize light energy, and is not beneficial to the plant to resist adversity stress (fig. 20). In contrast, in the mutant material under drought treatment conditions, the chlorophyll content of the leaves was significantly higher than that of the wild-type control, and the corresponding chlorophyll fluorescence kinetic parameters Fv/Fm, NPQ, qN, rfd were also significantly increased compared to the wild-type (fig. 21). The results show that the tobacco phytochrome interaction factor NtPIF1 negatively regulates the drought resistance of the tobacco by influencing the photosynthesis capacity of the tobacco under the drought condition.

Sequence listing

<110> tobacco institute of Chinese academy of agricultural sciences (Qingzhou tobacco institute of Chinese tobacco Co., ltd.)

<120> tobacco NtPIF1 gene and its coding protein and application

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1701

<212> DNA

<213> tobacco (Nicotiana tabacum L.)

<400> 1

atgaatcatt cagttcctga ttttgatatg gatgatgact acactattcc tacgtcttct 60

ggtcttacca gacctaaaaa gtctgcaatg gcggaagagg atatcatgga actattgtgg 120

cataatggac aagtggttat gcagagccaa aatcaaagat ctctgaagaa atctcacatt 180

agcaacggcg gtggcggagg tggcagcggt gatgcgctta ttccctccga acaagctgtc 240

agtagagaga tccgacatgt agaggaaact actacaccac agcaactgtt tatgcaggag 300

gacgagatgg cctcatggct tcactaccca ctcgatgact cctcctcctt cgaacgtgat 360

ctttacgccg atctccttta ttccacaccg agcgcaaccg ttacaaccgc tgcgccgccg 420

cgagaaatcc gtacgccccc ggtggagatc cgtccacctc cgccgcatcc atcccctgca 480

ccgccgattg cagtggctcc acgaccgcct atacctcctc ctgcaagacg tcccggcact 540

gaaagctcac atcggttcca gaacttcgga cacttctcgc gattgcctag tcgaacaagg 600

tcagaacttg gtccgtcaaa ttcgagcaag tcacctagag aatcaacggt tgtggactca 660

aacgaaactc caatttcagg gcctgaatct agggtttcac aggtagcgga taatgtagta 720

ccggttcccg gcggaaatgg agcatgtggg gctgtaaatg tcaacggaac tgcgactgcg 780

tcaacggcaa ttagggaacc ggcgacaaca tgtgagcttt cggtgacgtc atctcccggc 840

tcaggaaaca gtataaacgc cagcgctgaa ccaccgctgt cggaaacggc ggcgttggcg 900

acaccgacgg ctgcggcatc gaatgatcgg aaacgcaaag gaatagaaac ggacgacggg 960

gatggtcaga atgaggacgc tgaatttggg tctggtgata caaagaagca tgcacgtggt 1020

tcaacgtcta caaaacgatc tcgtgctgca gaggtccata atctttcgga aaggagacgt 1080

cgagacagaa taaatgagaa gatgagggct ctgcaggaac tgataccacg ctgtaacaag 1140

acagacaaag cttcaatgct ggatgaggca attgagtatt tgaaatcact gcaattgcaa 1200

gtgcagatga tgtccatggg atgcggcatg gtcccgatga tgtatcctgg aatgcagcaa 1260

tacatgccag ctatgggaat gggcatggtg ggaatgggta tggagattgg catgaacagg 1320

ccaatggttc catatccacc tctattacca ggtgcagcga tgcagaatgc agctgcagca 1380

gcacaaatgg gtcctagatt tcctatggca ccgtttcatt tgccaccagt tccagtacca 1440

gatccttcca ggatgcaagc ctcaagtcag caagatccaa tgctaaatcc acttgtagca 1500

cgtaatccca accagccaag acttccgaat tttaatgatc catatcaaca gcattttggt 1560

ctccaccagg cacaagtgca attaccgcag gcaagtcctt cttcttcgac ttggttctta 1620

gttcatttat tatcatgccg actatgttca tgtagaaacc agtcaaccac cattgaaaag 1680

tctagttgtt gcatatggtg a 1701

<210> 2

<211> 566

<212> PRT

<213> tobacco (Nicotiana tabacum L.)

<400> 2

Met Asn His Ser Val Pro Asp Phe Asp Met Asp Asp Asp Tyr Thr Ile

1 5 10 15

Pro Thr Ser Ser Gly Leu Thr Arg Pro Lys Lys Ser Ala Met Ala Glu

20 25 30

Glu Asp Ile Met Glu Leu Leu Trp His Asn Gly Gln Val Val Met Gln

35 40 45

Ser Gln Asn Gln Arg Ser Leu Lys Lys Ser His Ile Ser Asn Gly Gly

50 55 60

Gly Gly Gly Gly Ser Gly Asp Ala Leu Ile Pro Ser Glu Gln Ala Val

65 70 75 80

Ser Arg Glu Ile Arg His Val Glu Glu Thr Thr Thr Pro Gln Gln Leu

85 90 95

Phe Met Gln Glu Asp Glu Met Ala Ser Trp Leu His Tyr Pro Leu Asp

100 105 110

Asp Ser Ser Ser Phe Glu Arg Asp Leu Tyr Ala Asp Leu Leu Tyr Ser

115 120 125

Thr Pro Ser Ala Thr Val Thr Thr Ala Ala Pro Pro Arg Glu Ile Arg

130 135 140

Thr Pro Pro Val Glu Ile Arg Pro Pro Pro Pro His Pro Ser Pro Ala

145 150 155 160

Pro Pro Ile Ala Val Ala Pro Arg Pro Pro Ile Pro Pro Pro Ala Arg

165 170 175

Arg Pro Gly Thr Glu Ser Ser His Arg Phe Gln Asn Phe Gly His Phe

180 185 190

Ser Arg Leu Pro Ser Arg Thr Arg Ser Glu Leu Gly Pro Ser Asn Ser

195 200 205

Ser Lys Ser Pro Arg Glu Ser Thr Val Val Asp Ser Asn Glu Thr Pro

210 215 220

Ile Ser Gly Pro Glu Ser Arg Val Ser Gln Val Ala Asp Asn Val Val

225 230 235 240

Pro Val Pro Gly Gly Asn Gly Ala Cys Gly Ala Val Asn Val Asn Gly

245 250 255

Thr Ala Thr Ala Ser Thr Ala Ile Arg Glu Pro Ala Thr Thr Cys Glu

260 265 270

Leu Ser Val Thr Ser Ser Pro Gly Ser Gly Asn Ser Ile Asn Ala Ser

275 280 285

Ala Glu Pro Pro Leu Ser Glu Thr Ala Ala Leu Ala Thr Pro Thr Ala

290 295 300

Ala Ala Ser Asn Asp Arg Lys Arg Lys Gly Ile Glu Thr Asp Asp Gly

305 310 315 320

Asp Gly Gln Asn Glu Asp Ala Glu Phe Gly Ser Gly Asp Thr Lys Lys

325 330 335

His Ala Arg Gly Ser Thr Ser Thr Lys Arg Ser Arg Ala Ala Glu Val

340 345 350

His Asn Leu Ser Glu Arg Arg Arg Arg Asp Arg Ile Asn Glu Lys Met

355 360 365

Arg Ala Leu Gln Glu Leu Ile Pro Arg Cys Asn Lys Thr Asp Lys Ala

370 375 380

Ser Met Leu Asp Glu Ala Ile Glu Tyr Leu Lys Ser Leu Gln Leu Gln

385 390 395 400

Val Gln Met Met Ser Met Gly Cys Gly Met Val Pro Met Met Tyr Pro

405 410 415

Gly Met Gln Gln Tyr Met Pro Ala Met Gly Met Gly Met Val Gly Met

420 425 430

Gly Met Glu Ile Gly Met Asn Arg Pro Met Val Pro Tyr Pro Pro Leu

435 440 445

Leu Pro Gly Ala Ala Met Gln Asn Ala Ala Ala Ala Ala Gln Met Gly

450 455 460

Pro Arg Phe Pro Met Ala Pro Phe His Leu Pro Pro Val Pro Val Pro

465 470 475 480

Asp Pro Ser Arg Met Gln Ala Ser Ser Gln Gln Asp Pro Met Leu Asn

485 490 495

Pro Leu Val Ala Arg Asn Pro Asn Gln Pro Arg Leu Pro Asn Phe Asn

500 505 510

Asp Pro Tyr Gln Gln His Phe Gly Leu His Gln Ala Gln Val Gln Leu

515 520 525

Pro Gln Ala Ser Pro Ser Ser Ser Thr Trp Phe Leu Val His Leu Leu

530 535 540

Ser Cys Arg Leu Cys Ser Cys Arg Asn Gln Ser Thr Thr Ile Glu Lys

545 550 555 560

Ser Ser Cys Cys Ile Trp

565

Claims

1. Sink with a metal plateSilent, knockout or mutation tobaccoNtPIF1Application of gene in improving resistance of tobacco to ABA stress and drought stress, and tobaccoNtPIF1The CDS sequence of the gene is shown as SEQ ID No. 1.