CN107916265A - One aptamer and its screening technique that can be specifically bound with Cefquinome - Google Patents
One aptamer and its screening technique that can be specifically bound with Cefquinome Download PDFInfo
- Publication number
- CN107916265A CN107916265A CN201711286767.5A CN201711286767A CN107916265A CN 107916265 A CN107916265 A CN 107916265A CN 201711286767 A CN201711286767 A CN 201711286767A CN 107916265 A CN107916265 A CN 107916265A
- Authority
- CN
- China
- Prior art keywords
- supernatant
- magneto separate
- added
- selex
- ssdna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/115—Aptamers, i.e. nucleic acids binding a target molecule specifically and with high affinity without hybridising therewith ; Nucleic acids binding to non-nucleic acids, e.g. aptamers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
- C12N15/1034—Isolating an individual clone by screening libraries
- C12N15/1048—SELEX
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/16—Aptamers
Abstract
One aptamer that can be specifically bound with Cefquinome and its screening technique belong to food security and antibiotic detection field.The present invention is based on Magnetic SELEX technologies, using Cefquinome as target molecule, by forward direction screening and reverse screening process, is prepared for high specific and the Cefquinome aptamer of affinity.This method has advantage easy to operate, screening process cost is low.Obtain and aptamer has the characteristics that stability is strong, synthesis is convenient and is easy to mark, the application for supervision and the analysis detection etc. of aptamer Cefquinome in food, medicine and biological products provides scientific basis and theoretical foundation.
Description
Technical field
The invention belongs to food security and antibiotic detection field, is related specifically to utilize in Protocols in Molecular Biology
SELEX technologies (the aglucon phyletic evolution technology of index concentration) are screened the nucleic acid that can be specifically bound with Cefquinome and are adapted to
Body and its screening technique.For the supervision and analysis detection of aptamer Cefquinome in food, medicine and biological products
Etc. application scientific basis and theoretical foundation are provided.
Background technology
Since 21st century, the animal husbandry in China develops rapidly.The various Huinongs that country puts into effect in succession in recent years
Policy, increases the fund and support on policy dynamics of aquaculture.In order to reduce the incidence and mortality of the animals such as ox, pig, carry
High efficiency of feed utilization and the quality for improving product, use of the antibiotic in animal husbandry are more and more extensive.With expanding economy,
The consumption of the animal derived food such as the improvement of people's living standards, various beef and mutton, dairy produce, poultry, egg is also increasing.Cause
This, strictly controls animal food safety, has very important significance to the health of consumer.Cefquinome belongs to interior acyl
Amine antibiotic, also known as HOE 111, Cefquinome, are that a currently the only animal specific the 4th generation cephalosporins for animals resists
Raw element.Its has a broad antifungal spectrum, antibacterial activity are strong, absorption is fast, toxic side effect is small and bioavilability is high, and approval will extensively both at home and abroad
It is applied to the clinical treatment of the bacterium infections such as pig, bovine respiratory and mastitis for milk cows.However, abuse of antibiotics in aquaculture,
Often cause to contain Cefquinome antibiotic residue in its meat products and dairy products, after food chain is eaten by the mankind, can lead
The intestines problems such as diarrhea, vomiting are caused, it is even dead that severe patient also results in organ failure.Since it is widely present in daily life
Food, in medicine and biological products, seriously endangered the healthy and safe of product quality and the people.
At present, the method for traditional detection Cefquinome mainly has microbiological method, such as paper disk method, four nitrogen of chlorinated triphenyl base
Detection method is irrigated by azoles experiment i.e. TTC methods, Dell；High performance liquid chromatography (HPLC)；Immunoassay etc..But these methods detect
Time-consuming, sensitivity is low, it is impossible to meets the market demand of rapid sensitive.Meanwhile some of which method is easily subject to protease etc.
Influence and cause result inaccurate.Therefore it is particularly significant to develop new detection method.
Aptamer be refer to target molecule specificity, high affine the single-stranded oligo DNA or RNA combined, one
Section is by 20-90 base composition.It is a kind of new combinatorial chemistry technique --- the external index to grow up the nineties in last century
Enrichment Fas lignand system evolution (SELEX) technology obtains.As a kind of new bionical identification molecule, aptamer can be special
The identification of property and various target molecules of combining closely.It is similar to the specific recognition of antibody-antigene, but compared with antibody-antigene,
It has more advantages, such as high-affinity, and activity stabilized, easy modification, cost is low, it is simple to prepare and is denatured and renaturation is reversible etc.
Feature.And be not limited only to the specific binding with protein, its target molecule scope include drug molecule, amino acid, metal from
Sub, various microorganisms and cell etc..Caused extensively in the application of food security, food inspection and disease treatment etc. in recent years
General concern.
By the development of recent decades, developed various SELEX technologies, as CE-SELEX,
Magnetic-SELEX, Capture-SELEX and Cell-SELEX etc..The present invention is based on Magnetic-SELEX technologies, with head
Spore quinoline oxime is target molecule, by forward direction screening and reverse screening process, is prepared for high specific and the Cefquinome core of affinity
Sour aptamers.This method has advantage easy to operate, screening process cost is low.The aptamer obtained has stability
By force, the features such as synthesis is convenient and is easy to mark, can be used for many analysis detections such as food and medicine.
The content of the invention
It is an object of the invention to overcome the shortcomings of existing detection technique, there is provided one kind has more affine than protein antibodies higher
Specificity, non-immunogenicity, be capable of chemical synthesis, molecular weight is small and property is stablized the nucleic acid that can be used for detection Cefquinome
Aptamers.The present invention uses Magnetic-SELEX technologies, using Cefquinome as target molecule, using ampicillin as reverse screening
Target, filters out the aptamer with Cefquinome specific binding.
Above-mentioned purpose is achieved through the following technical solutions：
1. ssDNA libraries and primer shown in the following sequence of synthesis：
SsDNA libraries：
5’-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3’；
Upper primer：5’-AGCAGCACAGAGGTCAGATG-3’；
Lower primer：5’–biotin-TTCACGGTAGCACGCATAGG-3’.
2SELEX technology screening specific nucleic acid aptamers
Used in SELEX technology screening overall processes：2 × SELEX combination liquid final concentration forms:20mM Tris-HCl,
2mM MgCl2, 5mM KCl, 1mM CaCl2, 100mM NaCl, the Tween of 12.5ul is added per 100ml 2 × SELEX combination liquid
20, pH 7.6. (2 × SELEX combinations liquid is diluted 1 times by 1 × SELEX combinations liquid)
Cleaning solution final concentration forms：40mM Tris-HCl, 10mM EDTAS, 3.5M urea is clear per 100ml SELEX
Add 12.5ul Tween 20Ph=7.35 in washing lotion
TE buffer solutions final concentration forms：10mM Tris-HCl, 1mM EDTA.
2.1 first round screening steps：
2.1.1 take 2.5OD ssDNA libraries to be dissolved in 250 μ l aqua sterilisas, 95 DEG C of reaction 5min, after ice bath 10min immediately,
It is uniformly mixed with 2 × SELEX combination liquid of 250 μ l, it is spare.
2.1.2 magnetic bead-cephalo is prepared in the coupling specification being connected according to the magnetic bead being commercially available with Cefquinome
The compound that quinoline oxime combines, takes 500 μ l of magnetic bead-Cefquinome compound, is cleaned 3 times with 1 × SELEX combination liquid, (is used with reference to liquid
Amount 100 μ l every time), the ssDNA libraries then added in 2.1.1 in being incubated 1h under room temperature.
2.1.3 after being incubated, 3 times (cleaning solution dosages every time 500 μ l) are cleaned with cleaning solution,
Magneto separate abandons supernatant after cleaning, and 300 μ l TE buffer solutions are added into magnetic bead, is uniformly mixed, boiling water bath
10min.Then Magneto separate, draws supernatant as next round template.
2.1.4 using supernatant obtained by 2.1.3 as template, anti-sense primer and sense primer carry out PCR amplification.
2.2 second wheel screening steps
2.2.1 single stranded DNA is prepared：The Streptavidin MagneSphere of 80 μ l is taken, three times (200 μ l every time) is washed with cleaning solution, adds
Enter into the product of 2.1.4PCR amplifications, shaking capture 30min, Magneto separate removes supernatant, and three times are washed (every time with cleaning solution
100 μ l), the sodium hydroxide solution for adding 50 μ l, 0.2mol/L reacts 5min, and Magneto separate takes supernatant, the dilute hydrochloric acid added afterwards
(0.2mol/L) is adjusted to 7 with extensive PH test paper, and purifying, freeze.Screened as next round in secondary ssDNA libraries.
2.2.2 take the secondary ssDNA libraries that 2.2.1 is screened to be dissolved in 250 μ l aqua sterilisas, react 5min in 95 DEG C,
Ice bath 10min immediately afterwards, is uniformly mixed (500 μ l of final volume) with 2 × SELEX combination liquid of 250 μ l, spare.
2.2.3 magnetic bead-cephalo is prepared in the coupling specification being connected according to the magnetic bead being commercially available with Cefquinome
The compound that quinoline oxime combines, takes 500 μ l of magnetic bead-Cefquinome compound, is cleaned 3 times with 1 × SELEX combination liquid, (is used with reference to liquid
Amount 100 μ l every time), the ssDNA libraries then added in 2.2.2 in being incubated 1h under room temperature.
2.2.4 after being incubated, 3 times (cleaning solution dosages every time 500 μ l) are cleaned with cleaning solution,
Magneto separate abandons supernatant after cleaning, and 300 μ l TE buffer solutions are added into magnetic bead, is uniformly mixed, boiling water bath
10min.Then Magneto separate, draws supernatant as next round template.
2.2.5 using supernatant obtained by 2.2.4 as template, anti-sense primer and sense primer carry out PCR amplification.
2.3 third round amplification steps
2.3.1 single stranded DNA is prepared：The Streptavidin MagneSphere of 80 μ l is taken, three times (200 μ l every time) is washed with cleaning solution, adds
Enter into the product of 2.2.5PCR amplifications, shaking capture 30min, Magneto separate removes supernatant, and three times are washed (every time with cleaning solution
100 μ l), the sodium hydroxide solution for adding 50 μ l, 0.2mol/L reacts 5min, and Magneto separate takes supernatant, the dilute hydrochloric acid added afterwards
(0.2mol/L) is adjusted to 7 with extensive PH test paper, and purifying, freeze.Screened as next round in secondary ssDNA libraries.
2.3.2 take the secondary ssDNA libraries that 2.3.1 is screened to be dissolved in 250 μ l aqua sterilisas, react 5min in 95 DEG C,
Ice bath 10min immediately afterwards, is uniformly mixed with 2 × SELEX combination liquid of 250 μ l, spare.
2.3.3 each round later from third round will first carry out a counter-selection and then once just be sieved again.Counter-selection
Process：Magnetic bead-ampicillin is prepared in the coupling specification being connected according to the magnetic bead being commercially available with ampicillin
With reference to compound, take magnetic bead -500 μ l of counter-selection thing (ampicillin) compound, with 1 × SELEX combination liquid clean 3 times it is (every
Secondary 1ml), ssDNA secondary libraries prepared by 2.3.2 are then added in being incubated 30min under room temperature.Magneto separate draws supernatant,
Positive sieve reaction for next step.
2.3.4 being just sieved through journey is：The supernatant of 2.3.3 is taken, is added to the compound that 500ul magnetic beads-Cefquinome combines
In, incubation time 60min.
2.3.5 after being incubated, Magneto separate abandons supernatant, is cleaned 3 times with cleaning solution, each dosage 500ul, scavenging period
1min.Magneto separate abandons supernatant after cleaning, and 300 μ l TE buffer solutions are added in magnetic bead, is uniformly mixed, boiling water bath 10min.So
Magneto separate afterwards, draws supernatant.Next round template is used as using this supernatant
2.3.6 using supernatant obtained by 2.3.5 as template, anti-sense primer and sense primer carry out PCR amplification.
2.4 fourth round amplification steps
2.4.1 single stranded DNA is prepared：The Streptavidin MagneSphere of 80 μ l is taken, three times (200 μ l every time) is washed with cleaning solution, adds
Enter into the product of 2.3.6PCR amplifications, shaking capture 30min, Magneto separate removes supernatant, and three times are washed (every time with cleaning solution
100 μ l), the sodium hydroxide solution for adding 50 μ l, 0.2mol/L reacts 5min, and Magneto separate takes supernatant, the dilute hydrochloric acid added afterwards
(0.2mol/L) is adjusted to 7 with extensive PH test paper, and purifying, freeze.Screened as next round in secondary ssDNA libraries.
2.4.2 take the secondary ssDNA libraries that 2.4.1 is screened to be dissolved in 250 μ l aqua sterilisas, react 5min in 95 DEG C,
Ice bath 10min immediately afterwards, is uniformly mixed with 2 × SELEX combination liquid of 250 μ l, spare.
2.4.3 each round later from third round will first carry out a counter-selection and then once just be sieved again.Counter-selection
Process：Magnetic bead-ampicillin is prepared in the coupling specification being connected according to the magnetic bead being commercially available with ampicillin
With reference to compound, take magnetic bead -500 μ l of counter-selection thing (ampicillin) compound, with 1 × SELEX combination liquid clean 3 times it is (every
Secondary 1ml), ssDNA secondary libraries prepared by 2.4.2 are then added in being incubated 40min under room temperature.Magneto separate draws supernatant,
Positive sieve reaction for next step.
2.4.4 being just sieved through journey is：The supernatant of 2.4.3 is taken, is added to the compound that 400ul magnetic beads-Cefquinome combines
In, incubation time 50min.
2.4.5 after being incubated, Magneto separate abandons supernatant, is cleaned 4 times with cleaning solution, each dosage 600ul, scavenging period
2min.Magneto separate abandons supernatant after cleaning, and 300 μ l TE buffer solutions are added in magnetic bead, is uniformly mixed, boiling water bath 10min.So
Magneto separate afterwards, draws supernatant.Next round template is used as using this supernatant
2.4.6 using supernatant obtained by 2.4.5 as template, anti-sense primer and sense primer carry out PCR amplification.
2.5 the 5th wheel amplification steps
2.5.1 single stranded DNA is prepared：The Streptavidin MagneSphere of 80 μ l is taken, three times (200 μ l every time) is washed with cleaning solution, adds
Enter into the product of 2.4.6PCR amplifications, shaking capture 30min, Magneto separate removes supernatant, and three times are washed (every time with cleaning solution
100 μ l), the sodium hydroxide solution for adding 50 μ l, 0.2mol/L reacts 5min, and Magneto separate takes supernatant, the dilute hydrochloric acid added afterwards
(0.2mol/L) is adjusted to 7 with extensive PH test paper, and purifying, freeze.Screened as next round in secondary ssDNA libraries.
2.5.2 take the secondary ssDNA libraries that 2.5.1 is screened to be dissolved in 250 μ l aqua sterilisas, react 5min in 95 DEG C,
Ice bath 10min immediately afterwards, is uniformly mixed with 2 × SELEX combination liquid of 250 μ l, spare.
2.5.3 in order to remove the ssDNA libraries with the nonspecific reaction of the combination such as magnetic bead, tube wall, background absorption is reduced,
Screening efficiency is improved, later each round will first carry out a counter-selection and then once just be sieved again from third round.Counter-selection
Process：Magnetic bead-ampicillin is prepared in the coupling specification being connected according to the magnetic bead being commercially available with ampicillin
With reference to compound, take magnetic bead -500 μ l of counter-selection thing (ampicillin) compound, with 1 × SELEX combination liquid clean 3 times it is (every
Secondary 1ml), ssDNA secondary libraries prepared by 2.5.2 are then added in being incubated 50min under room temperature.Magneto separate draws supernatant,
Positive sieve reaction for next step.2.5.4 being just sieved through journey is：The supernatant of 2.5.3 is taken, is added to 300ul magnetic beads-cephalo quinoline
In the compound that oxime combines, incubation time 40min.
2.5.5 after being incubated, Magneto separate abandons supernatant, is cleaned 5 times with cleaning solution, each dosage 700ul, scavenging period
3min.Magneto separate abandons supernatant after cleaning, and 300 μ l TE buffer solutions are added in magnetic bead, is uniformly mixed, boiling water bath 10min.So
Magneto separate afterwards, draws supernatant.Next round template is used as using this supernatant
2.5.6 using supernatant obtained by 2.5.5 as template, anti-sense primer and sense primer carry out PCR amplification.
2.6 the 6th wheel amplification steps
2.6.1 single stranded DNA is prepared：The Streptavidin MagneSphere of 80 μ l is taken, three times (200 μ l every time) is washed with cleaning solution, adds
Enter into the product of 2.5.6PCR amplifications, shaking capture 30min, Magneto separate removes supernatant, and three times are washed (every time with cleaning solution
100 μ l), the sodium hydroxide solution for adding 50 μ l, 0.2mol/L reacts 5min, and Magneto separate takes supernatant, the dilute hydrochloric acid added afterwards
(0.2mol/L) is adjusted to 7 with extensive PH test paper, and purifying, freeze.Screened as next round in secondary ssDNA libraries.
2.6.2 take the secondary ssDNA libraries that 2.6.1 is screened to be dissolved in 250 μ l aqua sterilisas, react 5min in 95 DEG C,
Ice bath 10min immediately afterwards, is uniformly mixed with 2 × SELEX combination liquid of 250 μ l, spare.
2.6.3 in order to remove the ssDNA libraries with the nonspecific reaction of the combination such as magnetic bead, tube wall, background absorption is reduced,
Screening efficiency is improved, later each round will first carry out a counter-selection and then once just be sieved again from third round.Counter-selection
Process：Magnetic bead-ampicillin is prepared in the coupling specification being connected according to the magnetic bead being commercially available with ampicillin
With reference to compound, take magnetic bead -500 μ l of counter-selection thing (ampicillin) compound, with 1 × SELEX combination liquid clean 3 times it is (every
Secondary 1ml), ssDNA secondary libraries prepared by 2.6.2 are then added in being incubated 60min under room temperature.Magneto separate draws supernatant,
Positive sieve reaction for next step.2.6.4 being just sieved through journey is：The supernatant of 2.6.3 is taken, is added to 200ul magnetic beads-cephalo quinoline
In the compound that oxime combines, incubation time 30min.
2.6.5 after being incubated, Magneto separate abandons supernatant, is cleaned 6 times with cleaning solution, each dosage 800ul, scavenging period
4min.Magneto separate abandons supernatant after cleaning, and 300 μ l TE buffer solutions are added in magnetic bead, is uniformly mixed, boiling water bath 10min.So
Magneto separate afterwards, draws supernatant.Next round template is used as using this supernatant
2.6.6 using supernatant obtained by 2.6.5 as template, anti-sense primer and sense primer carry out PCR amplification.
3. obtain Cefquinome aptamer：Often it is glimmering by 5 ' end marks to screen obtained secondary ssDNA libraries for wheel
After light group is combined with target, secondary ssDNA libraries and target binding capability are surveyed with microplate reader.Until fluorescence intensity reaches maximum
Saturation state, obtains Cefquinome aptamer, such as Fig. 4 at this time.
4. cloning and sequencing：By last wheel screening obtained aptamer be sent to Shanghai Sheng Gong Technology Co., Ltd. into
Row may be sequenced, that is, obtain the nucleic acid aptamer sequence described in the claims, i.e. 5 '-AGCAGCACAGAGGTCAGATG
TGGGCGCCGACGTACTAAACAGGGGAACCTACCTGGTTAACC TATGCGTGCTACCGTGAA-3’。
5. affinity analysis：The aptamer of 5 ' end mark fluorescent groups is prepared with the cleaning solution for being not added with Tween 20
Into a series of concentration.Each concentration gradient takes 100 μ l, 90 DEG C of water-bath 10min, 4 DEG C of 15min, room temperature 5min activation, by itself plus
Enter in Cefquinome-bead complexes, 37 DEG C of incubation 30min.Magneto separate collects the supernatant being not bonded on magnetic bead, with enzyme mark
Instrument surveys fluorescence intensity.Using aptamer concentration as abscissa, fluorescence intensity is ordinate, and drafting combines saturation curve, tries to achieve
Kd values are 40.13.As shown in Fig. 2, the binding ability of explanation aptamer and Cefquinome is very strong.
6. specificity analysis：By gained Cefquinome aptamer and Cefquinome and its chaff interferent sulfuric acid cephalo
Sieve, Cefixime, ampicillin control group carry out sensitive fluorescent analysis with microplate reader, it is found that the aptamer is dry at other
Disturb it is most strong to the sensitiveness of Cefixime in the presence of thing, such as Fig. 3.
Advantages of the present invention：
(1) of the invention compared with traditional screening technique, this method has advantage easy to operate, screening process cost is low.
(2) amplifying nucleic acid aptamers of the present invention can screen in vitro, and the screening cycle is short, stability is strong, synthesis is convenient and is easy to
Various report molecules are marked, use can be preserved for a long time.
(3) the obtained aptamer that the present invention screens, can specifically bind with Cefquinome, and affinity is high, can
In the presence of other chaff interferents, Cefquinome molecule is specifically bound.
(4) the aptamer modified different report molecule is utilized in the present invention, various biology sensors can be built,
For detecting the concentration of Cefquinome in milk, many analysis detections such as other food and medicine are can be used for.
Brief description of the drawings
Fig. 1：The secondary structure of Cefquinome aptamer.
Fig. 2：The kd value nonlinear fittings of aptamer.
Fig. 3：Cefquinome extremely chaff interferent sensitive fluorescent is analyzed
Fig. 4：Secondary library and the fluorescence intensity of target binding capability reach saturation state
Embodiment
Experimental method used in following embodiments is conventional method unless otherwise specified.
The materials, reagents and the like used in the following examples, is commercially available unless otherwise specified.
Embodiment 1：Synthesize ssDNA libraries and the primer shown in following sequence
1.ssDNA libraries：
5’-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3’；Middle N40 is 40 alkali
The random sequence of base, both ends are respectively the fixed sequence program of 20nt, and storage capacity is 1014More than.
Upper primer：5’-AGCAGCACAGAGGTCAGATG-3’；
Lower primer：5’–biotin-TTCACGGTAGCACGCATAGG-3’.
Embodiment 2：SELEX technology screening specific nucleic acid aptamers
2.SELEX technology screenings
Used in SELEX technology screening overall processes：2 × SELEX combination liquid final concentration forms:20mM Tris-HCl,
2mM MgCl2, 5mM KCl, 1mM CaCl2, 100mM NaCl, the Tween of 12.5ul is added per 100ml 2 × SELEX combination liquid
20, pH 7.6. (2 × SELEX combinations liquid is diluted 1 times by 1 × SELEX combinations liquid)
Cleaning solution final concentration forms：40mM Tris-HCl, 10mM EDTAS, 3.5M urea is clear per 100ml SELEX
Add 12.5ul Tween 20Ph=7.35 in washing lotion
TE buffer solutions final concentration forms：10mM Tris-HCl, 1mM EDTA.
2.1 first round screening steps：
2.1.1 take 2.5OD ssDNA libraries to be dissolved in 250 μ l aqua sterilisas, 95 DEG C of reaction 5min, after ice bath 10min immediately,
It is uniformly mixed with 2 × SELEX combination liquid of 250 μ l, it is spare.
2.1.2 the carboxyl on carboxyl magnetic bead can occur to chemically react and mutually be coupled with the amino in Cefquinome structure.According to
The compound that magnetic bead-Cefquinome is combined is prepared in the coupling specification that the magnetic bead being commercially available is connected with Cefquinome,
500 μ l of magnetic bead-Cefquinome compound are taken, are cleaned 3 times with 1 × SELEX combination liquid, (with reference to liquid dosage 100 μ l every time), so
The ssDNA libraries in 2.1.1 are added afterwards in being incubated 1h under room temperature.
2.1.3 after being incubated, 3 times (cleaning solution dosages every time 500 μ l) are cleaned with cleaning solution,
Magneto separate abandons supernatant after cleaning, and 300 μ l TE buffer solutions are added into magnetic bead, is uniformly mixed, boiling water bath
10min.Then Magneto separate, draws supernatant as next round template.
2.1.4 using supernatant obtained by 2.1.3 as template, anti-sense primer and sense primer carry out PCR amplification.(PCR system bag
Include：15 μ l, Takara Premix TaqTM of template 25 μ l, 1.25 μ l of sense primer, 1.25 7.5 μ of μ l, ddH2O of anti-sense primer
l)
2.2 second wheel screening steps
2.2.1 single stranded DNA is prepared：The Streptavidin MagneSphere of 80 μ l is taken, three times (200 μ l every time) is washed with cleaning solution, adds
Enter into the product of 2.1.4PCR amplifications, shaking capture 30min, Magneto separate removes supernatant, and three times are washed (every time with cleaning solution
100 μ l), the sodium hydroxide solution for adding 50 μ l, 0.2mol/L reacts 5min, and Magneto separate takes supernatant, the dilute hydrochloric acid added afterwards
(0.2mol/L) is adjusted to 7 with extensive PH test paper, and purifying, freeze.Screened as next round in secondary ssDNA libraries.
2.2.2 take the secondary ssDNA libraries that 2.2.1 is screened to be dissolved in 250 μ l aqua sterilisas, react 5min in 95 DEG C,
Ice bath 10min immediately afterwards, is uniformly mixed (500 μ l of final volume) with 2 × SELEX combination liquid of 250 μ l, spare.
2.2.3 the carboxyl on carboxyl magnetic bead can occur to chemically react and mutually be coupled with the amino in Cefquinome structure.According to
The compound that magnetic bead-Cefquinome is combined is prepared in the coupling specification that the magnetic bead being commercially available is connected with Cefquinome,
500 μ l of magnetic bead-Cefquinome compound are taken, are cleaned 3 times with 1 × SELEX combination liquid, (with reference to liquid dosage 100 μ l every time), so
The ssDNA libraries in 2.2.2 are added afterwards in being incubated 1h under room temperature.
2.2.4 after being incubated, 3 times (cleaning solution dosages every time 500 μ l) are cleaned with cleaning solution,
Magneto separate abandons supernatant after cleaning, and 300 μ l TE buffer solutions are added into magnetic bead, is uniformly mixed, boiling water bath
10min.Then Magneto separate, draws supernatant as next round template.
2.2.5 using supernatant obtained by 2.2.4 as template, anti-sense primer and sense primer carry out PCR amplification.(PCR system bag
Include：15 μ l, Takara Premix TaqTM of template 25 μ l, 1.25 μ l of sense primer, 1.25 7.5 μ of μ l, ddH2O of anti-sense primer
l)
2.3 third round amplification steps
2.3.1 single stranded DNA is prepared：The Streptavidin MagneSphere of 80 μ l is taken, three times (200 μ l every time) is washed with cleaning solution, adds
Enter into the product of 2.2.5PCR amplifications, shaking capture 30min, Magneto separate removes supernatant, and three times are washed (every time with cleaning solution
100 μ l), the sodium hydroxide solution for adding 50 μ l, 0.2mol/L reacts 5min, and Magneto separate takes supernatant, the dilute hydrochloric acid added afterwards
(0.2mol/L) is adjusted to 7 with extensive PH test paper, and purifying, freeze.Screened as next round in secondary ssDNA libraries.
2.3.2 take the secondary ssDNA libraries that 2.3.1 is screened to be dissolved in 250 μ l aqua sterilisas, react 5min in 95 DEG C,
Ice bath 10min immediately afterwards, is uniformly mixed (500 μ l of final volume) with 2 × SELEX combination liquid of 250 μ l, spare.
2.3.3 in order to remove the ssDNA libraries with the nonspecific reaction of the combination such as magnetic bead, tube wall, background absorption is reduced,
Screening efficiency is improved, later each round will first carry out a counter-selection and then once just be sieved again from third round.Counter-selection
Process：Magnetic bead-ampicillin is prepared in the coupling specification being connected according to the magnetic bead being commercially available with ampicillin
With reference to compound, take magnetic bead -500 μ l of counter-selection thing (ampicillin) compound, with 1 × SELEX combination liquid clean 3 times it is (every
Secondary 1ml), ssDNA secondary libraries prepared by 2.3.2 are then added in being incubated 30min under room temperature.Magneto separate draws supernatant,
Positive sieve reaction for next step.
2.3.4 being just sieved through journey is：The supernatant of 2.3.3 is taken, is added to the compound that 500ul magnetic beads-Cefquinome combines
In, incubation time 60min.
2.3.5 after being incubated, Magneto separate abandons supernatant, is cleaned 3 times with cleaning solution, each dosage 500ul, scavenging period
1min.Magneto separate abandons supernatant after cleaning, and 300 μ l TE buffer solutions are added in magnetic bead, is uniformly mixed, boiling water bath 10min.So
Magneto separate afterwards, draws supernatant.Next round template is used as using this supernatant
2.3.6 using supernatant obtained by 2.3.5 as template, anti-sense primer and sense primer carry out PCR amplification.(PCR system bag
Include：15 μ l, Takara Premix TaqTM of template 25 μ l, 1.25 μ l of sense primer, 1.25 7.5 μ of μ l, ddH2O of anti-sense primer
l)
2.4 fourth round amplification steps
2.4.1 single stranded DNA is prepared：The Streptavidin MagneSphere of 80 μ l is taken, three times (200 μ l every time) is washed with cleaning solution, adds
Enter into the product of 2.3.6PCR amplifications, shaking capture 30min, Magneto separate removes supernatant, and three times are washed (every time with cleaning solution
100 μ l), the sodium hydroxide solution for adding 50 μ l, 0.2mol/L reacts 5min, and Magneto separate takes supernatant, the dilute hydrochloric acid added afterwards
(0.2mol/L) is adjusted to 7 with extensive PH test paper, and purifying, freeze.Screened as next round in secondary ssDNA libraries.
2.4.2 take the secondary ssDNA libraries that 2.4.1 is screened to be dissolved in 250 μ l aqua sterilisas, react 5min in 95 DEG C,
Ice bath 10min immediately afterwards, is uniformly mixed (500 μ l of final volume) with 2 × SELEX combination liquid of 250 μ l, spare.
2.4.3 in order to remove the ssDNA libraries with the nonspecific reaction of the combination such as magnetic bead, tube wall, background absorption is reduced,
Screening efficiency is improved, later each round will first carry out a counter-selection and then once just be sieved again from third round.Counter-selection
Process：Magnetic bead-ampicillin is prepared in the coupling specification being connected according to the magnetic bead being commercially available with ampicillin
With reference to compound, take magnetic bead -500 μ l of counter-selection thing (ampicillin) compound, with 1 × SELEX combination liquid clean 3 times it is (every
Secondary 1ml), ssDNA secondary libraries prepared by 2.4.2 are then added in being incubated 40min under room temperature.Magneto separate draws supernatant,
Positive sieve reaction for next step.2.4.4 being just sieved through journey is：The supernatant of 2.4.3 is taken, is added to 400ul magnetic beads-cephalo quinoline
In the compound that oxime combines, incubation time 50min.
2.4.5 after being incubated, Magneto separate abandons supernatant, is cleaned 4 times with cleaning solution, each dosage 600ul, scavenging period
2min.Magneto separate abandons supernatant after cleaning, and 300 μ l TE buffer solutions are added in magnetic bead, is uniformly mixed, boiling water bath 10min.So
Magneto separate afterwards, draws supernatant.Next round template is used as using this supernatant
2.4.6 using supernatant obtained by 2.4.5 as template, anti-sense primer and sense primer carry out PCR amplification.(PCR system bag
Include：15 μ l, Takara Premix TaqTM of template 25 μ l, 1.25 μ l of sense primer, 1.25 7.5 μ of μ l, ddH2O of anti-sense primer
l)
2.5 the 5th wheel amplification steps
2.5.1 single stranded DNA is prepared：The Streptavidin MagneSphere of 80 μ l is taken, three times (200 μ l every time) is washed with cleaning solution, adds
Enter into the product of 2.4.6PCR amplifications, shaking capture 30min, Magneto separate removes supernatant, and three times are washed (every time with cleaning solution
100 μ l), the sodium hydroxide solution for adding 50 μ l, 0.2mol/L reacts 5min, and Magneto separate takes supernatant, the dilute hydrochloric acid added afterwards
(0.2mol/L) is adjusted to 7 with extensive PH test paper, and purifying, freeze.Screened as next round in secondary ssDNA libraries.
2.5.2 take the secondary ssDNA libraries that 2.5.1 is screened to be dissolved in 250 μ l aqua sterilisas, react 5min in 95 DEG C,
Ice bath 10min immediately afterwards, is uniformly mixed (500 μ l of final volume) with 2 × SELEX combination liquid of 250 μ l, spare.
2.5.3 in order to remove the ssDNA libraries with the nonspecific reaction of the combination such as magnetic bead, tube wall, background absorption is reduced,
Screening efficiency is improved, later each round will first carry out a counter-selection and then once just be sieved again from third round.Counter-selection
Process：Magnetic bead-ampicillin is prepared in the coupling specification being connected according to the magnetic bead being commercially available with ampicillin
With reference to compound, take magnetic bead -500 μ l of counter-selection thing (ampicillin) compound, with 1 × SELEX combination liquid clean 3 times it is (every
Secondary 1ml), ssDNA secondary libraries prepared by 2.5.2 are then added in being incubated 50min under room temperature.Magneto separate draws supernatant,
Positive sieve reaction for next step.2.5.4 being just sieved through journey is：The supernatant of 2.5.3 is taken, is added to 300ul magnetic beads-cephalo quinoline
In the compound that oxime combines, incubation time 40min.
2.5.5 after being incubated, Magneto separate abandons supernatant, is cleaned 5 times with cleaning solution, each dosage 700ul, scavenging period
3min.Magneto separate abandons supernatant after cleaning, and 300 μ l TE buffer solutions are added in magnetic bead, is uniformly mixed, boiling water bath 10min.So
Magneto separate afterwards, draws supernatant.Next round template is used as using this supernatant
2.5.6 using supernatant obtained by 2.5.5 as template, anti-sense primer and sense primer carry out PCR amplification.(PCR system bag
Include：15 μ l, Takara Premix TaqTM of template 25 μ l, 1.25 μ l of sense primer, 1.25 7.5 μ of μ l, ddH2O of anti-sense primer
l)
2.6 the 6th wheel amplification steps
2.6.1 single stranded DNA is prepared：The Streptavidin MagneSphere of 80 μ l is taken, three times (200 μ l every time) is washed with cleaning solution, adds
Enter into the product of 2.5.6PCR amplifications, shaking capture 30min, Magneto separate removes supernatant, and three times are washed (every time with cleaning solution
100 μ l), the sodium hydroxide solution for adding 50 μ l, 0.2mol/L reacts 5min, and Magneto separate takes supernatant, the dilute hydrochloric acid added afterwards
(0.2mol/L) is adjusted to 7 with extensive PH test paper, and purifying, freeze.Screened as next round in secondary ssDNA libraries.
2.6.2 take the secondary ssDNA libraries that 2.6.1 is screened to be dissolved in 250 μ l aqua sterilisas, react 5min in 95 DEG C,
Ice bath 10min immediately afterwards, is uniformly mixed (500 μ l of final volume) with 2 × SELEX combination liquid of 250 μ l, spare.
2.6.3 in order to remove the ssDNA libraries with the nonspecific reaction of the combination such as magnetic bead, tube wall, background absorption is reduced,
Screening efficiency is improved, later each round will first carry out a counter-selection and then once just be sieved again from third round.Counter-selection
Process：Magnetic bead-ampicillin is prepared in the coupling specification being connected according to the magnetic bead being commercially available with ampicillin
With reference to compound, take magnetic bead -500 μ l of counter-selection thing (ampicillin) compound, with 1 × SELEX combination liquid clean 3 times it is (every
Secondary 1ml), ssDNA secondary libraries prepared by 2.6.2 are then added in being incubated 60min under room temperature.Magneto separate draws supernatant,
Positive sieve reaction for next step.2.6.4 being just sieved through journey is：The supernatant of 2.6.3 is taken, is added to 200ul magnetic beads-cephalo quinoline
In the compound that oxime combines, incubation time 30min.
2.6.5 after being incubated, Magneto separate abandons supernatant, is cleaned 6 times with cleaning solution, each dosage 800ul, scavenging period
4min.Magneto separate abandons supernatant after cleaning, and 300 μ l TE buffer solutions are added in magnetic bead, is uniformly mixed, boiling water bath 10min.So
Magneto separate afterwards, draws supernatant.Next round template is used as using this supernatant
2.6.6 using supernatant obtained by 2.6.5 as template, anti-sense primer and sense primer carry out PCR amplification.(PCR system bag
Include：15 μ l, Takara Premix TaqTM of template 25 μ l, 1.25 μ l of sense primer, 1.25 7.5 μ of μ l, ddH2O of anti-sense primer
l)
Embodiment 3：PCR amplification library system
PCR system includes：15 μ l, Takara Premix TaqTM of template 25 μ l, 1.25 μ l of sense primer, anti-sense primer
1.25 7.5 μ l of μ l, ddH2O
Embodiment 4：Obtain Cefquinome aptamer
After the obtained secondary ssDNA libraries of often wheel screening are combined by 5 ' end mark fluorescent groups with target, with enzyme mark
(absorbing wavelength 488,525) received wave is a length of to survey secondary ssDNA libraries and target binding capability to instrument.Until fluorescence intensity reaches
Maximum saturation state, obtains Cefquinome aptamer, such as Fig. 4 at this time.
Embodiment 5：Cloning and sequencing
The aptamer that last wheel screening obtains is sent to Shanghai Sheng Gong Technology Co., Ltd. to be sequenced, that is, is obtained
Nucleic acid aptamer sequence described in above-mentioned requirements.That is 5 '-AGCAGCACAGAGGTCAGATGTGGGCGCCGACGTACTAAAC
AGGGGAACCTACCTGGTTAACC TATGCGTGCTACCGTGAA-3’.Fig. 1 is the two level knot of Cefquinome aptamer
Composition
Embodiment 6：Affinity analysis
The aptamer of 5 ' end mark fluorescent groups is configured to a series of concentration with the cleaning solution for being not added with Tween 20
(i.e. 0,0.1,0.2,0.4,06,0.8,1.0 μM).Each concentration gradient takes 100 μ l, 90 DEG C of water-baths 10min, 4 DEG C of 15min,
Room temperature 5min is activated, and is added into 500 μ L Cefquinomes-bead complexes, 37 DEG C of incubation 30min.Magneto separate is collected not
The supernatant being attached on magnetic bead, surveying fluorescence intensity with microplate reader, (absorbing wavelength 488, received wave is a length of 525).Fitted with nucleic acid
Ligand concentration is abscissa, and fluorescence intensity is ordinate, is carried out curve fitting by equation Y=Bmax × X ÷ (Kd+X), wherein
Y is the saturation degree of Aptamer；Bmax is the number in maximum combined site；X is Aptamer.Drafting combines saturation curve, tries to achieve
Kd values are 40.13.As shown in Fig. 2, the binding ability of explanation aptamer and Cefquinome is very strong.
Embodiment 7：Specificity analysis
By gained Cefquinome aptamer and Cefquinome and its chaff interferent Cefpirome Sulfate, Cefixime, ammonia
Benzyl XiLin control group carries out sensitive fluorescent analysis with microplate reader, it is found that the aptamer is correct in the presence of other chaff interferents
The sensitiveness of spore gram oxime is most strong, such as Fig. 3.
SsDNA libraries：
5’-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3’；
5’-agcagcacagaggtcagatg-n40-cctatgcgtgctaccgtgaa-3’
Upper primer：5’-AGCAGCACAGAGGTCAGATG-3’；
5’-agcagcacagaggtcagatg-3’
Lower primer：5’–biotin-TTCACGGTAGCACGCATAGG-3’
5’-biotin-ttcacggtagcacgcatagg-3’
Nucleic acid aptamer sequence, i.e.,
5’-AGCAGCACAGAGGTCAGATGTGGGCGCCGACGTACTAAACAGGGGAACCTACCTGGTT
AACCTATGCGTGCTACCGTGAA-3’。
5’-agcagcacagaggtcagatgtgggcgccgacgtactaaacaggggaacctacctgg
ttaacctatgcgtgctaccgtgaa-3’。
Sequence table
<110>Beijing University of Chemical Technology
<120>One aptamer and its screening technique that can be specifically bound with Cefquinome
<141> 2017-12-07
<160> 4
<170> SIPOSequenceListing 1.0
<210> 1
<211> 40
<212> DNA
<213> 2 Ambystoma laterale x Ambystoma jeffersonianum
<400> 1
agcagcacag aggtcagatg cctatgcgtg ctaccgtgaa 40
<210> 2
<211> 20
<212> DNA
<213> 2 Ambystoma laterale x Ambystoma jeffersonianum
<400> 2
agcagcacag aggtcagatg 20
<210> 3
<211> 20
<212> DNA
<213> 2 Ambystoma laterale x Ambystoma jeffersonianum
<400> 3
ttcacggtag cacgcatagg 20
<210> 4
<211> 80
<212> DNA
<213> 2 Ambystoma laterale x Ambystoma jeffersonianum
<400> 4
agcagcacag aggtcagatg tgggcgccga cgtactaaac aggggaacct acctggttaa 60
cctatgcgtg ctaccgtgaa 80
Claims (3)
1. an aptamer that can be specifically bound with Cefquinome, its sequence for 5 '-
AGCAGCACAGAGGTCAGATGTGGGCGCCGACGTACTAAACAGGGGAACCTACCTGGTTAACCTATGCGTGCTACCGT
GAA-3’。
2. the method for screening aptamer as claimed in claim 1, it is characterised in that：
(1) random single chain DNA and primer shown in following sequence are synthesized：
SsDNA random libraries：5’-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3’；
Upper primer：5’-AGCAGCACAGAGGTCAGATG-3’；
Lower primer：5’–biotin-TTCACGGTAGCACGCATAGG-3’；
(2) SELEX technology screenings specific nucleic acid aptamers：
A. ssDNA libraries are dissolved in 250 μ l aqua sterilisas, 70-95 DEG C of denaturation 5min, then ice bath 10min, adds thereto
The combination buffer of 250 μ l is uniformly mixed, spare
B. the compound that magnetic bead-Cefquinome combines is prepared, takes 500 μ l of the compound, then adds ssDNA libraries in room temperature bar
When incubation 0.5-2 is small under part, Magneto separate discards uncombined ssDNA, is cleaned 3 times with cleaning solution, Magneto separate abandons supernatant；
C. 300 μ l TE solution, boiling water bath 2-20min are added into magnetic bead；Then Magneto separate, collects supernatant as PCR amplification mould
Plate, the secondary storehouse as next round screening；
Combination buffer used forms:20mM Tris-HCl, 2mM MgCl2, 5mM KCl, 1mM CaCl2, 100mM
NaCl, Tween 20, pH 7.6.
(3) PCR amplification library：For the supernatant obtained using step c in (2) as template, anti-sense primer and sense primer carry out PCR expansions
Increase；
(4) preparation of single-stranded DNA banks：Take Streptavidin MagneSphere to be washed three times with cleaning solution, be added in PCR product, vibrate
Capture 10-50min is shaken up, Magneto separate removes supernatant, then cleans 3 times；Add the sodium hydroxide solution denaturation 1- of 0.2mol/L
10min, Magneto separate take supernatant, and the rear hydrochloric acid that adds neutralizes, and purifying, freeze；Screened as next round；
(5) third round is screened：
A. using ampicillin as counter-selection thing, ampicillin is coupled on carboxyl magnetic bead；Take magnetic bead-ampicillin compound
Thing, with clean with reference to liquid, then addition ssDNA secondary libraries in being incubated under room temperature；
B. after being incubated, Magneto separate draws uncombined ssDNA, is added to in the magnetic bead-Cefquinome washed with reference to liquid
Continue to be incubated；
C. buffer solution for cleaning is used, Magneto separate abandons supernatant after cleaning, and 300 μ l TE buffer solutions are added in magnetic bead, is uniformly mixed,
Magneto separate after boiling water bath, draws supernatant；
D. repetitive process a-c, repeats to 5-15 wheels, secondary ssDNA libraries and target binding capability is surveyed with microplate reader, until fluorescence
Intensity reaches maximum saturation state, obtains Cefquinome aptamer at this time.
3. the method for screening aptamer as claimed in claim 1, it is characterised in that：
1) synthesizes the random single chain DNA and primer shown in following sequence：
SsDNA libraries：5’-AGCAGCACAGAGGTCAGATG-N40-CCTATGCGTGCTACCGTGAA-3’；
Sense primer：5’-AGCAGCACAGAGGTCAGATG-3’；
Anti-sense primer：5’–biotin-TTCACGGTAGCACGCATAGG-3’；
2) SELEX technology screenings specific nucleic acid aptamers
Used in SELEX technology screening overall processes：2 × SELEX combination liquid final concentration forms:20mM Tris-HCl, 2mM
MgCl2, 5mMKCl, 1mM CaCl2, 100mM NaCl, the Tween 20, pH of 12.5ul is added per 100ml 2 × SELEX combination liquid
7.6.
Cleaning solution final concentration forms：40mM Tris-HCl, 10mM EDTAS, 3.5M urea, per 100ml SELEX cleaning solutions
In plus 12.5ul Tween 20, pH=7.35
TE buffer solutions final concentration forms：10mM Tris-HCl, 1mM EDTA；
2.1 first round screening steps：
2.1.1 take 2.5OD ssDNA libraries to be dissolved in 250 μ l aqua sterilisas, 95 DEG C of reaction 5min, after ice bath 10min immediately, with
2 × SELEX combination liquid of 250 μ l is uniformly mixed, spare；
2.1.2 500 μ l of magnetic bead-Cefquinome compound are taken, are cleaned 3 times with 1 × SELEX combination liquid, then add in 2.1.1
SsDNA libraries in being incubated 1h under room temperature；
2.1.3 after being incubated, cleaned 3 times with cleaning solution,
Magneto separate abandons supernatant after cleaning, and 300 μ l TE buffer solutions are added into magnetic bead, is uniformly mixed, boiling water bath 10min；So
Magneto separate afterwards, draws supernatant as next round template；
2.1.4 using supernatant obtained by 2.1.3 as template, anti-sense primer and sense primer carry out PCR amplification；
2.2 second wheel screening steps
2.2.1 single stranded DNA is prepared：The Streptavidin MagneSphere of 80 μ l is taken, is washed three times with cleaning solution, is added to 2.1.4PCR expansions
In the product of increasing, shaking capture 30min, Magneto separate removes supernatant, is washed with cleaning solution, adds the hydrogen-oxygen of 50 μ l, 0.2mol/L
Change sodium solution reaction 5min, Magneto separate takes supernatant, and the rear dilute hydrochloric acid for adding 0.2mol/L is adjusted to 7 with extensive PH test paper, and purifying, freeze
It is dry；Screened as next round in secondary ssDNA libraries；
2.2.2 take the secondary ssDNA libraries that 2.2.1 is screened to be dissolved in 250 μ l aqua sterilisas, 5min is reacted in 95 DEG C, it is rear vertical
That is ice bath 10min, is uniformly mixed with 2 × SELEX combination liquid of 250 μ l, spare；
2.2.3 500 μ l of magnetic bead-Cefquinome compound are taken, are cleaned with 1 × SELEX combination liquid, are then added in 2.2.2
SsDNA libraries in being incubated 1h under room temperature；
2.2.4 after being incubated, cleaned 3 times with cleaning solution,
Magneto separate abandons supernatant after cleaning, and 300 μ l TE buffer solutions are added into magnetic bead, is uniformly mixed, boiling water bath 10min；So
Magneto separate afterwards, draws supernatant as next round template；
2.2.5 using supernatant obtained by 2.2.4 as template, anti-sense primer and sense primer carry out PCR amplification；
2.3 third round amplification steps
2.3.1 single stranded DNA is prepared：The Streptavidin MagneSphere of 80 μ l is taken, 2.2.5PCR amplifications are added to after being washed with cleaning solution
In product, shaking capture 30min, Magneto separate removes supernatant, is washed three times with cleaning solution, adds the hydrogen-oxygen of 50 μ l, 0.2mol/L
Change sodium solution reaction 5min, Magneto separate takes supernatant, and rear addition 0.2mol/L's is adjusted to 7 with wide pH value test paper, purifies, is lyophilized；Should
Screened as next round in secondary ssDNA libraries；
2.3.2 take the secondary ssDNA libraries that 2.3.1 is screened to be dissolved in 250 μ l aqua sterilisas, 5min is reacted in 95 DEG C, it is rear vertical
That is ice bath 10min, is uniformly mixed with 2 × SELEX combination liquid of 250 μ l, spare；
2.3.3 magnetic bead -500 μ l of counter-selection thing ampicillin compound are taken, is cleaned with 1 × SELEX combination liquid, then added
2.3.2 the ssDNA secondary libraries prepared in being incubated 30min under room temperature；Magneto separate draws supernatant, the positive sieve for next step
Reaction；
2.3.4 being just sieved through journey is：The supernatant of 2.3.3 is taken, is added in the compound that 500ul magnetic beads-Cefquinome combines,
Incubation time 60min；
2.3.5 after being incubated, Magneto separate abandons supernatant, is cleaned 3 times with cleaning solution, each dosage 500ul, scavenging period 1min；
Magneto separate abandons supernatant after cleaning, and 300 μ l TE buffer solutions are added in magnetic bead, is uniformly mixed, boiling water bath 10min；Then magnetic point
From absorption supernatant；Next round template is used as using this supernatant
2.3.6 using supernatant obtained by 2.3.5 as template, anti-sense primer and sense primer carry out PCR amplification；
2.4 fourth round amplification steps
2.4.1 single stranded DNA is prepared：The Streptavidin MagneSphere of 80 μ l is taken, 2.3.6PCR amplifications are added to after being washed with cleaning solution
In product, shaking capture 30min, Magneto separate removes supernatant, the sodium hydroxide of 50 μ l, 0.2mol/L is added after being washed with cleaning solution
Solution reaction 5min, Magneto separate take supernatant, and the rear dilute hydrochloric acid for adding 0.2mol/L is adjusted to 7 with extensive PH test paper, and purifying, freeze；
Screened as next round in secondary ssDNA libraries；
2.4.2 take the secondary ssDNA libraries that 2.4.1 is screened to be dissolved in 250 μ l aqua sterilisas, 5min is reacted in 95 DEG C, it is rear vertical
That is ice bath 10min, is uniformly mixed with 2 × SELEX combination liquid of 250 μ l, spare；
2.4.3 magnetic bead -500 μ l of counter-selection thing ampicillin compound are taken, is cleaned with 1 × SELEX combination liquid, then added
2.4.2 the ssDNA secondary libraries prepared in being incubated 40min under room temperature；Magneto separate draws supernatant, the positive sieve for next step
Reaction；
2.4.4 being just sieved through journey is：The supernatant of 2.4.3 is taken, is added in the compound that 400ul magnetic beads-Cefquinome combines,
Incubation time 50min；
2.4.5 after being incubated, Magneto separate abandons supernatant, is cleaned 4 times with cleaning solution, each dosage 600ul, scavenging period 2min；
Magneto separate abandons supernatant after cleaning, and 300 μ l TE buffer solutions are added in magnetic bead, is uniformly mixed, boiling water bath 10min；Then magnetic point
From absorption supernatant；Next round template is used as using this supernatant；
2.4.6 using supernatant obtained by 2.4.5 as template, anti-sense primer and sense primer carry out PCR amplification；
2.5 the 5th wheel amplification steps
2.5.1 single stranded DNA is prepared：The Streptavidin MagneSphere of 80 μ l is taken, 2.4.6PCR amplifications are added to after being washed with cleaning solution
In product, shaking capture 30min, Magneto separate removes supernatant, the sodium hydroxide of 50 μ l, 0.2mol/L is added after being washed with cleaning solution
Solution reaction 5min, Magneto separate take supernatant, and the rear dilute hydrochloric acid for adding 0.2mol/L is adjusted to 7 with wide pH value test paper, and purifying, freeze；
Screened as next round in secondary ssDNA libraries；
2.5.2 take the secondary ssDNA libraries that 2.5.1 is screened to be dissolved in 250 μ l aqua sterilisas, 5min is reacted in 95 DEG C, it is rear vertical
That is ice bath 10min, is uniformly mixed with 2 × SELEX combination liquid of 250 μ l, spare；
2.5.3 magnetic bead -500 μ l of counter-selection thing ampicillin compound are taken, 2.5.2 is added after being cleaned with 1 × SELEX combination liquid
The ssDNA secondary libraries of preparation in being incubated 50min under room temperature；Magneto separate draws supernatant, the positive sieve reaction for next step；
2.5.4 being just sieved through journey is：The supernatant of 2.5.3 is taken, is added in the compound that 300ul magnetic beads-Cefquinome combines,
Incubation time 40min；
2.5.5 after being incubated, Magneto separate abandons supernatant, is cleaned 5 times with cleaning solution, each dosage 700ul, scavenging period 3min；
Magneto separate abandons supernatant after cleaning, and 300 μ l TE buffer solutions are added in magnetic bead, is uniformly mixed, boiling water bath 10min；Then magnetic point
From absorption supernatant；Next round template is used as using this supernatant
2.5.6 using supernatant obtained by 2.5.5 as template, anti-sense primer and sense primer carry out PCR amplification；
2.6 the 6th wheel amplification steps
2.6.1 single stranded DNA is prepared：The Streptavidin MagneSphere of 80 μ l is taken, 2.5.6PCR amplifications are added to after being washed with cleaning solution
In product, shaking capture 30min, Magneto separate removes supernatant, the hydrogen-oxygen for adding 50 μ l, 0.2mol/L is washed after three times with cleaning solution
Change sodium solution reaction 5min, Magneto separate takes supernatant, and the rear dilute hydrochloric acid for adding 0.2mol/L is adjusted to 7 with wide pH value test paper, and purifying, freeze
It is dry；Screened as next round in secondary ssDNA libraries；
2.6.2 take the secondary ssDNA libraries that 2.6.1 is screened to be dissolved in 250 μ l aqua sterilisas, 5min is reacted in 95 DEG C, it is rear vertical
That is ice bath 10min, is uniformly mixed with 2 × SELEX combination liquid of 250 μ l, spare；
2.6.3 magnetic bead -500 μ l of counter-selection thing ampicillin compound are taken, 2.6.2 is added after being cleaned with 1 × SELEX combination liquid
The ssDNA secondary libraries of preparation in being incubated 60min under room temperature；Magneto separate draws supernatant, the positive sieve reaction for next step；
2.6.4 being just sieved through journey is：The supernatant of 2.6.3 is taken, is added in the compound that 200ul magnetic beads-Cefquinome combines,
Incubation time 30min；
2.6.5 after being incubated, Magneto separate abandons supernatant, is cleaned 6 times with cleaning solution, each dosage 800ul, scavenging period 4min；
Magneto separate abandons supernatant after cleaning, and 300 μ l TE buffer solutions are added in magnetic bead, is uniformly mixed, boiling water bath 10min；Then magnetic point
From absorption supernatant；Next round template is used as using this supernatant
2.6.6 using supernatant obtained by 2.6.5 as template, anti-sense primer and sense primer carry out PCR amplification；
3) obtains Cefquinome aptamer：The obtained secondary ssDNA libraries of often wheel screening pass through 5 ' end mark fluorescent bases
After group is combined with target, secondary ssDNA libraries and target binding capability are surveyed with microplate reader；Until fluorescence intensity reaches maximum saturation
State, obtains Cefquinome aptamer at this time.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711286767.5A CN107916265A (en) | 2017-12-07 | 2017-12-07 | One aptamer and its screening technique that can be specifically bound with Cefquinome |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711286767.5A CN107916265A (en) | 2017-12-07 | 2017-12-07 | One aptamer and its screening technique that can be specifically bound with Cefquinome |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN107916265A true CN107916265A (en) | 2018-04-17 |
Family
ID=61898435
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201711286767.5A Pending CN107916265A (en) | 2017-12-07 | 2017-12-07 | One aptamer and its screening technique that can be specifically bound with Cefquinome |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107916265A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109371031A (en) * | 2018-11-23 | 2019-02-22 | 北京化工大学 | A kind of screening technique specifically binding bovine serum albumin(BSA) aptamer |
| CN111676224A (en) * | 2019-10-24 | 2020-09-18 | 北京化工大学 | Aptamer capable of being combined with 2-bromo-1-indanol and screening method thereof |
| CN111751524A (en) * | 2019-11-01 | 2020-10-09 | 北京化工大学 | Method for establishing antibiotic double detection sensor based on aptamer |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105985962A (en) * | 2015-02-09 | 2016-10-05 | 中国中医科学院中医临床基础医学研究所 | Aptamer specifically targeting to inflammatory synovial cells of rheumatoid arthritis (RA) and applications of aptamer |
-
2017
- 2017-12-07 CN CN201711286767.5A patent/CN107916265A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105985962A (en) * | 2015-02-09 | 2016-10-05 | 中国中医科学院中医临床基础医学研究所 | Aptamer specifically targeting to inflammatory synovial cells of rheumatoid arthritis (RA) and applications of aptamer |
Non-Patent Citations (5)
| Title |
|---|
| JOHN G. BRUNO: "In Vitro Selection of DNA to Chloroaromatics Using Magnetic Microbead-Based Affinity Separation and Fluorescence Detection", 《BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS》 * |
| YE DUAN ET AL.: "Selection and Identification of Chloramphenicol-Specific DNA Aptamers by Mag-SELEX", 《APPL. BIOCHEM. BIOTECHNOL.》 * |
| 华夏: "减少猪肉中抗菌药物残留措施的研究", 《 中国优秀硕士学位论文全文数据库 农业科技辑》 * |
| 段烨等: "核酸适体技术及其在兽药残留检测中的应用", 《中国兽医杂志》 * |
| 高金兴: "头孢喹肟在牛奶中残留的HPLC检测及消除规律研究", 《 中国优秀硕士学位论文全文数据库 农业科技辑》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109371031A (en) * | 2018-11-23 | 2019-02-22 | 北京化工大学 | A kind of screening technique specifically binding bovine serum albumin(BSA) aptamer |
| CN111676224A (en) * | 2019-10-24 | 2020-09-18 | 北京化工大学 | Aptamer capable of being combined with 2-bromo-1-indanol and screening method thereof |
| CN111751524A (en) * | 2019-11-01 | 2020-10-09 | 北京化工大学 | Method for establishing antibiotic double detection sensor based on aptamer |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| McKeague et al. | Screening and initial binding assessment of fumonisin B1 aptamers | |
| CN102952802B (en) | Group of oligonucleotides aptamers capable of specifically recognizing aflatoxin B1 | |
| CN107916265A (en) | One aptamer and its screening technique that can be specifically bound with Cefquinome | |
| Peltomaa et al. | Application of bacteriophages in sensor development | |
| CN106834295B (en) | Broad-spectrum nucleic acid aptamer for specifically recognizing bacterial lipopolysaccharide and directional screening method thereof | |
| CN106568951B (en) | Escherichia coli O 157 based on aptamer: H7 colloidal gold strip and detection method | |
| CN103808716A (en) | Method for portably and rapidly detecting ochratoxin A | |
| CN103852460A (en) | Method for detecting multi-residues of antibiotics by magnetic nano fluorescence sensor based on aptamer | |
| Fischer et al. | Aptasensors for biosecurity applications | |
| Liu et al. | Aptamers against pathogenic bacteria: selection strategies and apta-assay/aptasensor application for food safety | |
| CN102703453A (en) | DNA aptamer specifically recognizing streptomycin and application of DNA aptamer | |
| Sun et al. | A HCR based multivalent aptamer amplifier for ultrasensitive detection of Salmonella | |
| CN104360077A (en) | Aptamer nucleic acid probe kit for detecting doxycycline residue as well as preparation method and application thereof | |
| CN104561008A (en) | Homocysteine aptamer HCy1 and preparation method thereof | |
| CN106771194B (en) | A method of detection pathogenic microorganism | |
| CN102010865A (en) | Nucleic acid aptamer capable of specifically recognizing Listeria monocytogenes, screening method and application thereof | |
| CN110004148A (en) | Rod method phenol aptamers affinity column and the preparation method and application thereof | |
| CN104745588A (en) | Specific nucleic acid aptamer for recognizing streptomycin and application of nucleic acid aptamer to streptomycin detection | |
| Chen et al. | Construction of time-resolved luminescence nanoprobe and its application in As (III) detection | |
| Zhao et al. | Small peptides in the detection of mycotoxins and their potential applications in mycotoxin removal | |
| CN102952801B (en) | Group of oligonucleotide aptamers for specifically identifying aflatoxin B2 | |
| CN106591315A (en) | Aptamer C202 of staphylococcus aureus enterotoxin C2 as well as screening method and applications thereof | |
| CN114457083B (en) | Single-stranded DNA (deoxyribonucleic acid) aptamer group specifically recognizing malachite green and application thereof | |
| CN101710125A (en) | Methods for detecting bicistronic mRNA virus of scylla serrata and kits thereof | |
| CN105349544A (en) | Nucleic acid aptamer S3 of Staphylococcus aureus enterotoxin A and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20180417 |