CN107868125A

CN107868125A - MG53 mutant and its production and use

Info

Publication number: CN107868125A
Application number: CN201610847346.4A
Authority: CN
Inventors: 肖瑞平; 吕凤祥; 张岩; 郭寺乐
Original assignee: Peking University
Current assignee: Peking University
Priority date: 2016-09-23
Filing date: 2016-09-23
Publication date: 2018-04-03

Abstract

The application is related to a kind of MG53 mutant, the wherein MG53 mutant has at least one serine missing in the coiled coil SPRY regions of the wild type MG53 and/or sports the amino acid of any other non-serine or threonine on the basis of wild type MG53 amino acid sequence.The application further relates to the pharmaceutical composition for including the MG53 mutant, encode the nucleic acid of the MG53 mutant, the preparation method of the MG53 mutant, MG53 mutant is being prepared for treating heart disease, kidney trouble, with the purposes in the medicine of cell and/or tissue damage relevant disease, especially, the MG53 mutant is in treatment heart disease, kidney trouble, while with cell and/or tissue damage relevant disease, it can avoid or reduce metabolism class side effect caused by wild type MG53, such as, insulin resistance, it is fat, diabetes, hypertension, dyslipidemia etc..

Description

MG53 mutant and its production and use

Technical field

The application is related to biomedicine field, and specifically, the application is related to a kind of MG53 mutant, dashed forward comprising the MG53 The pharmaceutical composition of variant, the nucleic acid of the coding MG53 mutant, the preparation method of the MG53 mutant and MG53 dash forward Variant is preparing the use in being used to treat heart disease, kidney trouble and the medicine of cell and/or tissue damage relevant disease On the way.

Background technology

Mitsugumin 53 (MG53) is also known as TRIM72, is three domain proteins (Tripartite motif- Containing Proteins, TRIM) a member in family.MG53 is by the TRIM domains of N-terminal and the SPRY domains of C-terminal Composition, TRIM domains are made up of (referring to Chuanxi Cai Ring, B-box, coiled-coil domain being sequentially connected et al.,the Journal of Biological Chemistry,Vol.284(5),3314-3322(2009)).MG53 master Express in striated muscle, maintain to play an important role for the stable state of skeletal muscle and the even whole body of heart.Send out before Existing, MG53 has cell repair function and Cardioprotective function (see, e.g., Chuanxi Cai et al., Nature Cell Biology,Vol.11,56-64(2009)；CN101797375B).In addition, further investigation revealed that, it is pre- in ischemic Adapt to (ischemic preconditioning, IPC) and Ischemic postconditioning (ischemic postconditioning, PostC in), MG53 is also one of important molecule to shield, the both ends of MG53 molecules can respectively with Caveolin-3 And p85-PI3K kinases is bound to each other to form compound, and activate the reperfusion injury protection kinases (reperfusion in downstream Injury salvage kinase, RISK) approach, so as to realize the protective effect of cardiac muscle (referring to Chun-Mei Cao et al.,Circulation 121,2565-2574,(2010))。

Although MG53 has cell repair function and Cardioprotective function, research before also found that MG53 has E3 ubiquitin ligase activities, participate in the occurrence and development of regulation and control insulin resistance and metabolic syndrome.The TRIM domains at MG53N ends In Ring domains there is E3 ubiquitin ligase activities, can be with insulin receptor (insulin receptor, IR) and pancreas Island element receptor substrate (insulin receptor substrate-1, IRS1) combine, and mediate their ubiquitination and The degraded of proteasome pathway, and then insulin signaling pathway is checked, cause the fertilizer using insulin resistance as morbidity core link Fat, diabetes, hypertension, dyslipidemia etc. are metabolized class disease (see, e.g., R.Song et al., Nature 494,375- 379,(2013)；J.S.Yi et al.,Nature communications 4,2354(2013)).As can be seen here, wild type MG53 can cause insulin resistance, obesity, diabetes, hypertension, dyslipidemia etc. while repair cell, cardioprotection Be metabolized class disease side effect, these side effects be it is undesirable that.

Summary of the invention

The application is related to a kind of MG53 mutant, the pharmaceutical composition comprising the MG53 mutant, the coding MG53 The nucleic acid of mutant, the preparation method of the MG53 mutant and MG53 mutant are being prepared for treating heart disease, kidney Dirty disease, with the purposes in the medicine of cell and/or tissue damage relevant disease, especially, the MG53 mutant with While cell repair function and/or Cardioprotective function, can avoid or reduce wild type MG53 caused by insulin support The metabolism class side effect such as anti-, obesity, diabetes, hypertension, dyslipidemia.

On the one hand, the application is related to a kind of MG53 mutant, wherein amino of the MG53 mutant in wild type MG53 On the basis of acid sequence, there is at least one serine missing in the coiled-coil-SPRY regions of the wild type MG53 And/or sport the amino acid of any other non-serine or threonine.In some embodiments, the coiled-coil- SPRY regions are located at the 122-477 amino acids region of wild type MG53 amino acid sequence.In some embodiments, institute State wild type MG53 and derive from animal, it is preferable that from mammal, for example, people, mouse, rat, monkey, pig, dog etc.. In some embodiments, the amino acid sequence of the wild type MG53 is SEQ ID NO:1、SEQ ID NO:2、SEQ ID NO:3、SEQ ID NO:4、SEQ ID NO:5、SEQ ID NO:6、SEQ ID NO:139、SEQ ID NO:140、SEQ ID NO:141、SEQ ID NO:Amino acid sequence shown in 142.

In some embodiments, the MG53 mutant is on the basis of wild type MG53 amino acid sequence, in institute Stating has at least one mutant serine in wild type MG53 coiled-coil-SPRY regions be nonpolar amino acid.Some In embodiment, the nonpolar amino acid is selected from the group：Glycine, alanine, leucine, isoleucine, valine, dried meat ammonia Acid, phenylalanine, methionine and tryptophan.Preferably, in some embodiments, the nonpolar amino acid is the third ammonia Acid.In some embodiments, the MG53 mutant is on the basis of wild type MG53 amino acid sequence, described wild There is at least one mutant serine in type MG53 coiled-coil-SPRY regions for the pole in addition to serine and threonine Acidic amino acid.In some embodiments, the polar amino acid is selected from the group：Glutamine, cysteine, asparagine, Tyrosine, aspartic acid, glutamic acid, lysine, arginine and histidine.Preferably, in some embodiments, the polarity Amino acid is cysteine.

In some embodiments, the serine for occurring to lack or be mutated is located at wild type MG53 amino acid sequence SEQ ID NO:The 150th of 1, the 189th, the 211st, the 214th, the 246th, the 255th, the 269th, the 296th, 297, the 301st, the 305th, the 306th, the 307th, the 314th, the 341st, the 377th, the 405th, the 418th One or more of position, the 425th or the 430th site.

In some embodiments, the serine for occurring to lack or be mutated is located at wild type MG53 amino acid sequence SEQ ID NO:The 150th of 139, the 189th, the 211st, the 214th, the 246th, the 255th, the 269th, the 296th, 297, the 301st, the 305th, the 306th, the 307th, the 314th, the 341st, the 377th, the 405th, the 418th One or more of position, the 425th or the 430th site.

In some embodiments, the serine for occurring to lack or be mutated is located at wild type MG53 amino acid sequence SEQ ID NO:The 150th of 140, the 189th, the 211st, the 214th, the 246th, the 255th, the 269th, the 296th, 297, the 301st, the 305th, the 306th, the 307th, the 314th, the 341st, the 377th, the 405th, the 418th One or more of position, the 425th or the 430th site.

In some embodiments, the serine for occurring to lack or be mutated is located at wild type MG53 amino acid sequence SEQ ID NO:The 150th of 141, the 189th, the 211st, the 214th, the 246th, the 255th, the 269th, the 296th, 297, the 301st, the 305th, the 306th, the 307th, the 314th, the 341st, the 377th, the 405th, the 418th One or more of position, the 425th or the 430th site.

In some embodiments, the serine for occurring to lack or be mutated is located at wild type MG53 amino acid sequence SEQ ID NO:One in the 150th, the 189th, the 211st, the 214th, the 246th, the 255th, the 269th of 142 or Multiple sites.

In some embodiments, the serine for occurring to lack or be mutated is located at wild type MG53 amino acid sequence SEQ ID NO:The 188th of 2, the 189th, the 210th, the 211st, the 214th, the 246th, the 253rd, the 255th, 269, the 296th, the 297th, the 301st, the 305th, the 306th, the 307th, the 314th, the 341st, the 367th Position, the 377th, the 418th, one or more of the 430th or the 440th site.

In some embodiments, the serine for occurring to lack or be mutated is located at wild type MG53 amino acid sequence SEQ ID NO:The 150th of 3, the 188th, the 189th, the 210th, the 211st, the 214th, the 246th, the 253rd, 255, the 269th, the 296th, the 297th, the 301st, the 305th, the 307th, the 314th, the 341st, the 367th Position, the 377th, the 418th, the 430th, the 440th, one or more of the 464th or the 474th site.

In some embodiments, the serine for occurring to lack or be mutated is located at wild type MG53 amino acid sequence SEQ ID NO:The 150th of 4, the 189th, the 211st, the 214th, the 246th, the 255th, the 269th, the 296th, 297, the 301st, the 305th, the 306th, the 307th, the 341st, the 377th, the 405th, the 418th, the 425th One or more of position, the 430th or the 464th site.

In some embodiments, the serine for occurring to lack or be mutated is located at wild type MG53 amino acid sequence SEQ ID NO:The 150th of 5, the 189th, the 211st, the 214th, the 246th, the 255th, the 269th, the 296th, 301, the 305th, the 307th, the 314th, the 341st, the 377th, the 411st, the 418th, the 425th, the 430th Or one or more of the 474th site.

In some embodiments, the serine for occurring to lack or be mutated is located at wild type MG53 amino acid sequence SEQ ID NO:The 150th of 6, the 189th, the 211st, the 214th, the 246th, the 255th, the 269th, the 296th, 297, the 301st, the 305th, the 307th, the 314th, the 341st, the 367th, the 377th, the 418th, the 425th Or one or more of the 430th site.

In some embodiments, the serine for occurring to lack or be mutated is located at wild type MG53 amino acid sequence (example Such as, SEQ ID NO:1、SEQ ID NO:2、SEQ ID NO:3、SEQ ID NO:4、SEQ ID NO:5、SEQ ID NO:6、 SEQ ID NO:139、SEQ ID NO:140、SEQ ID NO:141 or SEQ ID NO:142) the 150th, 188- 189,210-211 positions, the 214th, the 246th, 253-255 positions, the 269th, 296-297 positions, the 301st, 305-307 positions, the 314th, the 341st, the 367th, the 377th, the 405th, the 411st, the 418th, the 425th, One or more of 430, the 440th, the 464th or the 474th sites.

In some embodiments, the serine for occurring to lack or be mutated is located at wild type MG53 amino acid sequence (example Such as, SEQ ID NO:1、SEQ ID NO:2、SEQ ID NO:3、SEQ ID NO:4、SEQ ID NO:5、SEQ ID NO:6、 SEQ ID NO:139、SEQ ID NO:140、SEQ ID NO:141 or SEQ ID NO:142) the 189th, the 211st Position, the 214th, the 246th, 253-255 positions, the 269th, the 296th, the 301st, the 305th, the 307th, the 341st Position, the 377th, one or more of the 418th or the 430th site.

In some embodiments, the serine for occurring to lack or be mutated is located at wild type MG53 amino acid sequence (example Such as, SEQ ID NO:1、SEQ ID NO:2、SEQ ID NO:3、SEQ ID NO:4、SEQ ID NO:5、SEQ ID NO:6、 SEQ ID NO:139、SEQ ID NO:140、SEQ ID NO:141 or SEQ ID NO:142) the 211st, the 214th Position, the 246th, 253-255 positions, the 269th, one or more of the 296th or the 297th site.

In some embodiments, the serine for occurring to lack or be mutated is located at wild type MG53 amino acid sequence (example Such as, SEQ ID NO:1、SEQ ID NO:2、SEQ ID NO:3、SEQ ID NO:4、SEQ ID NO:5、SEQ ID NO:6、 SEQ ID NO:139、SEQ ID NO:140、SEQ ID NO:141 or SEQ ID NO:142) the 211st, the 214th Position, the 246th, the 255th, the 269th, one or more of the 296th or the 297th site.

In some embodiments, the serine for occurring to lack or be mutated is located at wild type MG53 amino acid sequence (example Such as, SEQ ID NO:1、SEQ ID NO:2、SEQ ID NO:3、SEQ ID NO:4、SEQ ID NO:5、SEQ ID NO:6、 SEQ ID NO:139、SEQ ID NO:140、SEQ ID NO:141 or SEQ ID NO:142) in 253-255 positions One or more sites.In some embodiments, the serine for occurring to lack or be mutated is located at wild type MG53 amino acid The 253rd of sequence.In some embodiments, the serine for occurring to lack or be mutated is located at wild type MG53 amino acid sequence The 255th of row.In some embodiments, the serine for occurring to lack or be mutated is located at wild type MG53 amino acid sequence SEQ ID NO:The 255th of 1.In some embodiments, the serine that missing or mutation occurs is located at wild type MG53's Amino acid sequence SEQ ID NO:139、SEQ ID NO:140、SEQ ID NO:141 or SEQ ID NO:The 255th of 142.

In some embodiments, the MG53 mutant has two or more mutant serines.Some In embodiment, two or more mutant serines of the MG53 mutant are included in one in 253-255 positions Mutant serine on individual or multiple sites.In some embodiments, the MG53 mutant is two or more Mutant serine is included in the mutant serine of the 253rd.In some embodiments, two or two of the MG53 mutant Mutant serine more than individual is included in the mutant serine of the 255th.In some embodiments, the MG53 mutant Two or more mutant serines are included in the mutant serine of the 253rd and the 255th.

It will be understood by those skilled in the art that may there is site residing for serine in the wild type MG53 albumen of different plant species Institute is different, therefore the serine sites that missing or mutation occurs may also be different.In some embodiments, lack Or the serine of mutation is located at SEQ ID NO:The upstream of corresponding serine sites in the amino acid sequence of wild type MG53 shown in 1 Or within 1 to 10 amino acid in downstream, within 1 to 5 amino acid or within 1 to 3 amino acid.

In some embodiments, the amino acid sequence of the MG53 mutant is SEQ ID NO:7、SEQ ID NO:8、 SEQ ID NO:9、SEQ ID NO:10、SEQ ID NO:11、SEQ ID NO:12、SEQ ID NO:147、SEQ ID NO: 148、SEQ ID NO:149 or SEQ ID NO:Amino acid sequence shown in 150.Preferably, in some embodiments, institute The amino acid sequence for stating MG53 mutant is SEQ ID NO:Amino acid sequence shown in 7.In some embodiments, it is described The amino acid sequence of MG53 mutant and SEQ ID NO:7、SEQ ID NO:8、SEQ ID NO:9、SEQ ID NO:10、SEQ ID NO:11、SEQ ID NO:12、SEQ ID NO:147、SEQ ID NO:148、SEQ ID NO:149、SEQ ID NO:150 One of shown amino acid sequence have at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%th, at least 98% or at least 99% amino acid sequence homology, and the MG53 mutant is with cell repair While function and/or Cardioprotective function, metabolism class side effect caused by wild type MG53 is avoided.

On the other hand, the application is related to a kind of pharmaceutical composition, and it includes the MG53 mutant and pharmaceutically acceptable Carrier.

On the other hand, the application is related to a kind of nucleic acid of separation, and it includes the amino acid sequence for encoding the MG53 mutant The nucleotide sequence of row.In some embodiments, the nucleic acid includes SEQ ID NO:Any nucleotide sequence shown in 13-18. In some embodiments, the nucleic acid includes SEQ ID NO:Any nucleotide sequence shown in 151-154.

On the other hand, the application is related to a kind of expression vector, and it includes the amino acid sequence for encoding the MG53 mutant Nucleotide sequence.In some embodiments, the nucleic acid includes SEQ ID NO:Any nucleotide sequence shown in 13-18. In some embodiments, the nucleic acid includes SEQ ID NO:Any nucleotide sequence shown in 151-154.

On the other hand, the application is related to a kind of host cell, and it includes expression vector described herein.

On the other hand, the application is related to a kind of preparation method of the MG53 mutant, and it includes：It is determined that need to be dashed forward One or more positions of the serine of change, to the complete of the plasmid of the nucleotide sequence comprising encoding wild type MG53 amino acid sequences Long sequence carries out the rite-directed mutagenesis in the position, by the plasmid transfection of the rite-directed mutagenesis to host cell, expresses the place Chief cell is to produce the MG53 mutant.In some embodiments, the rite-directed mutagenesis comprises the following steps：(1) determine The amino acid of the rite-directed mutagenesis corresponding nucleotide position in cDNA sequence is needed, according to the amino acid modification mutation position after mutation The nucleotide sequence put, and intercept the primers that the length comprising mutated site is 20-40bp；(2) with wild type MG53 plasmids are template, enter performing PCR using the primer of design in step (1) and react, and PCR primer enters row agarose gel electrophoresis, And PCR primer is purified；(3) PCR primer in step (2) after purification is anti-using nucleic acid restriction endonuclease progress digestion Should, and digestion products and suitable plasmid expression vector are attached, connection product is subjected to turning for bacterium competent cell Change, culture.In some embodiments, the rite-directed mutagenesis further comprises following steps：(4) picking step (3) gained gram The grand primer using designed by step (1) carries out bacterium colony PCR identifications, row agarose gel electrophoresis detection is entered to PCR primer, then DNA sequencing identification is carried out, identifies the positive colony with the rite-directed mutagenesis.

On the other hand, the application be related to the MG53 mutant prepare be used to treating heart disease, kidney trouble, with it is thin Purposes in the medicine of born of the same parents and/or tissue damage relevant disease.In some embodiments, the medicine is in treatment heart disease While disease, kidney trouble and cell and/or tissue damage relevant disease, metabolism class side effect, such as pancreas are avoid or reduced The side effects such as insulin resistance, obesity, diabetes, hypertension, dyslipidemia.In some embodiments, the heart disease is The disease related to myocardial damage, include but is not limited to, diabetic cardiomyopathy, myocardial ischemia, heart ischemia/Reperfusion injury Wound, miocardial infarction, heart failure, arrhythmia cordis, cardiac rupture, angina pectoris, myocarditis, coronary heart disease, pericarditis.In some implementations In mode, the kidney trouble includes but is not limited to, acute glomerulonephritis, CGN, nephrotic syndrome, acute Injury of kidney, diabetic nephropathy etc..In some embodiments, it is described to include with cell and/or tissue damage relevant disease but not It is limited to the disease related to kidney, brain, lung, liver, heart, spleen, gastral cell and/or tissue damage, skin damage Hinder related disease, for example, brain damage, injury of lungs, splenic injury, rupture of spleen, gastric ulcer, gastritis, gastric perforation, alimentary canal stick Membrane damage, wound, burn, ulcer, mucositis, asthma, COPD (COPD), apoplexy, skin aging etc..At certain In a little embodiments, the application is related to SEQ ID NO:Polypeptide shown in 7 prepare be used to treating heart disease, kidney trouble, With the purposes in the medicine of cell and/or tissue damage relevant disease.In some embodiments, the application is related to SEQ ID NO:147、SEQ ID NO:148、SEQ ID NO:149 or SEQ ID NO:Polypeptide shown in 150 is being prepared for treating the heart Purposes in dirty disease, kidney trouble and the medicine of cell and/or tissue damage relevant disease.

On the other hand, the application is related to one kind and treats heart disease, kidney trouble, related to cell and/or tissue damage The method of disease, including give the MG53 mutant of the subject effective dose of needs.In some embodiments, it is described MG53 mutant is avoided or subtracted while heart disease, kidney trouble and cell and/or tissue damage relevant disease is treated Metabolism class side effect, such as the side effect such as insulin resistance, obesity, diabetes, hypertension, dyslipidemia are lacked.In some realities Apply in mode, the heart disease is the disease related to myocardial damage, is included but is not limited to, diabetic cardiomyopathy, cardiac muscle Ischemic, heart ischemia/reperfusion injury, miocardial infarction, heart failure, arrhythmia cordis, cardiac rupture, angina pectoris, myocarditis, hat Worry, pericarditis.In some embodiments, the kidney trouble includes but is not limited to, and acute glomerulonephritis, chronic renal are small Ball ephritis, nephrotic syndrome, acute injury of kidney, diabetic nephropathy etc..In some embodiments, described and cell and/or group Damage relevant disease is knitted to include but is not limited to and kidney, brain, lung, liver, heart, spleen, gastral cell and/or tissue Related disease, the disease of skin injury correlation are damaged, for example, brain damage, injury of lungs, splenic injury, rupture of spleen, stomach are burst Ulcer, gastritis, gastric perforation, alimentary canal mucous membrane damage, wound, burn, ulcer, mucositis, asthma, COPD (COPD), apoplexy, skin aging etc..In some embodiments, the application be related to one kind treat heart disease, kidney trouble, With the method for cell and/or tissue damage relevant disease, including the SEQ ID NO of the subject effective dose of needs are given:7 institutes The polypeptide shown.In some embodiments, the application be related to one kind treat heart disease, kidney trouble, with cell and/or tissue The method of relevant disease is damaged, including gives the SEQ ID NO of the subject effective dose of needs:147、SEQ ID NO:148、 SEQ ID NO:149 or SEQ ID NO:Polypeptide shown in 150.

On the other hand, the application is related to for treating heart disease, kidney trouble, related to cell and/or tissue damage The MG53 mutant of disease.In some embodiments, the MG53 mutant treatment heart disease, kidney trouble, with it is thin Born of the same parents and/or while tissue damage relevant disease, avoid metabolism class side effect, for example, insulin resistance, obesity, diabetes, The side effects such as hypertension, dyslipidemia.In some embodiments, the heart disease is the disease related to myocardial damage, Including but not limited to, diabetic cardiomyopathy, myocardial ischemia, heart ischemia/reperfusion injury, miocardial infarction, heart failure, the heart Restrain not normal, cardiac rupture, angina pectoris, myocarditis, coronary heart disease, pericarditis.In some embodiments, the kidney trouble includes But it is not limited to, acute glomerulonephritis, CGN, nephrotic syndrome, acute injury of kidney, diabetic nephropathy etc.. It is described to include but is not limited to and kidney, brain, lung, liver with cell and/or tissue damage relevant disease in some embodiments The related disease of the related disease of dirty, heart, spleen, gastral cell and/or tissue damage, skin injury, for example, brain damages Wound, injury of lungs, splenic injury, rupture of spleen, gastric ulcer, gastritis, gastric perforation, alimentary canal mucous membrane damage, wound, burn, ulcer, Mucositis, asthma, COPD (COPD), apoplexy, skin aging etc..In some embodiments, the application relates to And for treating heart disease, kidney trouble, the SEQ ID NO with cell and/or tissue damage relevant disease:It is more shown in 7 Peptide.In some embodiments, the application be related to for treat heart disease, kidney trouble, with cell and/or tissue damage phase The SEQ ID NO of related disorders:147、SEQ ID NO:148、SEQ ID NO:149 or SEQ ID NO:Polypeptide shown in 150.

Brief description of the drawings

Fig. 1 shows wild type MG53 molecular structure ideograph.

Fig. 2 shows people's wild type MG53 amino acid sequence SEQ ID NO:1 and its nucleic acid sequence encoding SEQ ID NO: 19。

Fig. 3 shows mouse wild-type MG53 amino acid sequence SEQ ID NO:2 and its nucleic acid sequence encoding SEQ ID NO:20。

Fig. 4 shows wild-type rat MG53 amino acid sequence SEQ ID NO:3 and its nucleic acid sequence encoding SEQ ID NO:21。

Fig. 5 shows monkey wild type MG53 amino acid sequence SEQ ID NO:4 and its nucleic acid sequence encoding SEQ ID NO:22。

Fig. 6 shows pig wild type MG53 amino acid sequence SEQ ID NO:5 and its nucleic acid sequence encoding SEQ ID NO: 23。

Fig. 7 shows dog wild type MG53 amino acid sequence SEQ ID NO:6 and its nucleic acid sequence encoding SEQ ID NO: 24。

Fig. 8 shows the amino acid sequence SEQ ID NO of people's MG53 S255A mutant:7 and its nucleic acid sequence encoding SEQ ID NO:13。

Fig. 9 shows the amino acid sequence SEQ ID NO of mouse MG53 S255A mutant:8 and its nucleic acid sequence encoding SEQ ID NO:14。

Figure 10 shows the amino acid sequence SEQ ID NO of rat MG53 S255A mutant:9 and its nucleic acid sequence encoding SEQ ID NO:15。

Figure 11 shows the amino acid sequence SEQ ID NO of monkey MG53 S255A mutant:10 and its nucleic acid sequence encoding SEQ ID NO:16。

Figure 12 shows the amino acid sequence SEQ ID NO of pig MG53 S255A mutant:11 and its nucleic acid sequence encoding SEQ ID NO:17。

Figure 13 shows the amino acid sequence SEQ ID NO of dog MG53 S255A mutant:12 and its nucleic acid sequence encoding SEQ ID NO:18。

Figure 14 is shown in the cardiac muscle cell of the original cuiture of neonate rat is overexpressed mouse wild-type using adenovirus After MG53 and mouse MG53 S255A mutant, intracellular ATP amounts and LDH burst sizes.Upper figure is the primary training in neonate rat Mouse wild-type MG53 and mouse MG53S255A mutant are overexpressed using adenovirus in foster cardiac muscle cell, through hypoxia-reoxygenation Intracellular ATP content is detected after processing, Adv- β-gal represent expression galactosidase without expressing mouse wild-type MG53 And the comparison virus of mouse MG53 S255A mutant, Adv-MG53-myc represent expression mouse wild-type MG53 adenovirus, Adv-MG53-S255A-myc represents adenovirus (n=7, * p ＜ 0.05, * * the p ＜ of expression mouse MG53 S255A mutant 0.01)；Figure below be in the cardiac muscle cell of the original cuiture of neonate rat using adenovirus be overexpressed mouse wild-type MG53 and MG53 S255A mutant, detects the LDH of cell burst size after hypoxia-reoxygenation is handled, and Adv- β-gal represent expression gala Comparison virus of the glycosidase without expressing mouse wild-type MG53 and mouse MG53 S255A mutant, Adv-MG53-myc are represented Mouse wild-type MG53 adenovirus is expressed, Adv-MG53-S255A-myc represents the gland of expression mouse MG53 S255A mutant Viral (n=7, * * p ＜ 0.01, * * * p ＜ 0.005).

Figure 15 shows that mouse MG53 S255A mutation do not influence activation of the mouse wild-type MG53 to AKT.Upper figure is new Mouse wild-type MG53 and mouse MG53 S255A is overexpressed in the cardiac muscle cell of the original cuiture of raw rat using adenovirus to dash forward Variant, immunoblotting (Western Blot) detect intracellular p-AKT⁴⁷³Amount, β-gal represent expression galactoside Control adenovirus of the enzyme without expressing mouse wild-type MG53 and mouse MG53 S255A mutant, MG53 represent that expression mouse is wild Raw type MG53 adenovirus, S255A represent the adenovirus of expression mouse MG53 S255A mutant；Figure below is the statistics of upper figure Figure, Adv β-gal represent control gland of the expression galactosidase without expressing mouse wild-type MG53 and MG53 S255A mutant Virus, Adv MG53 represent expression mouse wild-type MG53 adenovirus, and Adv MG53 S255A represent expression mouse MG53 The adenovirus (n=5, * p ＜ 0.05) of S255A mutant.

Figure 16 shows the degradation of substrates of mouse MG53 S255A inhibition from mutation MG53 mediations.Figure 16 A upper figure be IRS1 and mouse wild-type MG53, mouse MG53 S255A mutant or mouse MG53-D- are overexpressed in HEK293T cell lines The plasmid of RING truncates, Western Blot detect IRS1 protein content, CON represent do not express mouse wild-type MG53, Mouse MG53 S255A mutant, the empty carrier plasmid control of mouse MG53-D-RING truncates, MG53 represent that expression mouse is wild Raw type MG53 vector plasmid, S255A represent the vector plasmid of expression mouse MG53 S255A mutant, and D-RING represents expression The MG53 truncates MG53-D-RING of mouse RING domains excision vector plasmid；Figure 16 A figure below is the statistical chart of upper figure (n=5, * p ＜ 0.05；* p ＜ 0.01)；Figure 16 B upper figure is that IR and mouse wild-type are overexpressed in HEK293T cell lines MG53, mouse MG53 S255A mutant or mouse MG53-D-RING truncates plasmid, Western Blot detections IR's Protein content, CON represent that not expressing mouse wild-type MG53, mouse MG53 S255A mutant, mouse MG53-D-RING truncates The empty carrier plasmid control of body, MG53 represent expression mouse wild-type MG53 vector plasmid, and S255A represents expression mouse MG53 The vector plasmid of S255A mutant, D-RING represent the vector plasmid of expression mouse MG53-D-RING truncates；Under Figure 16 B Figure is the statistical chart (n=5, * * p ＜ 0.01) of upper figure.

Figure 17 shows the degradation of substrates that people's MG53 S255A mutant inhibits MG53 to mediate.Upper figure is thin in HEK293T IRS1 and people's wild type MG53, people's MG53 S255A mutant or people's MG53-D-RING truncates matter are overexpressed in born of the same parents system Grain, Western Blot detect IRS1 protein content, and CON represents not expressing people's wild type MG53, people MG53 S255A mutation The empty carrier plasmid control of body, people's MG53-D-RING truncates, MG53 represent expression people's wild type MG53 vector plasmid, MG53-dR represents the vector plasmid of expression people's MG53-D-RING truncates；Figure below is statistical chart (n=5, * the * p of upper figure< 0.01)。

Figure 18 shows that mouse MG53 S255A mutant inhibits MG53 and substrate IRS1 combination.Figure 18 A are shown Mouse wild-type MG53 and MG53 substrate IRS1, or coexpression mouse MG53 S255A are co-expressed in HEK293T cell lines The substrate IRS1 of mutant and MG53, then immunoprecipitation IRS1 albumen and carry out Western Blot experiment detection MG53- The content of IRS1 compounds.MG53 in Figure 18 A represents that mouse wild-type MG53, MG53 S255A represent mouse MG53 S255A Mutant, IRS1 represent mouse islets element receptor substrate；Figure 18 B fix purifying in three-dimensional resonance (SPR) experiment such as surface Protein I RS1, detect its combination to the purifying protein mouse wild-type MG53 in mobile phase or mouse MG53 S255A mutant Intensity.MG53 in Figure 18 B represents that mouse wild-type MG53, MG53-S255A represent mouse MG53 S255A mutant, Rat IRS1 represents erythrocyte insulin receptor in rats following substrate.

Figure 19 shows influence of the mouse MG53 S255A mutant to IRS1 protein contents.Upper figure is in HEK293T cell lines Middle overexpression IRS1, the plasmid of Ub, MG53, MG53 S255A mutant, Western Blot detect IRS1 protein content.Ub Ubiquitin is represented, MG53 represents that mouse wild-type MG53, MG53-S255A represent mouse MG53 S255A mutant；Figure below is upper figure The statistical chart of experiment, CON represent not expressing the empty carrier plasmid pair of mouse wild-type MG53 and mouse MG53 S255A mutant According to MG53 represents expression mouse wild-type MG53 vector plasmid, and MG53-S255A represents expression mouse MG53 S255A mutation Vector plasmid (n=3, the * p of body<0.05；***p<0.005).

Figure 20 shows the amino acid sequence SEQ ID NO of people's MG53 hypotypes:139 (its corresponding NCBI numbering is ) and its nucleic acid sequence encoding SEQ ID NO BAD18630.1:143.

Figure 21 shows the amino acid sequence SEQ ID NO of people's MG53 hypotypes:140 (its corresponding NCBI numbering is XP_ And its nucleic acid sequence encoding SEQ ID NO 016878743.1):144.

Figure 22 shows the amino acid sequence SEQ ID NO of people's MG53 hypotypes:141 (its corresponding NCBI numbering is ) and its nucleic acid sequence encoding SEQ ID NO BAC03506.1:145.

Figure 23 shows the amino acid sequence SEQ ID NO of people's MG53 hypotypes:142 (its corresponding NCBI numbering is ) and its nucleic acid sequence encoding SEQ ID NO AAH33211.1:146.

Figure 24 shows the amino acid sequence SEQ ID NO of people's MG53 hypotype S255A mutant:147 and its code nucleic acid sequence Arrange SEQ ID NO:151.

Figure 25 shows the amino acid sequence SEQ ID NO of people's MG53 hypotype S255A mutant:148 and its code nucleic acid sequence Arrange SEQ ID NO:152.

Figure 26 shows the amino acid sequence SEQ ID NO of people's MG53 hypotype S255A mutant:149 and its code nucleic acid sequence Arrange SEQ ID NO:153.

Figure 27 shows the amino acid sequence SEQ ID NO of people's MG53 hypotype S255A mutant:150 and its code nucleic acid sequence Arrange SEQ ID NO:154.

Figure 28 shows the name schematic diagram of the total length MG53 albumen of each species in the application and its amino acid sites of fragment.

Detailed description of the invention

Although the application will in following discloses many aspects and embodiment, without prejudice to subject matter spirit and On the premise of scope, those skilled in the art obviously can carry out various equivalent changes and modification to it.It is disclosed in the present application more Individual aspect and embodiment are only used for for example, it is not intended to limit the application, and the real protection scope of the application is to weigh Profit requires to be defined.Unless otherwise noted, all technologies used herein and scientific terminology are respectively provided with and art of the present invention In the identical implication that is generally understood of those of ordinary skill.All bibliography for being quoted in the application, patent, patent Shen Please it is incorporated herein by reference by overall.

On the one hand, the application is related to a kind of MG53 mutant, wherein amino of the MG53 mutant in wild type MG53 On the basis of acid sequence, there is at least one serine missing in the coiled-coil-SPRY regions of the wild type MG53 And/or sport the amino acid of any other non-serine or threonine.

" wild type MG53 " or " wild type MG53 albumen " refer to what is expressed in subject to term used herein The native sequences or its fragment of total length MG53 albumen.MG53 albumen is a kind of multifunctional protein, and its structure is as shown in Figure 1.Each thing The total length MG53 length proteins of kind are slightly different, but generally have about 477 amino acid, by the TRIM domains and C-terminal of N-terminal SPRY domains composition, TRIM domains are by Ring, B-box, coiled-coil domain (RBCC) group for being sequentially connected Into.MG53 albumen is one of important component of film reparation, in the pre-adaptation protection and rear adaptation protection of ischemical reperfusion injury Play a significant role, while the high expression of MG53 albumen can also cause the generation of insulin resistance and metabolic syndrome.On MG53 structure, function and the interaction with other albumen, existing play-by-play in this area (see, e.g., Chuanxi Cai et al.,Journal of Biological Chemistry,284(5),3314-3322,(2009)； Xianhua Wang et al.,Circulation Research 107,76-83,(2010)；Eun Young Park et al.,Proteins,790-795(2009))。

Term " object " used herein includes the mankind and inhuman animal.Inhuman animal includes all Vertebrate, such as mammal and nonmammalian." object " can also be livestock animals, for example, ox, pig, sheep, poultry and Horse；Or rodent, such as rat, mouse；Or primate, such as ape, monkey；Or domestic animal, such as dog and cat. " object " can be male or female, can be old age, adult, teenager, child or baby.Mankind's " object " can be Caucasian, African, Asian, Semite, or the mixing of other ethnic or described ethnic backgrounds.

In some embodiments, the wild type MG53 is preferably derived from mammal, for example, people, ape, monkey, Mouse, rat, pig, dog etc..Those skilled in the art can be by open channel (for example, in American National Biotechnology Information Heart website (NCBI)) obtain each species wild type MG53 amino acid sequence, the wild type MG53 of each species amino acid sequence Row are incorporated by reference into the application.In some embodiments, the amino acid sequence of the wild type MG53 such as SEQ ID NO: 1、SEQ ID NO:2、SEQ ID NO:3、SEQ ID NO:4、SEQ ID NO:5 or SEQ ID NO:Shown in 6, correspond to respectively In the wild type MG53 full-length proteins of people, mouse, rat, monkey, pig, dog etc..

Term " albumen ", " polypeptide " and " peptide " used herein is interchangeable, and refers to the polymerization of amino acid Thing.Albumen, polypeptide or peptide described herein can contain natural amino acid, can also contain non-natural amino acid, or Analog, the analogies of amino acid.Albumen, polypeptide or peptide described herein can be obtained by any method well known in the art , such as, but not limited to, pass through naturally isolated, recombination expression, chemical synthesis etc..

Term " coiled-coil-SPRY domains " used herein is in wild type MG53 amino acid sequence A corresponding domain.Coiled-coil domains (that is, coiled-coil domain) are present in most of TRIM family proteins In, the either homology between TRIM member and other albumen or heterologous knot between domain mediation TRIM family members Conjunction forms the compounds such as dimer, polymer, so as to play cell repair function (see, e.g., Ozato et al., Nature Review Immunology,8:849-860(2008)；Sanchez S.et al.,PNAS,111:2494-2499 (2014)).SPRY domains are located at the C-terminal of wild type MG53 amino acid sequence, are usually located at wild type MG53 288-477 Amino acids region.In some embodiments, SPRY domains described herein include PRY motifs and SPRY motifs. SPRY domains are very conservative in evolution, from fungi to higher mammal in have expression (see, e.g., Ozato et al., Nature Review Immunology,8:849-860(2008)).So far, identified in different mammalian genomes To about 60 TRIM family members in, 15 members are in TRIM domains (i.e. Ring-B-box-Coiled-Coil structures Domain) a similar SPRY domain is carried afterwards, and MG53 shows the conservative one-level with these TRIM subfamily albumen Structure (see, e.g. WO2009/073808).Specific amino acid region site exists corresponding to Coiled-coil-SPRY domains It may be slightly different in different plant species, but those skilled in the art can be by the state of the art (for example, in NCBI Disclosure) and/or normal experiment method obtain the wild type MG53 of different plant species coiled-coil-SPRY domains Corresponding specific amino acid region site.In some embodiments, the coiled-coil-SPRY domains in the application Refer to wild type MG53 122-477 amino acids or the region similar with its structure.In some embodiments, it is described Structure zone similarity can include 70%, 80% or 90% continuous amino acid sequence in 122-477 amino acids The region of row.In some embodiments, the N-terminal initiation site of the structure zone similarity can be than 122-477 bit aminos The N-terminal of acid region, which increases, either shortens about 1,2,3,4,5,6,7,8,9,10,15 or 20 Individual amino acid, and/or its C-terminal termination site can increase or shorten about 1 than the C-terminal in 122-477 amino acids region Individual, 2,3,4,5,6,7,8,9,10,15 or 20 amino acid.For example, in some embodiment party In formula, the coiled-coil-SPRY domains in the application refer to wild type MG53 (that is, the SEQ ID NO of people:1) in Coiled-coil-SPRY domains, it corresponds to SEQ ID NO:1 122-477 amino acids.

Term " MG53 mutant " used herein or " MG53 protein mutants " refer to wild type MG53 albumen Natural acid sequence the MG53 protein variants or fragment that are modified.This kind of modification includes but is not limited to one or more amino Acid is lacked and/or is substituted.In some embodiments, amino acid sequence of the MG53 mutant in the application in wild type MG53 On the basis of row, there is at least one serine missing in the coiled-coil-SPRY domains of the wild type MG53 And/or sport the amino acid of any other non-serine or threonine.

" at least one serine " used herein refers to one or more serines.For example, refer to wild type 1 in MG53 coiled-coil-SPRY domains, 2,3,4,5,6,7,8,9,10,11 It is individual, 12,13,14,15,16,17,18,19,20,21,22,23,24,25,26 Individual, 27,28,29,30,31,32,33,34,35 or more serines.

" amino acid of other non-serines or threonine " used herein refer in addition to serine, threonine , any other natural amino acid, the natural amino acid of substitution, alpha-non-natural amino acid, substitution alpha-non-natural amino acid or its Any combinations.The title of natural amino acid is expressed as the single-letter or three-letter codes of standard in this application.Natural amino acid Including nonpolar amino acid and polar amino acid.Unless otherwise indicated, any amino acid as described herein can be D- or L- structures Type.

In some embodiments, at least one silk in the coiled-coil-SPRY domains of the wild type MG53 Propylhomoserin (Ser or S) lacks or sported nonpolar amino acid.The nonpolar amino acid includes glycine (Gly or G), third Propylhomoserin (Ala or A), leucine (Leu or L), isoleucine (Ile or I), valine (Val or V), proline (Pro or P), benzene Alanine (Phe or F), methionine (Met or M), tryptophan (Trp or W).In some embodiments, the wild type At least one serine in MG53 coiled-coil-SPRY domains lacks or sported glycine or alanine.It is excellent Selection of land, in some embodiments, at least one ammonia in the coiled-coil-SPRY domains of the wild type MG53 Acid missing sports alanine.It is highly preferred that in some embodiments, the coiled-coil- of the wild type MG53 At least one mutant serine in SPRY domains is alanine.

In some embodiments, at least one silk in the coiled-coil-SPRY domains of the wild type MG53 Propylhomoserin lacks or sported polar amino acid.The polar amino acid includes glutamine (Gln or Q), cysteine (Cys Or C), asparagine (Asn or N), tyrosine (Tyr or Y), aspartic acid (Asp or D), glutamic acid (Glu or E), lysine (Lys or K), arginine (Arg or R), histidine (His or H).In some embodiments, the wild type MG53 At least one serine in coiled-coil-SPRY domains lacks or sported cysteine or histidine.It is preferred that Ground, in some embodiments, at least one serine in the coiled-coil-SPRY domains of the wild type MG53 Lack or sport cysteine.It is highly preferred that in some embodiments, the coiled-coil- of the wild type MG53 At least one mutant serine in SPRY domains is cysteine.

In some embodiments, mutant serine described herein includes a serine by one or more non-silks Other of propylhomoserin or threonine 49-Phe ,82-Ser,115-Arg,144-Met,145-Asn ,161-Arg,169-Met Human Connective tissue growth factor, for example, serine can by 1,2,3,4,5,6,7 Other individual, 8,9 or 10 non-serines or threonine 49-Phe ,82-Ser,115-Arg,144-Met,145-Asn ,161-Arg,169-Met Human Connective tissue growth factors.If two or more serine quilts Substitution, then each serine can be separately by one or more non-serines or other 49-Phe ,82-Ser,115-Arg,144-Met,145-Asn ,161-Arg,169-Met Human Connective tissue growth factors of threonine.

Although each species wild type MG53 specific serine sites may be different with the different of species, Once amino acid area corresponding to known certain species wild type MG53 amino acid sequence and its coiled-coil-SPRY domains Domain, those skilled in the art are assured that the specific amino acid corresponding to the serine in coiled-coil-SPRY domains Site.For example, people's wild type MG53 known to those skilled in the art amino acid sequence such as SEQ ID NO:Shown in 1, its Coiled-coil-SPRY domains correspond to SEQ ID NO:1 122-477 amino acids.In this case, ability Field technique personnel are assured that the tool corresponding to the serine in people's wild type MG53 coiled-coil-SPRY domains Body amino acid sites are located at SEQ ID NO respectively:The 150th of 1, the 189th, the 211st, the 214th, the 246th, 255, the 269th, the 296th, the 297th, the 301st, the 305th, the 306th, the 307th, the 314th, the 341st Position, the 377th, the 405th, the 418th, the 425th, the 430th.

In some embodiments, the serine for occurring to lack or be mutated is located at people's wild type MG53 amino acid sequence SEQ ID NO:The 150th of 1, the 189th, the 211st, the 214th, the 246th, the 255th, the 269th, the 296th, 297th, the 301st, the 305th, the 306th, the 307th, the 314th, the 341st, the 377th, the 405th, the 418th Position, the 425th, one or more of the 430th site.

In some embodiments, MG53 albumen described herein includes total length MG53 albumen, or total length MG53 eggs White truncate (i.e. the fragment of the truncation of total length MG53 albumen), or have compared with total length MG53 albumen or its truncate One or more amino acid mutations either mutant of increase or deletion.In this case, for unified different MG53 The name of amino acid sites number in the amino acid sequence of protein subunit, when the ammonia that a certain MG53 protein subunits are mentioned in the application During base acid site, by the amino acid sequence of the amino acid sequence of the MG53 protein subunits and total length MG53 albumen (for example, SEQ ID NO:1) alignment is carried out, and introduces interval in related amino acid sequence when necessary, reaches identical amino acid number At most, the number of sites of the 1st amino acid of the amino acid sequence of the MG53 hypotypes is appointed as total length corresponding to the amino acid The amino acid sites number of MG53 albumen, so that when referring to certain species wild type MG53 amino acid sites number, either Total length MG53 albumen or its truncate, refer to the number of sites in the amino acid sequence of total length MG53 albumen.

For example, as shown in figure 28, the total length MG53 albumen of certain species has n amino acid, and corresponding amino acid sites are 1-n positions.The amino acid sequence of MG53 hypotypes 1 is compared with the amino acid sequence of total length MG53 albumen, containing corresponding to total length sequence The truncate of the m-n amino acids of row, then just by the number of sites of the 1st amino acid of the amino acid sequence of MG53 hypotypes 1 M positions are appointed as, the number of sites of the 2nd amino acid of the amino acid sequence of MG53 hypotypes 1 are appointed as m+1 positions, with such Push away, last amino acid sites of the amino acid sequence of MG53 hypotypes 1 are appointed as n-th.For another example MG53 hypotypes 2 Amino acid sequence contains the 1-s amino acids corresponding to full length sequence compared with the amino acid sequence of total length MG53 albumen Truncate, then the number of sites of the 1st amino acid of the amino acid sequence of MG53 hypotypes 2 is just appointed as the 1st, MG53 is sub- The number of sites of 2nd amino acid of the amino acid sequence of type 2 is appointed as the 2nd, by that analogy, by the amino acid of MG53 hypotypes 2 Last amino acid sites of sequence are appointed as s positions.For another example the amino acid sequence of MG53 hypotypes 3 and total length MG53 eggs White amino acid sequence is compared, the truncate containing the pth-q amino acids corresponding to full length sequence, then just by MG53 hypotypes The number of sites of 1st amino acid of 3 amino acid sequence is appointed as pth position, by the 2nd of the amino acid sequence of MG53 hypotypes 3 The number of sites of amino acid is appointed as pth+1, by that analogy, by last amino acid of the amino acid sequence of MG53 hypotypes 3 Site is appointed as q positions.

For example, SEQ ID NO:140 be one of wild type MG53 hypotypes of people, and it has 333 amino acid, corresponding to people Wild type MG53 full length sequence SEQ ID NO:1 145-477 amino acids fragments, in this case, by SEQ ID NO:1st amino acid (methionine) site of 140 amino acid sequence is appointed as SEQ ID NO:The 145th of 140, the 2nd Amino acid sites are appointed as SEQ ID NO:The 146th of 140, by that analogy, by SEQ ID NO:140 amino acid sequence Last amino acid sites is appointed as SEQ ID NO:The 477th of 140.In another example SEQ ID NO:141 be the wild of people One of type MG53 hypotypes, it also has 333 amino acid, with people wild type MG53 full length sequence SEQ ID NO:1 145-477 Amino acids are compared to only 1 amino acid difference, i.e. SEQ ID NO:The 315th of 1 is glutamic acid, and SEQ ID NO:141 Relevant position be glycine, in this case, by SEQ ID NO:1st amino acid (egg ammonia of 141 amino acid sequence Acid) site is appointed as SEQ ID NO:The 145th of 141, the 2nd amino acid sites are appointed as SEQ ID NO:The 146th of 141 Position, by that analogy, by SEQ ID NO:Last amino acid sites of 141 amino acid sequence are appointed as SEQ ID NO: The 477th of 141.For another example SEQ ID NO:142 be one of wild type MG53 hypotypes of people, and it has 269 amino acid, Corresponding to people wild type MG53 full length sequence SEQ ID NO:1 1-269 amino acids fragments, in this case, by SEQ ID NO:1st amino acid (methionine) site of 142 amino acid sequence is appointed as SEQ ID NO:The 1st of 142, will SEQ ID NO:2nd amino acid sites of 142 amino acid sequence are appointed as SEQ ID NO:The 2nd of 142, with such Push away, by SEQ ID NO:Last amino acid sites of 142 amino acid sequence are appointed as SEQ ID NO:The 269th of 142 Position.

In some embodiments, the serine for occurring to lack or be mutated is located at the amino acid sequence of people's wild type MG53 hypotypes Arrange SEQ ID NO:The 150th of 139, the 189th, the 211st, the 214th, the 246th, the 255th, the 269th, 296, the 297th, the 301st, the 305th, the 306th, the 307th, the 314th, the 341st, the 377th, the 405th Position, the 418th, one or more of the 425th or the 430th site.

In some embodiments, the serine for occurring to lack or be mutated is located at the amino acid sequence of people's wild type MG53 hypotypes Arrange SEQ ID NO:The 150th of 140, the 189th, the 211st, the 214th, the 246th, the 255th, the 269th, 296, the 297th, the 301st, the 305th, the 306th, the 307th, the 314th, the 341st, the 377th, the 405th Position, the 418th, one or more of the 425th or the 430th site.

In some embodiments, the serine for occurring to lack or be mutated is located at the amino acid sequence of people's wild type MG53 hypotypes Arrange SEQ ID NO:The 150th of 141, the 189th, the 211st, the 214th, the 246th, the 255th, the 269th, 296, the 297th, the 301st, the 305th, the 306th, the 307th, the 314th, the 341st, the 377th, the 405th Position, the 418th, one or more of the 425th or the 430th site.

In some embodiments, the serine for occurring to lack or be mutated is located at the amino acid sequence of people's wild type MG53 hypotypes Arrange SEQ ID NO:In the 150th, the 189th, the 211st, the 214th, the 246th, the 255th, the 269th of 142 One or more sites.

In some embodiments, the serine for occurring to lack or be mutated is located at mouse wild-type MG53 amino acid sequence SEQ ID NO:The 188th of 2, the 189th, the 210th, the 211st, the 214th, the 246th, the 253rd, the 255th, 269th, the 296th, the 297th, the 301st, the 305th, the 306th, the 307th, the 314th, the 341st, the 367th Position, the 377th, the 418th, the 430th, one or more of the 440th site.

In some embodiments, the serine for occurring to lack or be mutated is located at wild-type rat MG53 amino acid sequence SEQ ID NO:The 150th of 3, the 188th, the 189th, the 210th, the 211st, the 214th, the 246th, the 253rd, 255th, the 269th, the 296th, the 297th, the 301st, the 305th, the 307th, the 314th, the 341st, the 367th Position, the 377th, the 418th, the 430th, the 440th, the 464th, one or more of the 474th site.

In some embodiments, the serine for occurring to lack or be mutated is located at monkey wild type MG53 amino acid sequence SEQ ID NO:The 150th of 4, the 189th, the 211st, the 214th, the 246th, the 255th, the 269th, the 296th, 297th, the 301st, the 305th, the 306th, the 307th, the 341st, the 377th, the 405th, the 418th, the 425th Position, the 430th, one or more of the 464th site.

In some embodiments, the serine for occurring to lack or be mutated is located at pig wild type MG53 amino acid sequence SEQ ID NO:The 150th of 5, the 189th, the 211st, the 214th, the 246th, the 255th, the 269th, the 296th, 301st, the 305th, the 307th, the 314th, the 341st, the 377th, the 411st, the 418th, the 425th, the 430th Position, one or more of the 474th site.

In some embodiments, the serine for occurring to lack or be mutated is located at dog wild type MG53 amino acid sequence SEQ ID NO:The 150th of 6, the 189th, the 211st, the 214th, the 246th, the 255th, the 269th, the 296th, 297th, the 301st, the 305th, the 307th, the 314th, the 341st, the 367th, the 377th, the 418th, the 425th Position, one or more of the 430th site.

Although the specific serine sites that missing or mutation occurs may be different with the different of species, wild The serine sites of raw type MG53 albumen have well-conserved between each species.For example, for people, mouse, rat, monkey For the wild type MG53 albumen of son, pig, dog etc., the 189th of the amino acid sequence of respective wild type MG53 albumen, the 211st Position, the 214th, the 246th, the 255th, the 269th, the 296th, the 301st, the 305th, the 307th, the 341st, the 377, the 418th, the 430th are serines.In some embodiments, the serine of missing or mutation occurs positioned at open country Raw type MG53 amino acid sequence is (for example, SEQ ID NOs:1-6) the 189th, the 211st, the 214th, the 246th, 255, the 269th, the 296th, the 301st, the 305th, the 307th, the 341st, the 377th, the 418th, the 430th One or more of site.

In some embodiments, the amino acid sequence of the MG53 mutant is SEQ ID NO:7、SEQ ID NO:8、 SEQ ID NO:9、SEQ ID NO:10、SEQ ID NO:11、SEQ ID NO:12、SEQ ID NO:147、SEQ ID NO: 148、SEQ ID NO:149 or SEQ ID NO:150.It is highly preferred that in some embodiments, the MG53 mutant Amino acid sequence is SEQ ID NO:7.In some embodiments, the amino acid sequence of the MG53 mutant and SEQ ID NO:7、SEQ ID NO:8、SEQ ID NO:9、SEQ ID NO:10、SEQ ID NO:11、SEQ ID NO:12、SEQ ID NO:147、SEQ ID NO:148、SEQ ID NO:149、SEQ ID NO:One of sequence shown in 150 have at least 70%, extremely Few 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% amino acid sequence is same Source property, and the MG53 mutant avoids wild type with cell repair function and/or while Cardioprotective function Metabolism class side effect caused by MG53.

The percentage of " sequence homology " is defined as, for amino acid sequence, by candidate amino acid sequence and contrast Amino acid sequence carries out alignment, and introduces interval when necessary, identical amino acid number is reached most, and in this base On plinth calculate two amino acid sequences between same amino acid percentage；For nucleotide sequence, by candidate nucleic acid sequence Alignment is carried out with contrast nucleotide sequence, and introduces interval when necessary, identical nucleotide number is reached most, and On the basis of this calculate two nucleotide sequences between identical nucleotides percentage.

It can be contrasted by various ways known in the art to determine the percentage of homology.For example, public affairs can be used Drive available following instrument and carry out alignment, the instrument such as BLASTp (American National Biotechnology Information center websites (NCBI)：http://blast.ncbi.nlm.nih.gov/Blast.cgi, also it can be found in, Altschul S.F.et al., J.Mol.Biol., 215:403–410(1990)；Stephen F.et al, Nucleic Acids Res., 25:3389–3402 (1997)), ClustalW2 (European Bioinformatics research institute websites：http://www.ebi.ac.uk/Tools/msa/ Clustalw2/, reference can be made to, Higgins D.G.et al., Methods in Enzymology, 266:383-402(1996)； Larkin M.A.et al., Bioinformatics (Oxford, England), 23 (21):2947-8 (2007)) and TCoffee (bioinformatics research institute of Switzerland website, reference can be made to, Poirot O.et al., Nucleic Acids Res., 31 (13):3503-6(2003)；Notredame C.et al., J.Mol.Boil., 302 (1):205-17(2000)).Using soft Part carry out sequence alignment when, can use software provide default parameters, can also according to the appropriate adjusting parameter of needs of contrast, These are all within the knowledge of those skilled in the art.

In some embodiments, SEQ ID NOs:7-12、SEQ ID NOs:147-150 and with SEQ ID NOs: 7-12、SEQ ID NOs:MG53 mutant of the 147-150 with amino acid sequence homology with cell repair function and/ Or while Cardioprotective function, avoid or reduce metabolism class side effect caused by wild type MG53.

Present inventor is it has surprisingly been found that at least one in wild type MG53 coiled-coil-SPRY domains After serine lacks or sported the amino acid of any other non-serine or threonine, wild type MG53 can be avoided or reduced Caused metabolism class side effect, but have no effect on MG53 cell repair function and/or Cardioprotective function.Be not intended to by To any theoretical constraint, the above results are probably the silk ammonia in the coiled-coil-SPRY domains due to wild type MG53 The phosphorylation in sour site can significantly regulate and control MG53 E3 ubiquitin ligase functions, and adjust MG53 by substrate IR β and IRS1 To the regulating and controlling effect of insulin signaling system, but the phosphorylation of the serine sites in the domain does not regulate and control the thin of MG53 Born of the same parents' repair function and/or Cardioprotective function.

" cell repair function " used herein refers to, in cellular damage, particularly when cell acute damages, Wild type MG53 or MG53 mutant can carry out repairing recovery to the cell membrane of damaging cells, optionally, related by activating Signal pathway (for example, RISK approach) reduces cell death, promotes cells survival, so that cell recovers function.Some In embodiment, wild type MG53 or the MG53 mutant of the application can repair cell living, external cell or in vivo Cell.Wild type MG53 or the MG53 mutant of the application can also repair different types of cell, such as, but not limited to, Cardiac muscle cell, striated muscle cell, Skeletal Muscle Cell, kidney proximal renal tubular epithelial cells, alveolar epithelial cells, alimentary canal epithelium are thin Born of the same parents are (for example, mouth epithelial cells, esophageal epithelial cell, gastric epithelial cell, duodenal epithelium cell, intestinal epithelial cell, sky Enterocyte, ileal epithelium, colon epithelial cell), mucomembranous cell (for example, oral mucosa cell, schneiderian membrane cell, Gastric Mucosal Cells, small intestinal cell, colonic mucosal cells, Duodenal Mucosa cell), Skin Cell (such as epidermal cell, Epithelial cell, dermal cell, endothelial cell), (such as cells of vascular wall, vascular endothelial cell, blood vessel crust are thin for vascular cell Born of the same parents, vascular smooth muscle cells) etc..In some embodiments, wild type MG53 or the MG53 mutant that the application provides can be with Repair cardiac muscle cell, Skeletal Muscle Cell, striated muscle cell, kidney proximal renal tubular epithelial cells, alveolar epithelial cells etc..

The cell repair function of MG53 mutant described herein can be determined using method well known in the art.Example Such as it is mutated by being overexpressed wild type MG53 and MG53 described herein using adenovirus in neonatal rat myocardial cell (NRVM) Body, cell is stimulated using anoxic, detect the survival condition of cell (for example, being surveyed by ATP the and LDH concentration of mtt assay, culture medium Determine the detection such as method, TUNEL decoration methods (concrete operation step referring to Zhang.T et al.Nature Medicine, 175-184, (2016) control group), is then compared (for example, not expressing empty carrier negative control group, the mistake of wild type MG53, MG53 mutant Express wild type MG53 positive controls) and experimental group (that is, the group for being overexpressed MG53 mutant described herein) sight Index (for example, intracellular ATP levels, LDH emission levels etc.) is surveyed, to determine the cell of MG53 mutant described herein Repair function.

" Cardioprotective function " described herein refers to, in myocardial damage, particularly in myocardium acute injury, Wild type MG53 or MG53 mutant can be by the reparations to cardiac muscle cell's membrane damage, optionally, by activating cardiac muscle cell Coherent signal approach (for example, RISK approach) so as to realize the protection to cardiac muscle cell, and then improve cardioprotection.Can To determine the Cardioprotective function of MG53 mutant described herein using method well known in the art.Such as by breast Wild type MG53 and MG53 mutant described herein are overexpressed in rat cardiomyocyte (NRVM), cell is stimulated using anoxic, The survival condition of cell is detected (for example, being examined by mtt assay, ATP the and LDH concentration mensurations method of culture medium, TUNEL decoration methods etc. Survey (concrete operation step is referring to Zhang.T et al.Nature Medicine, 175-184, (2016)), then compare control Group is not (for example, expressing the empty carrier negative control group of wild type MG53, MG53 mutant, being overexpressed the wild type MG53 positive Control group) and experimental group (that is, the group for being overexpressed MG53 mutant described herein) observation index (for example, intracellular ATP Horizontal, LDH emission levels etc.), to investigate the Cardioprotective function of MG53 mutant described herein.In another example respectively Cardiac muscle cell is incubated using wild type MG53 and MG53 mutant proteins described herein, is stimulated using various (for example, lacking Oxygen, H₂O₂) guiding cell death, by comparing control group (for example, not only not having to wild type MG53 but also incubate without MG53 mutant The negative control group educated, the positive controls for being overexpressed wild type MG53) and experimental group (that is, dashed forward with MG53 described herein The group that variant is incubated) cell survival rate evaluate the Cardioprotective function of MG53 mutant described herein.Cell survival Rate can be determined by the measurement that MTT cell counts, LDH, ATP or TUNEL are dyed.

" side effect of metabolism class " described herein refers to, the treatment mesh occurred after the medicine of therapeutic dose is applied Outside, disease or discomfort caused by metabolic disorder, include but is not limited to, insulin resistance, obesity, diabetes, Hypertension, dyslipidemia etc..It is not intended to be bound by any theory, but it is believed that by determining MG53 E3 ubiquitin can connect Enzyme function is connect to evaluate the order of severity of metabolism class side effect.In some embodiments, as wild type MG53 coiled- At least one serine in coil-SPRY domains lacks or sported the amino acid of any other non-serine or threonine Afterwards, can suppress wild type MG53 at least 40%, at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%th, at least 90%, at least 95%, at least 98%, at least 99%, even 100% E3 ubiquitin ligase functions, so as to avoid Or metabolism class side effect caused by wild type MG53 is reduced, but have no effect on MG53 cell repair function and/or heart guarantor Protective function." avoiding or reduce metabolism class side effect caused by wild type MG53 " refers to do not occur wild type MG53 generations completely The side effect of metabolism class or be metabolized class side effect the order of severity than caused by corresponding wild type MG53 be metabolized class side effect Reduce at least 40%, at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, At least 95%, at least 98%, at least 99%, even 100%." MG53 cell repair function and/or Cardioprotective work(is not influenceed Can " refer to MG53 cell repair function and/or Cardioprotective function is not affected completely or MG53 cell repair Function and/or Cardioprotective function reduce at most 5%, at most 10%, at most 15%, at most 20%, at most 25%, at most 30% etc..

In some embodiments, the MG53 mutant that the application provides includes its analog.The MG53 mutant class A kind of polypeptide is referred to like thing, all or part for the MG53 mutant that its function having or architectural feature provide with the application Substantially it is similar, but the amino acid sequence of the MG53 mutant analog and wild type MG53 amino acid sequence are at least one Individual amino acid sites are different.The MG53 mutant analog can be the Partial Fragment, derivative or variant of MG53 mutant, And the modification of chemistry or biology can be included.The MG53 mutant analog can have the one or more of MG53 mutant The conservative replacement of amino acid, increase, deletion, insert, block, modifying (for example, phosphorylation, glycosylation, mark etc.) or its is any Combination.MG53 mutant analog can include the naturally occurring variant of MG53 mutant and artificially generated variant, such as pass through The artificial polypeptide sequence that recombination method or chemical synthesis obtain.MG53 mutant analog can include non-naturally occurring amino Sour residue.It will be understood by those skilled in the art that the analog of MG53 mutant described herein still remains and MG53 The essentially similar function of mutant, for example, the analog of MG53 mutant is with cell repair function and/or Cardioprotective While function, can avoid or reduce metabolism class side effect caused by wild type MG53, for example, insulin resistance, obesity, Diabetes, hypertension, dyslipidemia etc..

The conservative replacement of amino acid residue refers to the replacement between the similar amino acid of property, such as between polar amino acid Replacement (replacement between such as glutamine and asparagine), replacement (such as leucine, different bright ammonia between hydrophobic amino acid Replacement between acid, methionine and valine), and replacement (such as arginine, lysine between the amino acid with identical charges Replacement between histidine, or the replacement between glutamic acid and aspartic acid) etc..In some embodiments, the application Described MG53 mutant and SEQ ID NOs:7-12、SEQ ID NOs:Sequence is compared shown in 147-150, only in non-serine One or more amino acid sites have the conservative replacement of amino acid.In some embodiments, MG53 described herein dashes forward Variant and SEQ ID NOs:7-12、SEQ ID NOs:Sequence is compared shown in 147-150,2 in non-serine, 3,4, 5,6,7,8,9,10,15 or 20 amino acid sites have the conservative replacement of amino acid.

On the premise of activity is not influenceed, MG53 mutant described herein can also contain non-natural amino acid. Non-natural amino acid is included for example, β-fluoro alanine, 1-Methyl histidine, γ-methyleneglutaric acid, the bright ammonia of Alpha-Methyl Acid, 4,5- dehydrogenations lysine, hydroxy-proline, 3- difluorophenyls alanine, 3- amino tyrosine, 4- methyl tryptophans etc..

The MG53 mutant of the application can also be modified using method well known in the art.Such as, but not limited to, PEGylation, glycosylation, amino are terminal modified, fatty acylated, carboxyl is terminal modified, phosphorylation, methylate.

It will be understood by those skilled in the art that the MG53 mutant of the application is modified using method well known in the art Afterwards, the function essentially similar with MG53 mutant is still remained, for example, the MG53 mutant through modification is with cell While repair function and/or Cardioprotective function, metabolism class side effect caused by wild type MG53 can be avoided or reduce, For example, insulin resistance, obesity, diabetes, hypertension, dyslipidemia etc..

On the other hand, the application is related to a kind of pharmaceutical composition, and it includes MG53 mutant described herein and pharmacy Upper acceptable carrier.

Term " pharmaceutically acceptable carrier " used herein refers to, for giving administration object delivering MG53 mutation Pharmaceutically acceptable solvent, suspending agent or any other pharmacologically inert medium of body, it does not disturb MG53 mutant Structure and property.Some examples of such carriers can make MG53 mutant be configured to for example tablet, pill, capsule, liquid, gel, Syrup, slurries, suspension and lozenge to administration object to be orally ingested.Some examples of such carriers can be configured to MG53 mutant Injection, infusion or local administration.

The pharmaceutically acceptable carrier that can be used in the pharmaceutical composition of the application includes, but not limited to for example, medicine Learn acceptable liquid, gel or solid carriers, (for example, sodium chloride injection, ringer's solution parenteral solution is isotonic for aqueous media Glucose injection, Sterile Water Injection, or glucose and lactated Ringer's parenteral solution), non-aqueous phase medium is (for example, plant origin Fixed oil, cottonseed oil, corn oil, sesame oil or peanut oil), antimicrobial material, isotonic material (such as chlorine Change sodium or glucose), buffer solution (such as phosphate or citrate buffer), antioxidant (such as niter cake), anesthesia Agent (such as procaine hydrochloride), suspending agent/dispersant (such as sodium carboxymethylcellulose, hydroxypropyl methyl cellulose or poly- second Alkene pyrrolidone), chelating agent (such as EDTA (ethylenediamine tetra-acetic acid) or EGTA (double (2- amino-ethyls ether) tetrems of ethylene glycol Acid)), emulsifying agent (such as polysorbate80 (Tween-80)), diluent, adjuvant, auxiliary material or non-toxic auxiliary substances, other Component known to field, or more multiple combinations.Applicable component may include, for example, filler, adhesive, disintegrant, slow Fliud flushing, preservative, lubricant, stir taste agent, thickener, colouring agent or emulsifying agent.

In some embodiments, described pharmaceutical composition is oral formulations.Oral formulations include, but not limited to glue Capsule, wafer, pill, tablet, lozenge (being used for the substrate of taste, typically sucrose and Arabic gum or tragacanth), powder, particle Agent or be water or non-aqueous solution or suspension or Water-In-Oil or oil-in-water emulsion or be elixir or syrup or It is Pastilles (be applicable inert base, such as gelatin and glycerine, or sucrose or Arabic gum) and/or mouth-wash and its similar Thing.

In some embodiments, oral solid pharmaceutical preparation (such as capsule, tablet, pill, dragee, powder, particle) Include described MG53 mutant and one or more pharmaceutically acceptable carriers, such as sodium citrate or Dicalcium Phosphate, and/ Or following material：(1) filler or replenishers, such as starch, lactose, sucrose, glucose, mannitol, and/or silicic acid；(2) Adhesive, for example, carboxymethyl cellulose, alginate, gelatin, PVP, sucrose, and/or Arabic gum； (3) wetting agent, for example, glycerine；(4) disintegrating agent, for example, agar, calcium carbonate, potato or tapioca, alginic acid, certain A little silicate and sodium carbonate, (5) retardance agent solution, such as paraffin；(6) absorbent, such as quaternary ammonium compound are accelerated；(7) lubricate Agent, for example, acetyl alcohol and glycerin monostearate；(8) absorbent, such as kaolin and bentonite；(9) lubricant, such as talcum, Calcium stearate, magnesium stearate, solid polyethylene glycol, lauryl sodium sulfate and its mixture；With (10) colouring agent.

In some embodiments, oral liquid preparation includes pharmaceutically acceptable emulsion, microemulsion, solution, outstanding Floating agent, syrup and elixir etc..In addition to MG53 mutant, liquid dosage form can also contain conventional inert diluent, example Such as, water or other solvents, solubilizer and emulsifying agent, such as ethanol, isopropanol, ethyl carbonate, ethyl acetate, phenmethylol, benzene (first) Acid benzyl ester, propane diols, 1,3-BDO, oils (especially, cottonseed oil, peanut oil, corn oil, olive oil, castor oil and sesame Oil), glycerine, tetrahydrofurfuryl alcohol, polyethylene glycol and fatty acid sorbitol ester and mixture.In addition to inert diluent, orally Composition can also add adjuvant for example, wetting agent, emulsifying agent and suspending agent, sweetener, flavor enhancement, pigment, spices and anti-corrosion Agent.

In some embodiments, described pharmaceutical composition is ejection preparation.Ejection preparation include aseptic aqueous solution or Dispersion liquid, supensoid agent or emulsion.In all cases, described ejection preparation should be sterile and should be that liquid is noted with facilitating Penetrate.It produce and storage requirement under should keep stable, and should antimicrobial (such as bacterium and fungi) pollution.Carrier can To be a kind of solvent or decentralized medium, it is included, for example, water, ethanol, polyol (for example, glycerine, propane diols, and Liquid macrogol etc.) and its appropriate mixture and/or vegetable oil.Described ejection preparation should keep appropriate mobility, Appropriate mobility can maintain in several ways, for example, by using coatings such as such as lecithin, use surfactant etc.. Can be by adding various antibacterials and antifungal agent (for example, p-hydroxybenzoate, methaform, phenol, sorbic acid, thimerosal Deng) realize resisting microbial contamination.

In some embodiments, described pharmaceutical composition is mouthspray preparation or nasal spray preparation.The spray Mist preparation includes, but not limited to water-borne aerosol, non-aqueous suspensions, Liposomal formulation or solid particle preparation etc..It is water-based Aerosol is by by pharmaceutically acceptable carrier and the stabilizer one of the aqueous solution of agent or suspension and routine With preparation.The carrier changes with stabilizer according to the needs of specific compound, but it generally comprises non-ionic surface work Property agent (Tweens or polyethylene glycol), oleic acid, lecithin, amino acid such as glycine, buffer solution, salt, sugar or sugar alcohol.Aerosol Agent is generally prepared by isotonic solution, can pass through sprayer delivery.

In some embodiments, described pharmaceutical composition can be used in mixed way with one or more other drugs. In some embodiments, described composition includes at least one other drugs.In some embodiments, other described medicines Thing is cardiovascular drugs, the medicine for treating kidney trouble or medicine for cell repair etc..

In some embodiments, described pharmaceutical composition can be delivered in administration object by appropriate approach, Including but not limited to, oral route, injecting pathway (such as intravenous injection, intramuscular injection, hypodermic injection, intracutaneous injection, intracardiac are passed through Injection, intrathecal injection, intrapleural injection, intraperitoneal injection etc.), mucosal route (such as intranasal administration, oral administration), Epidural route, anal route, cutaneous routes, intraocular routes, pulmonary route.In some embodiments, described drug regimen Thing can pass through injection administration.

On the other hand, the application is related to a kind of nucleic acid of separation, and it includes the ammonia for encoding herein described MG53 mutant The nucleotide sequence of base acid sequence.

Term " separation " used herein refers to a kind of material (such as polypeptide or nucleic acid) with it in nature The environment of middle normal presence be separated or be present in from its environment of normal presence is different in nature environment.

Term " nucleic acid " used in this application or " polynucleotide " refer to ribonucleic acid (RNA), DNA (DNA) or ribonucleic acid-DNA mixture such as DNA-RNA hybrids.Nucleic acid or polynucleotide can be single Chain or double-stranded DNA or RNA or DNA-RNA hybrids.Nucleic acid or polynucleotide can be linear or ring-types.The application makes Term " coding " refers to be transcribed into mRNA and/or is translated as peptide or protein " for ... coding "." coded sequence " or " gene " refers to coding mRNA, the polynucleotide sequence of peptide or protein.The two terms are interchangeable in this application.

In some embodiments, the nucleic acid of the separation includes SEQ ID NO:Any nucleotide sequence shown in 13-18.

SEQ ID NO:13 be coding SEQ ID NO:The nucleotide sequence of amino acid sequence shown in 7, its particular sequence referring to Fig. 8.

SEQ ID NO:14 be coding SEQ ID NO:The nucleotide sequence of amino acid sequence shown in 8, its particular sequence referring to Fig. 9.

SEQ ID NO:15 be coding SEQ ID NO:The nucleotide sequence of amino acid sequence shown in 9, its particular sequence referring to Figure 10.

SEQ ID NO:16 be coding SEQ ID NO:The nucleotide sequence of amino acid sequence shown in 10, its particular sequence referring to Figure 11.

SEQ ID NO:17 be coding SEQ ID NO:The nucleotide sequence of amino acid sequence shown in 11, its particular sequence referring to Figure 12.

SEQ ID NO:18 be coding SEQ ID NO:The nucleotide sequence of amino acid sequence shown in 12, its particular sequence referring to Figure 13.

In some embodiments, the nucleic acid of the separation includes SEQ ID NO:Any nucleic acid sequence shown in 151-154 Row.

SEQ ID NO:151 be coding SEQ ID NO:The nucleotide sequence of amino acid sequence shown in 147, its particular sequence ginseng See Figure 24.

SEQ ID NO:152 be coding SEQ ID NO:The nucleotide sequence of amino acid sequence shown in 148, its particular sequence ginseng See Figure 25.

SEQ ID NO:153 be coding SEQ ID NO:The nucleotide sequence of amino acid sequence shown in 149, its particular sequence ginseng See Figure 26.

SEQ ID NO:154 be coding SEQ ID NO:The nucleotide sequence of amino acid sequence shown in 150, its particular sequence ginseng See Figure 27.

In some embodiments, the nucleic acid for the separation that the application provides includes and SEQ ID NOs:13-18、SEQ ID NOs:Any nucleotide sequence shown in 151-154 has the nucleotide sequence of at least 70% homology, for example, at least 75%, at least 80%th, at least 85%, at least 90%, at least 95% or at least 99% homology, and remain to encode SEQ ID NOs:7- 12、SEQ ID NOs:One of amino acid sequence shown in 147-150.

In some embodiments, this application provides coding SEQ ID NOs:7-12、SEQ ID NOs:147-150's Nucleotide sequence, but its nucleotide sequence is different from SEQ ID NOs due to the degeneracy of genetic code:13-18、SEQ ID NOs: Any nucleotide sequence shown in 151-154.

Term " degeneracy of genetic code " used herein refers to that same amino acid has two or more The phenomenon of corresponding codon.For example, proline has 4 synonym CCU, CCC, CCA, CCG.It is known in the art that by In the degeneracy of nucleic acid genetic password, the nucleic acid of some positions in certain known nucleic acid sequence can be replaced, but not Change the amino acid sequence of coding.Those skilled in the art can easily carry out the replacement of degenerate, for example, Pass through the site-directed mutagenesis technique of base.Different organisms are distinct to the Preference of different codons, are selected at some Biological cell in expression the application polypeptide, can select the preferred codon of the biological cell, obtain corresponding coding Sequence, MG53 mutant sequences (such as the SEQ ID NOs of the application are obtained by recombination expression:7-12、SEQ ID NOs: 147-150)。

On the other hand, the application is related to a kind of expression vector, and it includes the amino acid of MG53 mutant described herein The coded sequence of sequence.

Expression vector in the application can be, for example, DNA plasmid, bacterial plasmid, virus etc..The non-limit of expression vector Property example processed is such as Paul, 2002, Nature Biotechnology, 19,505；Miyagishi and Taira,2002, Nature Biotechnology,19,497；Lee etc., 2002, Nature Biotechnology, 19,500；And Novina Deng 2002, Nature Medicine, advance online publication doi:Described in 10.1038/nm725 's.Promoter can further be contained in the expression vector, its code sequence with the amino acid sequence of the MG53 mutant Row are operatively connected so that after the expression vector enters host cell, the promoter can start the table of coded sequence Reach.Expression vector can import host cell by appropriate method, such as, but not limited to, which calcium phosphate transfection, liposome turn Dye, electroporation transfection, bacterial heat shock etc., specific method refer to, " molecular cloning " (experiment that Sambrook et al. writes Handbook, Cold SpringHarbor, 1989).In some embodiments, expression vector described herein includes SEQ ID NO:13-18 institutes Any nucleotide sequence shown.

Host cell described herein can be eukaryotic or prokaryotic.Appropriate eukaryotic It can include, for example, mammalian cell, such as Chinese hamster ovary cell (CHO).Appropriate prokaryotic can include, example Such as, bacterium, such as Escherichia coli.

On the other hand, the application is related to the preparation method of the MG53 mutant, and the MG53 mutant that the application provides can Prepared with known technology by this area.For example, can be prepared by chemical synthesis process, genetic engineering can also be passed through It is prepared by method.

Chemical synthesis process mainly includes two methods of synthesis in solid state and liquid phase synthesis.Solid-phase peptide synthesis include, Such as Merrifield solid-phase synthesis, this method are documented in document " Merrifield, J.Am.Chem.Soc.85 in detail: 2149-2154 " and " M.Bodanszky et al., " Peptide Synthesis ", John Wiley＆Sons, Second Edition, 1976 " and " J.Meienhofer, " Hormonal Proteins and Peptides ", Vol.2, p.46, Academic Press (New York), in 1983 ".These entireties are incorporated into the application by reference at this As reference.Merrifield solid-phase synthesis mainly includes the following steps that, according to the amino acid sequence of target polypeptides, first make by The carboxyl-terminus amino acid of protection is connected with resin；Resin is washed after connection；Protection on decarboxylize end amino acid α amino Base (for example, tertbutyloxycarbonyl), the company of the not broken amino acid and interlaminar resin is have to ensure that when sloughing this protection group Connect key；Then the protected amino acid of penultimate carboxyl terminal is coupled on the resin of gained, when carrying out this coupling, An amido link is formed between the free carboxy of second amino acid and the amino for first amino acid being connected on resin；According to The amino acid order of connection of target polypeptides, is repeated in previous reaction process, until all amino acid are all connected on resin；Most Afterwards, cut protected peptide from resin, slough protection group and can obtain target polypeptides.The polypeptide of the application can also pass through liquid Method preparation is combined to, such as the solution method of peptide synthesis of standard can be used to prepare, this method is documented in document in detail “E.Schroder and K.Kubke,"The Peptides",Vol.1,Academic Press(New York),1965” In.The document is incorporated by the application by reference at this and is used as referring to.Liquid phase synthesizing method mainly includes, and utilizes Form the chemistry or enzyme method coupled stepwise amino acid or fragments of peptides of amido link.

Gene engineering method is to be expressed using the nucleotide sequence for encoding corresponding MG53 mutant in suitable host cell The method for generating corresponding mutant.Detailed description about this method refers to " molecular cloning " that Sambrook et al. writes (laboratory manual, Cold SpringHarbor, 1989).In some embodiments, the preparation method for the MG53 mutant that the application is related to The one or more positions for the serine being mutated including determining needs, to including encoding wild type MG53 amino acid sequences The full length sequence of the plasmid of nucleotide sequence carries out the rite-directed mutagenesis in the position, by the plasmid transfection of the rite-directed mutagenesis to place Chief cell, the host cell is expressed to produce the MG53 mutant.

Term " rite-directed mutagenesis " used herein refers to, change interested is introduced into target DNA fragment, including The addition of base, deletion, replacement etc..In some embodiments, the target DNA fragment is wild type MG53 coded sequence SEQ ID NOs:19-24、SEQ ID NOs:143-146, the site for introducing mutation are located at the coiled- of the wild type MG53 One or more of the coded sequence of coil-SPRY domains serine sites.

SEQ ID NO:19 be coding SEQ ID NO:The nucleotide sequence of amino acid sequence shown in 1, its particular sequence referring to Fig. 2.

SEQ ID NO:20 be coding SEQ ID NO:The nucleotide sequence of amino acid sequence shown in 2, its particular sequence referring to Fig. 3.

SEQ ID NO:21 be coding SEQ ID NO:The nucleotide sequence of amino acid sequence shown in 3, its particular sequence referring to Fig. 4.

SEQ ID NO:22 be coding SEQ ID NO:The nucleotide sequence of amino acid sequence shown in 4, its particular sequence referring to Fig. 5.

SEQ ID NO:23 be coding SEQ ID NO:The nucleotide sequence of amino acid sequence shown in 5, its particular sequence referring to Fig. 6.

SEQ ID NO:24 be coding SEQ ID NO:The nucleotide sequence of amino acid sequence shown in 6, its particular sequence referring to Fig. 7.

SEQ ID NO:143 be coding SEQ ID NO:The nucleotide sequence of amino acid sequence shown in 139, its particular sequence ginseng See Figure 20.

SEQ ID NO:144 be coding SEQ ID NO:The nucleotide sequence of amino acid sequence shown in 140, its particular sequence ginseng See Figure 21.

SEQ ID NO:145 be coding SEQ ID NO:The nucleotide sequence of amino acid sequence shown in 141, its particular sequence ginseng See Figure 22.

SEQ ID NO:146 be coding SEQ ID NO:The nucleotide sequence of amino acid sequence shown in 142, its particular sequence ginseng See Figure 23.

In some embodiments, the rite-directed mutagenesis comprises the following steps：

(1) determine to need the amino acid of the rite-directed mutagenesis corresponding nucleotide position in cDNA sequence, after mutation Amino acid changes the nucleotide sequence of mutated site, and intercepts the sequences Design that the length comprising mutated site is 20-40bp and draw Thing；

(2) using wild type MG53 plasmids as template, enter performing PCR using the primer of design in step (1) and react, PCR primer Enter row agarose gel electrophoresis, and PCR primer is purified；

(3) PCR primer in step (2) after purification carries out endonuclease reaction using nucleic acid restriction endonuclease, and by digestion Product is attached with suitable plasmid expression vector, and connection product is carried out to the conversion of bacterium competent cell, culture.

In some embodiments, the rite-directed mutagenesis further comprises following steps：

(4) picking step (3) institute DCRP carries out bacterium colony PCR identifications using the primer designed by step (1), and PCR is produced Thing enters row agarose gel electrophoresis detection, then carries out DNA sequencing identification, identifies positive gram with the rite-directed mutagenesis It is grand.

Various commercially available site-directed mutagenesis kits can be used to carry out rite-directed mutagenesis to wild type MG53, such as with reference to Beijing The specification of the Easy Mutagenesis System kits of Quan Shi King Companies, wherein describing the side of rite-directed mutagenesis in detail Method and step.

Term " therapeutically effective amount " used herein refers to, it is possible to achieve suppresses or alleviate disease or the disease of object Shape, or can prophylactically suppress prevent disease or symptom occur medicine amount.Therapeutically effective amount can be by object One or more diseases or remission medicine to a certain extent amount；Can be related with disease or the symptom origin cause of formation by those One or more physiology or biochemical parameters partially or completely return to the amount of normal medicine；And/or disease can be reduced The amount of the medicine for the possibility that disease or symptom occur.

Embodiment

The biologic material being related to such as coli strain, various cloning and expression plasmids, culture in all embodiments Base, toolenzyme, buffer solution, and various cultural methods, protein extraction and purification process, other molecular biology manipulations methods, It is that art personnel are familiar with, may be referred to " molecular cloning " (laboratory manual, cold spring that Sambrook et al. writes Port, 1989) and " fine works molecular biology experiment guide " (U.S./F. Ao Sibai etc. are write, and face sub- grain husk etc. is translated, Beijing, scientific publication Society, 1998).

Embodiment 1：The preparation of MG53 mutant

1. the preparation of people's MG53 mutant

People's MG53 S255A mutant

(1) mutant primer is designed：It is determined that need amino acid corresponding nucleotide position, control in cDNA sequence of point mutation Amino acid code sublist, the nucleotide sequence of mutated site is changed according to the amino acid after mutation, and intercepts mutated site upstream Primers between 20bp and downstream 10bp.Primer sequence is as follows：

People's MG53 S255A forward primers：tgcagaagatcctggcagaggctcccccacccg(SEQ ID NO:25)

People's MG53 S255A reverse primers：tccagacgggcgggtgggggagcctctgccagg(SEQ ID NO:26)

(2) PCR (PCR) of plasmid full-length clone：Using antigen gene expressed plasmid as template, design is used Point mutation primer, using high-fidelity Taq enzyme enter performing PCR reaction, whole gene expression plasmid.Reaction system and reaction condition ginseng According to as follows：

(3) agarose gel electrophoresis of PCR primer：PCR primer enters row agarose gel electrophoresis, with identify its purity and Quantity.

(4) ethanol precipitation of PCR primer：The correct and single band PCR primer for size, in the method for ethanol precipitation Purified.

(5) Dpn I digestions：PCR primer after purification carries out endonuclease reaction using nucleic acid restriction endonuclease Dpn I.

(6) conversion of digestion products：Dpn I digestion products are carried out with the conversion of bacterium competent cell, it is suitable to be applied to Screening flat board on cultivated.

(7) identification of positive colony：Picking size suitable clones carry out bacterium colony PCR identifications, and agarose is carried out to PCR primer Detected through gel electrophoresis, and size clear for band correctly clone progress small size and shake bacterium amplification cultivation, then surveyed Sequence is identified.

Prepare in the same manner people MG53 S255G, S255L, S255V, S255P, S255F, S255W, S255Q, S255C, S255Y, S255D, S255R, S211A, S214A, S246A, S269A, S296A, S297A mutant.Except mutation is drawn Outside thing difference, other steps are identical with the preparation process of people's MG53 S255A mutant.The following institute of primer of each mutant Show：

(i) people MG53 S255G forward and reverse primer, people MG53 S255G represent wild type MG53 (that is, the SEQ of people ID NO:1) the 255th mutant serine is the MG53 mutant of glycine.

People's MG53 S255G forward primers：tgcagaagatcctggcagagggtcccccacccg(SEQ ID NO:27)

People's MG53 S255G reverse primers：tccagacgggcgggtgggggaccctctgccagg(SEQ ID NO:28)

(ii) people MG53 S255L forward and reverse primer, people MG53 S255L represent the wild type MG53 of people (i.e., SEQ ID NO:1) the 255th mutant serine is the MG53 mutant of leucine.

People's MG53 S255L forward primers：tgcagaagatcctggcagagcttcccccacccg(SEQ ID NO:29)

People's MG53 S255L reverse primers：tccagacgggcgggtgggggaagctctgccagg(SEQ ID NO:30)

(iii) people MG53 S255V forward and reverse primer, people MG53 S255V represent the wild type MG53 of people (i.e., SEQ ID NO:1) the 255th mutant serine is the MG53 mutant of valine.

People's MG53 S255V forward primers：tgcagaagatcctggcagaggttcccccacccg(SEQ ID NO:31)

People's MG53 S255V reverse primers：tccagacgggcgggtgggggaacctctgccagg(SEQ ID NO:32)

(iv) people MG53 S255P forward and reverse primer, people MG53 S255P represent the wild type MG53 of people (i.e., SEQ ID NO:1) the 255th mutant serine is the MG53 mutant of proline.

People's MG53 S255P forward primers：tgcagaagatcctggcagagcctcccccacccg(SEQ ID NO:33)

People's MG53 S255P reverse primers：tccagacgggcgggtgggggaggctctgccagg(SEQ ID NO:34)

(v) people MG53 S255F forward and reverse primer, people MG53 S255F represent wild type MG53 (that is, the SEQ of people ID NO:1) the 255th mutant serine is the MG53 mutant of phenylalanine.

People's MG53 S255F forward primers：tgcagaagatcctggcagagtttcccccacccg(SEQ ID NO:35)

People's MG53 S255F reverse primers：tccagacgggcgggtgggggaaactctgccagg(SEQ ID NO:36)

(vi) people MG53 S255W forward and reverse primer, people MG53 S255W represent the wild type MG53 of people (i.e., SEQ ID NO:1) the 255th mutant serine is the MG53 mutant of tryptophan.

People's MG53 S255W forward primers：tgcagaagatcctggcagagtggcccccacccg(SEQ ID NO:37)

People's MG53 S255W reverse primers：tccagacgggcgggtgggggccactctgccagg(SEQ ID NO:38)

(vii) people MG53 S255Q forward and reverse primer, people MG53 S255Q represent the wild type MG53 of people (i.e., SEQ ID NO:1) the 255th mutant serine is the MG53 mutant of glutamine.

People's MG53 S255Q forward primers：tgcagaagatcctggcagagcaacccccacccg(SEQ ID NO:39)

People's MG53 S255Q reverse primers：tccagacgggcgggtgggggttgctctgccagg(SEQ ID NO:40)

(viii) people MG53 S255C forward and reverse primer, people MG53 S255C represent the wild type MG53 of people (i.e., SEQ ID NO:1) the 255th mutant serine is the MG53 mutant of cysteine.

People's MG53 S255C forward primers：tgcagaagatcctggcagagtgtcccccacccg(SEQ ID NO:41)

People's MG53 S255C reverse primers：tccagacgggcgggtgggggacactctgccagg(SEQ ID NO:42)

(ix) people MG53 S255Y forward and reverse primer, people MG53 S255Y represent the wild type MG53 of people (i.e., SEQ ID NO:1) the 255th mutant serine is the MG53 mutant of tyrosine.

People's MG53 S255Y forward primers：tgcagaagatcctggcagagtatcccccacccg(SEQ ID NO:43)

People's MG53 S255Y reverse primers：tccagacgggcgggtgggggatactctgccagg(SEQ ID NO:44)

(x) people MG53 S255D forward and reverse primer, people MG53 S255D represent wild type MG53 (that is, the SEQ of people ID NO:1) the 255th mutant serine is the MG53 mutant of aspartic acid.

People's MG53 S255D forward primers：tgcagaagatcctggcagaggatcccccacccg(SEQ ID NO:45)

People's MG53 S255D reverse primers：tccagacgggcgggtgggggctactctgccagg(SEQ ID NO:46)

(xi) people MG53 S255R forward and reverse primer, people MG53 S255R represent the wild type MG53 of people (i.e., SEQ ID NO:1) the 255th mutant serine is arginic MG53 mutant.

People's MG53 S255R forward primers：tgcagaagatcctggcagagcgtcccccacccg(SEQ ID NO:47)

People's MG53 S255R reverse primers：tccagacgggcgggtgggggacgctctgccagg(SEQ ID NO:48)

(xii) people MG53 S211A forward and reverse primer, people MG53 S211A represent the wild type MG53 of people (i.e., SEQ ID NO:1) the 211st mutant serine is the MG53 mutant of alanine.

People's MG53 S211A forward primers：ccttgcgccgggagctgggggccctgaactctt(SEQ ID NO:49)

People's MG53 S211A reverse primers：gctgctccaggtaagagttcagggcccccagctcc(SEQ ID NO: 50)

(xiii) people MG53 S214A forward and reverse primer, people MG53 S214A represent the wild type MG53 of people (i.e., SEQ ID NO:1) the 214th mutant serine is the MG53 mutant of alanine.

People's MG53 S214A forward primers：gggagctggggagcctgaacgcttacctggagc(SEQ ID NO:51)

People's MG53 S214A reverse primers：tgccgcagctgctccaggtaagcgttcaggctc(SEQ ID NO:52)

(xiv) people MG53 S246A forward and reverse primer, people MG53 S246A represent the wild type MG53 of people (i.e., SEQ ID NO:1) the 246th mutant serine is the MG53 mutant of alanine.

People's MG53 S246A forward primers：tgaaatactgcctggtgaccgccaggctgcaga(SEQ ID NO:53)

People's MG53 S246A reverse primers：gccaggatcttctgcagcctggcggtcaccagg(SEQ ID NO:54)

(xv) people MG53 S269A forward and reverse primer, people MG53 S269A represent the wild type MG53 of people (i.e., SEQ ID NO:1) the 269th mutant serine is the MG53 mutant of alanine.

People's MG53 S269A forward primers：aggagctgacctttgacccggcctctgcgcacc(SEQ ID NO:55)

People's MG53 S296A reverse primers：accaggctcgggtgcgcagaggccgggtcaaag(SEQ ID NO:56)

(xvi) people MG53 S297A forward and reverse primer, people MG53 S297A represent the wild type MG53 of people (i.e., SEQ ID NO:1) the 297th mutant serine is the MG53 mutant of alanine.

People's MG53 S297A forward primers：agctgacctttgacccgagcgctgcgcacccga(SEQ ID NO:57)

People's MG53 S297A reverse primers：accaccaggctcgggtgcgcagcgctcgggtca(SEQ ID NO:58)

2. the preparation of mouse MG53 mutant

According to people's MG53 S255A mutant identicals method prepare mouse MG53 S255A, S255G, S255L, S255W, S255Q, S255Y, S255D, S255R mutant.In addition to mutant primer difference, other steps are dashed forward with people MG53 S255A The preparation process of variant is identical.The primer of each mutant is as follows：

(i) mouse MG53 S255A forward and reverse primer, mouse MG53 S255A represent the wild type MG53 of mouse (that is, SEQ ID NO:2) the 255th mutant serine is the MG53 mutant of alanine.

Mouse MG53 S255A forward primers：tgcagaagatcctgtcagaggcaccaccaccgg(SEQ ID NO: 59)

Mouse MG53 S255A reverse primers：tctagccttgccggtggtggtgcctctgacagg(SEQ ID NO: 60)

(ii) mouse MG53 S255G forward and reverse primer, mouse MG53 S255G represent the wild type MG53 of mouse (that is, SEQ ID NO:2) the 255th mutant serine is the MG53 mutant of glycine.

Mouse MG53 S255G forward primers：tgcagaagatcctgtcagagggaccaccaccgg(SEQ ID NO: 61)

Mouse MG53 S255G reverse primers：tctagccttgccggtggtggtccctctgacagg(SEQ ID NO: 62)

(iii) mouse MG53 S255L forward and reverse primer, mouse MG53 S255L represent the wild type of mouse MG53 (that is, SEQ ID NO:2) the 255th mutant serine is the MG53 mutant of leucine.

Mouse MG53 S255L forward primers：tgcagaagatcctgtcagagttaccaccaccgg(SEQ ID NO: 63)

Mouse MG53 S255L reverse primers：tctagccttgccggtggtggtaactctgacagg(SEQ ID NO: 64)

(iv) mouse MG53 S255W forward and reverse primer, mouse MG53 S255W represent the wild type MG53 of mouse (that is, SEQ ID NO:2) the 255th mutant serine is the MG53 mutant of tryptophan.

Mouse MG53 S255W forward primers：tgcagaagatcctgtcagagtggccaccaccgg(SEQ ID NO: 65)

Mouse MG53 S255W reverse primers：tctagccttgccggtggtggccactctgacagg(SEQ ID NO: 66)

(v) mouse MG53 S255Q forward and reverse primer, mouse MG53 S255Q represent the wild type MG53 of mouse (that is, SEQ ID NO:2) the 255th mutant serine is the MG53 mutant of glutamine.

Mouse MG53 S255Q forward primers：tgcagaagatcctgtcagagcaaccaccaccgg(SEQ ID NO: 67)

Mouse MG53 S255Q reverse primers：tctagccttgccggtggtggttgctctgacagg(SEQ ID NO: 68)

(vi) mouse MG53 S255Y forward and reverse primer, mouse MG53 S255Y represent the wild type MG53 of mouse (that is, SEQ ID NO:2) the 255th mutant serine is the MG53 mutant of tyrosine.

Mouse MG53 S255Y forward primers：tgcagaagatcctgtcagagtatccaccaccgg(SEQ ID NO: 69)

Mouse MG53 S255Y reverse primers：tctagccttgccggtggtggatactctgacagg(SEQ ID NO: 70)

(vii) mouse MG53 S255D forward and reverse primer, mouse MG53 S255D represent the wild type of mouse MG53 (that is, SEQ ID NO:2) the 255th mutant serine is the MG53 mutant of aspartic acid.

Mouse MG53 S255D forward primers：tgcagaagatcctgtcagaggatccaccaccgg(SEQ ID NO: 71)

Mouse MG53 S255D reverse primers：tctagccttgccggtggtggatcctctgacagg(SEQ ID NO: 72)

(viii) mouse MG53 S255R forward and reverse primer, mouse MG53 S255R represent the wild type of mouse MG53 (that is, SEQ ID NO:2) the 255th mutant serine is arginic MG53 mutant.

Mouse MG53 S255R forward primers：tgcagaagatcctgtcagagcgaccaccaccgg(SEQ ID NO: 73)

Mouse MG53 S255R reverse primers：tctagccttgccggtggtggtcgctctgacagg(SEQ ID NO: 74)

3. the preparation of rat MG53 mutant

According to people's MG53 S255A mutant identicals method prepare rat MG53 S255A, S255G, S255L, S255W, S255Q, S255Y, S255D, S255R mutant.In addition to mutant primer difference, other steps are dashed forward with people MG53 S255A The preparation process of variant is identical.The primer of each mutant is as follows：

(i) rat MG53 S255A forward and reverse primer, rat MG53 S255A represent the wild type MG53 of rat (that is, SEQ ID NO:3) the 255th mutant serine is the MG53 mutant of alanine.

Rat MG53 S255A forward primers：tgcagaagattctgtcagaggcaccacccccag(SEQ ID NO: 75)

Rat MG53 S255A reverse primers：tctagccttgctgggggtggtgcctctgacaga(SEQ ID NO: 76)

(ii) rat MG53 S255G forward and reverse primer, rat MG53 S255G represent the wild type MG53 of rat (that is, SEQ ID NO:3) the 255th mutant serine is the MG53 mutant of glycine.

Rat MG53 S255G forward primers：tgcagaagattctgtcagagggaccacccccag(SEQ ID NO: 77)

Rat MG53 S255G reverse primers：tctagccttgctgggggtggtccctctgacaga(SEQ ID NO: 78)

(iii) rat MG53 S255L forward and reverse primer, rat MG53 S255L represent the wild type of rat MG53 (that is, SEQ ID NO:3) the 255th mutant serine is the MG53 mutant of leucine.

Rat MG53 S255L forward primers：tgcagaagattctgtcagagttaccacccccag(SEQ ID NO: 79)

Rat MG53 S255L reverse primers：tctagccttgctgggggtggtaactctgacaga(SEQ ID NO: 80)

(iv) rat MG53 S255W forward and reverse primer, rat MG53 S255W represent the wild type MG53 of rat (that is, SEQ ID NO:3) the 255th mutant serine is the MG53 mutant of tryptophan.

Rat MG53 S255W forward primers：tgcagaagattctgtcagagtggccacccccag(SEQ ID NO: 81)

Rat MG53 S255W reverse primers：tctagccttgctgggggtggccactctgacaga(SEQ ID NO: 82)

(v) rat MG53 S255Q forward and reverse primer, rat MG53 S255Q represent the wild type MG53 of rat (that is, SEQ ID NO:3) the 255th mutant serine is the MG53 mutant of glutamine.

Rat MG53 S255Q forward primers：tgcagaagattctgtcagagcaaccacccccag(SEQ ID NO: 83)

Rat MG53 S255Q reverse primers：tctagccttgctgggggtggttgctctgacaga(SEQ ID NO: 84)

(vi) rat MG53 S255Y forward and reverse primer, rat MG53 S255Y represent the wild type MG53 of rat (that is, SEQ ID NO:3) the 255th mutant serine is the MG53 mutant of tyrosine.

Rat MG53 S255Y forward primers：tgcagaagattctgtcagagtatccacccccag(SEQ ID NO: 85)

Rat MG53 S255Y reverse primers：tctagccttgctgggggtggatactctgacaga(SEQ ID NO: 86)

(vii) rat MG53 S255D forward and reverse primer, rat MG53 S255D represent the wild type of rat MG53 (that is, SEQ ID NO:3) the 255th mutant serine is the MG53 mutant of aspartic acid.

Rat MG53 S255D forward primers：tgcagaagattctgtcagaggatccacccccag(SEQ ID NO: 87)

Rat MG53 S255D reverse primers：tctagccttgctgggggtggatcctctgacaga(SEQ ID NO: 88)

(viii) rat MG53 S255R forward and reverse primer, rat MG53 S255R represent the wild type of rat MG53 (that is, SEQ ID NO:3) the 255th mutant serine is arginic MG53 mutant.

Rat MG53 S255R forward primers：tgcagaagattctgtcagagcgaccacccccag(SEQ ID NO: 89)

Rat MG53 S255R reverse primers：tctagccttgctgggggtggtcgctctgacaga(SEQ ID NO: 90)

4. the preparation of monkey MG53 mutant

According to people's MG53 S255A mutant identicals method prepare monkey MG53 S255A, S255G, S255L, S255W, S255Q, S255Y, S255D, S255R mutant.In addition to mutant primer difference, other steps are dashed forward with people MG53 S255A The preparation process of variant is identical.The primer of each mutant is as follows：

(i) monkey MG53 S255A forward and reverse primer, monkey MG53 S255A represent the wild type MG53 of monkey (that is, SEQ ID NO:4) the 255th mutant serine is the MG53 mutant of alanine.

Monkey MG53 S255A forward primers：aagatcctggcagaggctcccccacccgcccgtctg(SEQ ID NO:91)

Monkey MG53 S255A reverse primers：cagacgggcgggtgggggagcctctgccaggatctt(SEQ ID NO:92)

(ii) monkey MG53 S255G forward and reverse primer, monkey MG53 S255G represent the wild type MG53 of monkey (that is, SEQ ID NO:4) the 255th mutant serine is the MG53 mutant of glycine.

Monkey MG53 S255G forward primers：aagatcctggcagagggtcccccacccgcccgtctgg(SEQ ID NO:93)

Monkey MG53 S255G reverse primers：ccagacgggcgggtgggggaccctctgccaggatctt(SEQ ID NO:94)

(iii) monkey MG53 S255L forward and reverse primer, monkey MG53 S255L represent the wild type of monkey MG53 (that is, SEQ ID NO:4) the 255th mutant serine is the MG53 mutant of leucine.

Monkey MG53 S255L forward primers：agatcctggcagagttacccccacccgcccgtctgga(SEQ ID NO:95)

Monkey MG53 S255L reverse primers：tccagacgggcgggtgggggtaactctgccaggatct(SEQ ID NO:96)

(iv) monkey MG53 S255W forward and reverse primer, monkey MG53 S255W represent the wild type MG53 of monkey (that is, SEQ ID NO:4) the 255th mutant serine is the MG53 mutant of tryptophan.

Monkey MG53 S255W forward primers：agatcctggcagagtggcccccacccgcccgtctgga(SEQ ID NO:97)

Monkey MG53 S255W reverse primers：tccagacgggcgggtgggggccactctgccaggatct(SEQ ID NO:98)

(v) monkey MG53 S255Q forward and reverse primer, monkey MG53 S255Q represent the wild type MG53 of monkey (that is, SEQ ID NO:4) the 255th mutant serine is the MG53 mutant of glutamine.

Monkey MG53 S255Q forward primers：aagatcctggcagagcaacccccacccgcccgtctgga(SEQ ID NO:99)

Monkey MG53 S255Q reverse primers：tccagacgggcgggtgggggttgctctgccaggatctt(SEQ ID NO:100)

(vi) monkey MG53 S255Y forward and reverse primer, monkey MG53 S255Y represent the wild type MG53 of monkey (that is, SEQ ID NO:4) the 255th mutant serine is the MG53 mutant of tyrosine.

Monkey MG53 S255Y forward primers：agatcctggcagagtatcccccacccgcccgtctgg(SEQ ID NO:101) monkey MG53 S255Y reverse primers：ccagacgggcgggtgggggatactctgccaggatct(SEQ ID NO: 102)

(vii) monkey MG53 S255D forward and reverse primer, monkey MG53 S255D represent the wild type of monkey MG53 (that is, SEQ ID NO:4) the 255th mutant serine is the MG53 mutant of aspartic acid.

Monkey MG53 S255D forward primers：aagatcctggcagaggatcccccacccgcccgtctgg(SEQ ID NO:103)

Monkey MG53 S255D reverse primers：ccagacgggcgggtgggggatcctctgccaggatctt(SEQ ID NO:104)

(viii) monkey MG53 S255R forward and reverse primer, monkey MG53 S255R represent the wild type of monkey MG53 (that is, SEQ ID NO:4) the 255th mutant serine is arginic MG53 mutant.

Monkey MG53 S255R forward primers：aagatcctggcagagcgtcccccacccgcccgtctgg(SEQ ID NO:105)

Monkey MG53 S255R reverse primers：ccagacgggcgggtgggggacgctctgccaggatctt(SEQ ID NO:106)

5. the preparation of pig MG53 mutant

According to people's MG53 S255A mutant identicals method prepare pig MG53 S255A, S255G, S255L, S255W, S255Q, S255Y, S255D, S255R mutant.In addition to mutant primer difference, other steps are dashed forward with people MG53 S255A The preparation process of variant is identical.The primer of each mutant is as follows：

(i) pig MG53 S255A forward and reverse primer, pig MG53 S255A represent wild type MG53 (that is, the SEQ of pig ID NO:5) the 255th mutant serine is the MG53 mutant of alanine.

Pig MG53 S255A forward primers：aagatcctggcagaggcgcccccacctgcccgcctg(SEQ ID NO: 107)

Pig MG53 S255A reverse primers：caggcgggcaggtgggggcgcctctgccaggatctt(SEQ ID NO: 108)

(ii) pig MG53 S255G forward and reverse primer, pig MG53 S255G represent the wild type MG53 of pig (i.e., SEQ ID NO:5) the 255th mutant serine is the MG53 mutant of glycine.

Pig MG53 S255G forward primers：aagatcctggcagaggggcccccacctgcccgcctgg(SEQ ID NO: 109)

Pig MG53 S255G reverse primers：ccaggcgggcaggtgggggcccctctgccaggatctt(SEQ ID NO: 110)

(iii) pig MG53 S255L forward and reverse primer, pig MG53 S255L represent the wild type MG53 of pig (i.e., SEQ ID NO:5) the 255th mutant serine is the MG53 mutant of leucine.

Pig MG53 S255L forward primers：agatcctggcagagttgcccccacctgcccgcctgg(SEQ ID NO: 111)

Pig MG53 S255L reverse primers：ccaggcgggcaggtgggggcaactctgccaggatct(SEQ ID NO: 112)

(iv) pig MG53 S255W forward and reverse primer, pig MG53 S255W represent the wild type MG53 of pig (i.e., SEQ ID NO:5) the 255th mutant serine is the MG53 mutant of tryptophan.

Pig MG53 S255W forward primers：agatcctggcagagtggcccccacctgcccgcctgg(SEQ ID NO: 113)

Pig MG53 S255W reverse primers：ccaggcgggcaggtgggggccactctgccaggatct(SEQ ID NO: 114)

(v) pig MG53 S255Q forward and reverse primer, pig MG53 S255Q represent wild type MG53 (that is, the SEQ of pig ID NO:5) the 255th mutant serine is the MG53 mutant of glutamine.

Pig MG53 S255Q forward primers：aagatcctggcagagcagcccccacctgcccgcctgg(SEQ ID NO: 115)

Pig MG53 S255Q reverse primers：ccaggcgggcaggtgggggctgctctgccaggatctt(SEQ ID NO: 116)

(vi) pig MG53 S255Y forward and reverse primer, pig MG53 S255Y represent the wild type MG53 of pig (i.e., SEQ ID NO:5) the 255th mutant serine is the MG53 mutant of tyrosine.

Pig MG53 S255Y forward primers：agatcctggcagagtatcccccacctgcccgcctgga(SEQ ID NO: 117)

Pig MG53 S255Y reverse primers：tccaggcgggcaggtgggggatactctgccaggatct(SEQ ID NO: 118)

(vii) pig MG53 S255D forward and reverse primer, pig MG53 S255D represent the wild type MG53 of pig (i.e., SEQ ID NO:5) the 255th mutant serine is the MG53 mutant of aspartic acid.

Pig MG53 S255D forward primers：aagatcctggcagaggatcccccacctgcccgcctgga(SEQ ID NO:119)

Pig MG53 S255D reverse primers：tccaggcgggcaggtgggggatcctctgccaggatctt(SEQ ID NO:120)

(viii) pig MG53 S255R forward and reverse primer, pig MG53 S255R represent the wild type MG53 of pig (i.e., SEQ ID NO:5) the 255th mutant serine is arginic MG53 mutant.

Pig MG53 S255R forward primers：aagatcctggcagagcggcccccacctgcccgcctgg(SEQ ID NO: 121)

Pig MG53 S255R reverse primers：ccaggcgggcaggtgggggccgctctgccaggatctt(SEQ ID NO: 122)

6. the preparation of dog MG53 mutant

According to people's MG53 S255A mutant identicals method prepare dog MG53 S255A, S255G, S255L, S255W, S255Q, S255Y, S255D, S255R mutant.In addition to mutant primer difference, other steps are dashed forward with people MG53 S255A The preparation process of variant is identical.The primer of each mutant is as follows：

(i) dog MG53 S255A forward and reverse primer, dog MG53 S255A represent wild type MG53 (that is, the SEQ of dog ID NO:6) the 255th mutant serine is the MG53 mutant of alanine.

Dog MG53 S255A forward primers：aagatcctggcagaagcaccaccgcctgcccgtttg(SEQ ID NO: 123)

Dog MG53 S255A reverse primers：caaacgggcaggcggtggtgcttctgccaggatctt(SEQ ID NO: 124)

(ii) dog MG53 S255G forward and reverse primer, dog MG53 S255G represent the wild type MG53 of dog (i.e., SEQ ID NO:6) the 255th mutant serine is the MG53 mutant of glycine.

Dog MG53 S255G forward primers：aagatcctggcagaaggaccaccgcctgcccgtttgg(SEQ ID NO: 125)

Dog MG53 S255G reverse primers：ccaaacgggcaggcggtggtccttctgccaggatctt(SEQ ID NO: 126)

(iii) dog MG53 S255L forward and reverse primer, dog MG53 S255L represent the wild type MG53 of dog (i.e., SEQ ID NO:6) the 255th mutant serine is the MG53 mutant of leucine.

Dog MG53 S255L forward primers：agatcctggcagaattaccaccgcctgcccgtttgg(SEQ ID NO: 127)

Dog MG53 S255L reverse primers：ccaaacgggcaggcggtggtaattctgccaggatct(SEQ ID NO: 128)

(iv) dog MG53 S255W forward and reverse primer, dog MG53 S255W represent the wild type MG53 of dog (i.e., SEQ ID NO:6) the 255th mutant serine is the MG53 mutant of tryptophan.

Dog MG53 S255W forward primers：agatcctggcagaatggccaccgcctgcccgtttgga(SEQ ID NO: 129)

Dog MG53 S255W reverse primers：tccaaacgggcaggcggtggccattctgccaggatct(SEQ ID NO: 130)

(v) dog MG53 S255Q forward and reverse primer, dog MG53 S255Q represent wild type MG53 (that is, the SEQ of dog ID NO:6) the 255th mutant serine is the MG53 mutant of glutamine.

Dog MG53 S255Q forward primers：aagatcctggcagaacaaccaccgcctgcccgtttgg(SEQ ID NO: 131)

Dog MG53 S255Q reverse primers：ccaaacgggcaggcggtggttgttctgccaggatctt(SEQ ID NO: 132)

(vi) dog MG53 S255Y forward and reverse primer, dog MG53 S255Y represent the wild type MG53 of dog (i.e., SEQ ID NO:6) the 255th mutant serine is the MG53 mutant of tyrosine.

Dog MG53 S255Y forward primers：agatcctggcagaatatccaccgcctgcccgtttgga(SEQ ID NO: 133)

Dog MG53 S255Y reverse primers：tccaaacgggcaggcggtggatattctgccaggatct(SEQ ID NO: 134)

(vii) dog MG53 S255D forward and reverse primer, dog MG53 S255D represent the wild type MG53 of dog (i.e., SEQ ID NO:6) the 255th mutant serine is the MG53 mutant of aspartic acid.

Dog MG53 S255D forward primers：aagatcctggcagaagatccaccgcctgcccgtttgga(SEQ ID NO:135)

Dog MG53 S255D reverse primers：tccaaacgggcaggcggtggatcttctgccaggatctt(SEQ ID NO:136)

(viii) dog MG53 S255R forward and reverse primer, dog MG53 S255R represent the wild type MG53 of dog (i.e., SEQ ID NO:6) the 255th mutant serine is arginic MG53 mutant.

Dog MG53 S255R forward primers：aagatcctggcagaacgaccaccgcctgcccgtttgg(SEQ ID NO: 137)

Dog MG53 S255R reverse primers：ccaaacgggcaggcggtggtcgttctgccaggatctt(SEQ ID NO: 138)

Each site serine missings of other species MG53 can be prepared according to people's MG53 S255A mutant identical methods And/or the mutant of mutation.In addition to mutant primer difference, other steps walk with the preparation of people's MG53 S255A mutant It is rapid identical.Those skilled in the art can use the primer of each mutant of this area conventional technical means design.

Embodiment 2：Cell repair function and Cardioprotective of the mouse MG53 S255A mutant to mouse wild-type MG53 The influence of function

In order to verify mouse MG53 S255A mutant (its amino acid sequence such as SEQ ID NO:Shown in 8) it is wild to mouse The influence of type MG53 cell repair function and Cardioprotective function, neonatal rat myocardial cell of the inventor in the original cuiture of rat (NRVM) mouse wild-type MG53 and mouse MG53 S255A mutant are overexpressed using adenovirus in, detects the survival shape of cell Condition.As a result as shown in figure 14, the hypoxia-reoxygenation of simulated ischemia reperfusion injury causes a large amount of of NRVM lactic dehydrogenase (LDH) Release and intracellular ATP reduction；It is almost equal to be overexpressed mouse wild-type MG53 and mouse MG53 S255A mutation physical efficiency Suppress to degree LDH release and ATP reduction.Mouse wild-type MG53 is to Apoptosis caused by ischemia-reperfusion for this explanation There is protective effect with downright bad equivalent damage, and mouse MG53 S255A mutant has no effect on mouse wild-type MG53 cell Repair function and Cardioprotective function, i.e. the phosphorylation in mouse MG53 S255 sites do not regulate and control MG53 cell repair function and Cardioprotective function.

Mouse MG53 S255A mutation do not influence activation of the MG53 to RISK signal paths

The mechanism of MG53 Cardioprotective function is：It is the important molecule in the RISK signal paths of Cardioprotective, energy Caveolin caveolin-3 and p85-PI3K protein-interacting is mediated, so as to activate RISK signal paths, as downstream is important Signaling molecule AKT (referring to Zhang Y.et al, Cardiovascular research 91,108-115 (2011)).Institute So that further, whether the mechanism that inventor detects mouse MG53 S255A mutation and do not influence MG53 Cardioprotectives is mouse MG53 S255A are mutated physical efficiency and mouse wild-type MG53 equally activates RISK signal paths.Experimental result such as Figure 15 institutes Show, 473 silk ammonia that mouse wild-type MG53 can improve the downstream signaling molecule AKT of RISK signal paths are overexpressed in NRVM The phosphorylation of acid, can activate AKT；And mouse MG53S255A mutation physical efficiency equally improves with mouse wild-type MG53 The phosphorylation of AKT 473 serines, that is, activate AKT.Illustrate that mouse MG53 S255A mutant does not influence mouse wild-type Activation of the MG53 to RISK signal paths, i.e. mouse MG53 S255 phosphorylation does not influence the RISK signals of Cardioprotective Path.

Embodiment 3：The influence of people or mouse MG53 S255A mutant to wild type MG53 E3 ubiquitin ligase activities

Checking for insulin signaling pathway caused by the high expression of MG53 is insulin resistance and metabolic syndrome occurrence and development One of important mechanisms, and one of MG53 critical function.First, inventor constructs mouse wild-type MG53 serine The expression plasmid of mutation-mouse MG53 S255A (its amino acid sequence such as SEQ ID NO：Shown in 8).In addition, inventor goes back structure IRS1 expression plasmid, the expression plasmid of ubiquitin, mouse wild-type MG53 expression plasmid are built.Secondly, before inventor Research shows that MG53 is insulin receptor substrate IRS1 E3 ubiquitin ligases, and the proteasome pathway of its protein can be mediated to drop Solve (Song, R.et al.Nature 494,375-379, (2013)).So inventor is by IRS1 expression plasmid, ubiquitin Expression plasmid and mouse wild-type MG53 or mouse MG53S255A mutant plasmid co-transfection enter in HEK293T cell lines, Influence of the mouse MG53 S255A mutation to MG53 functions is reacted by the change of IRS1 protein contents.Experimental result such as Figure 19 It is shown, the results showed that, mouse wild-type MG53 can largely reduce IRS1 expression quantity；And mouse MG53 S255A dash forward Becoming the protein content for the IRS1 that physical efficiency significantly suppresses MG53 mediations reduces.Illustrate in the coexpression system of HEK293T cell lines, The E3 ubiquitin ligase functions that mouse wild-type MG53 can bring into normal play, mediate IRS1 ubiquitination to degrade；What is detected is small Mouse MG53 S255A mutant inhibits MG53 E3 ubiquitin ligase functions, i.e. the phosphorylation state energy in the S255 sites of MG53 Regulate and control MG53 E3 ubiquitin ligase functions.

People or mouse MG53 S255A mutant suppress the degradation of substrates of MG53 mediations

MG53 is RING domain type E3 ubiquitin ligases, and MG53 RING domains are combined Jie with E2 ubiquitin cross-linking enzymes Lead the ubiquitination of substrate and further proteasome degradation.So the truncate MG53-D-RING of RING domains excision just loses Wild type MG53 E3 ubiquitin ligase functions are lost.Further, in order to quantitatively weigh people's MG53 S255A mutant (its Amino acid sequence such as SEQ ID NO:Shown in 7) or mouse MG53 S255A mutant (its amino acid sequence such as SEQ ID NO:8 It is shown) influence to people or mouse wild-type MG53 E3 ubiquitin ligase functions, inventor is with people or mouse MG53-D-RING For positive control, coexpression human or mouse wild-type MG53, MG53 S255A mutation in human embryonic kidney epithelial cells system HEK293T The substrate IRS1 or insulin receptor IR of body or MG53-D-RING truncates and MG53, detect different mutation and MG53 is mediated Substrate degraded influence.As a result as shown in Figure 16 (mouse) and Figure 17 (people), people or mouse wild-type MG53 can be very big Mediate to degree IRS1 degraded；People or mouse MG53-D-RING truncates can not almost mediate IRS1 degraded completely；It is and small Mouse MG53 S255A mutant can only mediate IRS1 about 40% degraded, and people's MG53 S255A mutant can only mediate IRS1 about 10% degraded.Mouse wild-type MG53 can mediate about 50% IR β degraded；Mouse MG53-D-RING truncates and small Mouse MG53 S255A mutant can not almost mediate IR β degraded completely.In addition, in HEK293T coexpression system, mouse Wild type MG53 can mediate the degraded of the precursor protein of IR β albumen, while mouse MG53-D-RING truncates and mouse MG53 S255A mutant almost completely inhibits the degradation of this MG53 mediations.This description of test, people or mouse MG53-D-RING Truncate pole significantly inhibits MG53 E3 ubiquitin ligase functions；And people or mouse MG53 S255A mutant can about press down MG53 more than 50% processed E3 ubiquitin ligase functions.

Mouse MG53 S255A mutant suppresses the combination of MG53 and substrate IRS1 albumen

In order to detect mouse MG53 S255A mutant (its amino acid sequence such as SEQ ID NO:Shown in 8) whether influence MG53 and substrate IRS1 albumen identification and combination, inventor is on the one hand by immune common in vitro HEK293T cell lines The binding ability of substrate IRS1 and mouse wild-type MG53 or mouse MG53 S255A mutant under precipitation detection activated state；Separately On the one hand the albumen of detection purifying is tested by surface plasma body resonant vibration (surface plasmon resonance, SPR) IRS1 and mouse wild-type MG53 or mouse MG53 S255A mutant directly in conjunction with ability.Experimental result is as shown in figure 18, Figure 18 A show that IRS1 can carry out physical combination with mouse wild-type MG53；And the IRS1 of same amount can only combine very small amount Mouse MG53 S255A mutant；Figure 18 B show that mouse wild-type MG53 albumen can be combined well with IRS1 albumen, KD =64.2nM；And mouse MG53 S255A mutant proteins can not be with IRS1 protein bindings.As can be seen here, mouse MG53 S255A Mutant inhibits identifications and combination of the MG53 to substrate IRS1 albumen, so as to inhibit MG53 E3 ubiquitin ligase activities.

Embodiment 4：It is active inside people's MG53 S255A mutant

For identifier MG53 S255A mutant (its amino acid sequence such as SEQ ID NO:Shown in 7) in vivo whether still So there is cell repair function and Cardioprotective function, while avoid or reducing metabolism class caused by wild type MG53 Side effect, inventor are further divided by the way that people's MG53 S255A mutant and people's wild type MG53 are introduced in rat body respectively Analyse activity inside people's MG53 S255A mutant.First, inventor prepares people's MG53 S255A mutant according to embodiment 1. Secondly, 15 male Sprague-Dawley (SD) rats are selected (every about 250g, it is limited to tie up tonneau China experimental animal by Beijing Company provides), it is divided into three groups, experimental group, positive controls, negative control group, every group of difference 5.30mg/kg yellow Jackets After intraperitoneal injection of anesthesia rat, in left side the 3rd, intercostal opens chest, exposes heart.Then, to experimental group rat heart vein Inject people's MG53 S255A mutant proteins (6mg/kg, iv), heliotropism control rats cardiac veins injection people's wild type MG53 albumen (its amino acid sequence such as SEQ ID NO:Shown in 1) (6mg/kg, iv), noted to negative control group rat heart vein Penetrate bovine serum albumin(BSA) (BSA) (6mg/kg, iv).Each group rat ligatures heart after above-mentioned albumen is injected intravenously 5 minutes respectively Coronary artery left anterior descending branch, and continue 45 minutes.Before terminating, each group rat is injected intravenously corresponding people MG53 again S255A mutant proteins, people's wild type MG53 albumen and BSA (6mg/kg, iv), then unclamp coronary artery.Reperfu- sion 24 After hour, dead rat is not defined as surviving in 24 hours, and death is defined as death, with this results contrast experimental group, sun Property control group and the survival rate of negative control group rat.Using insulin stimulating each group rat, rat, comparative experiments are then put to death Group, the myocardial infarction area of positive controls and negative control group rat, Serum LDH concentration and heart pathological section TUNEL Staining conditions, carry out each group rat heart Damage Evaluation.It is negative right to be less than to the myocardial infarction area conspicuousness of experimental group rat Conspicuousness it can suppress LDH compared with negative control group rat according to the myocardial infarction area of group rat, or experimental group rat Release, or the heart pathological section TUNEL coloration result conspicuousnesses of experimental group rat be better than negative control group rat the heart Dirty pathological section TUNEL coloration results, then show that people's MG53 S255A mutant has no effect on people's wild type MG53 cell and repaiied Multiple function and Cardioprotective function, it can be used in treating heart disease, such as miocardial infarction, heart ischemia/reperfusion injury etc.. Last comparative experiments group, positive controls and negative control group rat respectively organize (for example, cardiac muscle, skeletal muscle, liver) inner p- AKT/t-AKT situation of change, so that the insulin that evaluation experimental group, positive controls and negative control group rat are respectively organized is anti- Ying Xing.P-AKT/t-AKT ratios decline in the tissue of positive controls rat, show that people's wild type MG53 albumen causes insulin Sensitiveness declines；P-AKT/t-AKT ratios are normal in the tissue of negative control group rat, show BSA to insulin sensitivity without Influence；P-AKT/t-AKT odds ratios positive controls are high in the tissue of experimental group rat, show that people's MG53 S255A mutant can Declined with eliminating or weakening insulin sensitivity caused by people's wild type MG53 albumen.

In summary, (particularly the 255th silk of at least one serine in MG53coiled-coil-SPRY domains Propylhomoserin) missing or when sporting the amino acid of any other non-serine or threonine (for example, alanine), caused MG53 dashes forward Variant with cell repair function and/or while Cardioprotective function, is avoid or reducing the metabolism such as insulin resistance again Class side effect.

Although the present invention is specifically showed and described to invention by way of quoting specific embodiment, ability Field technique personnel all it should be understood that in the case where not departing from the purport of present disclosure and protection domain, may be used also by the above To carry out the change on various forms and details.

Claims

A kind of 1. MG53 mutant, it is characterised in that the basis of amino acid sequence of the MG53 mutant in wild type MG53 On, there is at least one serine missing in the coiled-coil-SPRY regions of the wild type MG53 and/or sport The amino acid of any other non-serine or threonine.
2. MG53 mutant according to claim 1, wherein the coiled-coil-SPRY regions are located at wild type The 122-477 amino acids region of MG53 amino acid sequence.
3. MG53 mutant according to claim 1 or 2, it is characterised in that the amino acid sequence of the wild type MG53 For SEQ ID NO:1、SEQ ID NO:2、SEQ ID NO:3、SEQ ID NO:4、SEQ ID NO:5 or SEQ ID NO:6 Shown amino acid sequence.
4. the MG53 mutant according to any one of claim 1-3, it is characterised in that the mutant serine is non-pole Acidic amino acid, the nonpolar amino acid are selected from the group：Glycine, alanine, leucine, isoleucine, valine, dried meat ammonia Acid, phenylalanine, methionine, tryptophan.
5. the MG53 mutant according to any one of claim 1-3, it is characterised in that the mutant serine is except silk Polar amino acid outside propylhomoserin and threonine, the polar amino acid are selected from the group：Glutamine, cysteine, asparagus fern acyl Amine, tyrosine, aspartic acid, glutamic acid, lysine, arginine, histidine.
6. the MG53 mutant according to any one of claim 1-5, it is characterised in that the silk ammonia of missing or mutation occurs Acid is positioned at following one or more sites of the amino acid sequence of the wild type MG53：189th, the 211st, the 214th, 246th, the 255th, the 269th, the 296th, the 301st, the 305th, the 307th, the 341st, the 377th, the 418th Position, the 430th.
7. the MG53 mutant according to any one of claim 1-6, it is characterised in that the silk ammonia of missing or mutation occurs Acid is located at the 255th of the amino acid sequence of the wild type MG53.
8. the MG53 mutant according to any one of claim 1-7, it is characterised in that the amino of the MG53 mutant Acid sequence is SEQ ID NO:Any amino acid sequence shown in 7-12.
9. a kind of pharmaceutical composition, it is characterised in that including the MG53 mutant and pharmacy any one of claim 1-8 Upper acceptable carrier.
10. a kind of nucleic acid of separation, it includes the amino acid sequence of the MG53 mutant any one of coding claim 1-8 The nucleotide sequence of row.
11. the preparation method of the MG53 mutant any one of a kind of claim 1-8, it is characterised in that it is determined that needing The one or more positions for the serine being mutated, to the matter of the nucleotide sequence comprising encoding wild type MG53 amino acid sequences The full length sequence of grain carries out the rite-directed mutagenesis in the position, by the plasmid transfection of the rite-directed mutagenesis to host cell, expression The host cell is to produce the MG53 mutant.
12. the MG53 mutant according to any one of claim 1-8 is being prepared for treating heart disease, kidney disease Purposes in the medicine of disease and cell and/or tissue damage relevant disease.
13. purposes according to claim 12, it is characterised in that the medicine treatment heart disease, kidney trouble, with Metabolism class side effect is avoided while cell and/or tissue damage relevant disease.