CN1078613C - Spinacia and betaine aldehyde dehydrogenase gene and method for raising resistance to salt of plant - Google Patents

Abstract

The present invention discloses a new garden orache betaine aldehyde dehydrogenase gene and a DNA sequence thereof. The present invention provides a vector for converting the gene into a host plant and expressing the gene in the host plant, and the present invention also provides a plant with the transferred betaine aldehyde dehydrogenase gene and a method for causing the plant to have high salt endurance.

Description

Prunella asiatica betaine aldehyde dehydrogenase gene and the method that improves plant salt endurance

The present invention relates to plant genetic engineering field, relate in particular to and change foreign gene over to plant, make salt tolerant of plant and the method that drought tolerance improves.

Environmental factor, arid, low temperature, high salt etc. have limited growth and the crop yield of plant, are response abiotic stress, often accumulate some small molecules organic compound in the cell, and trimethyl-glycine is exactly one of them.The accumulation of trimethyl-glycine under arid or salt alkaline stress such as Chenopodiaceae, annual bluegrass section, aster is more obvious.Trimethyl-glycine also is present in except that being positioned at chloroplast(id) in microsome and the endochylema, known coercing down, and except that participating in osmoregulation, also main enzyme and the terminal oxidation key enzyme to tricarboxylic acid cycle has provide protection.The biosynthesizing of trimethyl-glycine obtains through two-step oxidation in the plant, wherein relates to choline-monooxygenase (cmo) and betaine-aldehyde dehydrogenase (BADH, EC1.2,1.8).The activity of these two enzymes all is subjected to salt and drought-induced.People such as Saneoka prove that the corn that contains glycinebetaine obviously descends than absence type institute damaged under salt stress.

We have cloned BADH cDNA from the very strong chenopod prunella asiatica of salt tolerance, and have obtained to be applicable to the carrier that carries this gene transferred plant cell, and the transgenic plant with salt tolerant and drought tolerance.

One of purpose of the present invention has provided the cDNA sequence of coding prunella asiatica betaine-aldehyde dehydrogenase.

Another object of the present invention has provided the prunella asiatica betaine aldehyde dehydrogenase gene is transformed plant and expresses the method that can improve plant salt endurance and anti-property morning therein.

A further object of the present invention has provided the plant that changes betaine aldehyde dehydrogenase gene, and these transgenic plant have high-salt tolerance and drought tolerance.

One. clone and the sequential analysis and the detection of expression in prokaryotic cell prokaryocyte of coding prunella asiatica BADH structure gene

1. total DNA of plant and cDNA preparation

Getting 4g, to go to arteries and veins leaf texture be the total DNA of material extraction, and cDNA is synthetic to carry out according to Jurgen 1987 methods.

2. prunella asiatica BADH structure gene is cloned and sequence characteristic

One of round pcr key is a design of primers, at first knows the distribution situation of intron among the BADH from other aldehyde dehydrogenase structure gene of plant by inference, has designed primer according to the spinach cDNA sequence data of having delivered again.Two primers are respectively applied for the structure gene of amplification BADH.

3.PCR amplification

(1) design of primers, two primers of our synthetic are respectively:

Primer 1,5 ' AGAATGGCGTTCCCAATTCCTGCTC3 ';

Primer 2,5 ' TTCAAGGAGACTTGTACCATCCCCA3 '.

(2) amplified reaction, amplified reaction cumulative volume are that 50 μ L contain 10mmol/L Tris-HCl pH8.350mmol/LKCL, 1.5mmol/L MgCl ₂Every kind of dNTP of 200 μ mol/L, every kind of primer of 25pmol, the total dna profiling of 1 μ g or 200～500ng strand cDNA, and 1.25U Taq polysaccharase, amplification condition is 95 ℃ of pre-sex change, enter 93.5 ℃ after 10 minutes, 1 minute, 55 ℃, 1 minute, 72 ℃, 1.5 minutes 30 circle working cyclees are afterwards again in 72 ℃ of insulations 10 minutes, amplified production is through 1% agarose gel electrophoresis analysis, behind the electrophoresis required band is cut out, reclaim with Gene Clean Kit, the DNA after the recovery inserts plasmid pUC19, Transformed E .coli JM83, all clones' PCR product are all through pcr amplification checking once more.

4. sequential analysis

All sequential analyses are template with double-stranded plasmid all, finish through the full sequence measurement of two strands with Sanger (1977).

With prunella asiatica cDNA is template, utilization primer 1 and 2 carries out the single band (Fig. 1) that pcr amplification obtains about 1.5kb, sequential analysis shows that this fragment is the cDNA full-length gene of BADH, its length is 1509bp, 503 amino acid whose open reading frame (Fig. 2 of one coding are arranged, be positioned at 773～811 codons the Cys (Fig. 3) of corresponding decapeptide Val-Thr-Leu-Geu-Gly-Gly-Lys-Ser-Pro and 868～870 codings relevant with the enzyme function be the sequence of aldehyde dehydrogenase high conservative, homology analysis shows, the homology of prunella asiatica BADH gene and the spinach BADH cDNA 87.5% that delivered, with beet BADH cDNA88.1% homology (Dnasis Computer Program, Hitachi) (Fig. 3), the homology of the aminoacid sequence of being inferred by their Nucleotide is respectively 90.1% and 87.8%.

5.BADH the structure of expression of structural gene plasmid

Used coli expression carrier is pKK233-3.

6. clone and the expression of prunella asiatica BADH gene in intestinal bacteria

Prunella asiatica BADH encoding gene is inserted among the colibacillus expression plasmid KK223-3, Transformed E .coli JM83, obtain a collection of transformant, choose 26 mono-clonals, extract plasmid DNA, with it is that template is carried out pcr amplification with primer 1 and 3, choose and obtain single 1.5kb amplified band plasmid DNA, be that probe carries out the Southern hybridization analysis with BADH1.5kb structure gene again, obtain 12 positive colonies, 11 of picked at random are contrast with the E.coli JM83 that contains the KK223-3 plasmid, measure the BADH isozymes activity, the transformed bacteria that contains BADH structure gene, vigor is a 8.04U/mg albumen, and the control enzyme activity is very low, only be 0.6U/mg albumen, change the comparison of BADH gene bacterium according to active high 13 times.

Two. prunella asiatica BADH structure gene is expressed in eukaryotic cell

Plasmid DNA is extracted and purifying is undertaken by the Sambrook method 1.DNA extract, and the plant total DNA extraction is undertaken by preceding method.

2. the structure of plant expression vector and Plant Transformation

The structure of BADH cDNA plant expression vector carries out (Fig. 5) according to a conventional method, binary expression vector pBin438 (Fig. 4) contains " Ω " fragment of dual 35S promoter and translational enhancer TMV, with BamHI and KpnI BADH cDNA fragment is cut out the back from cloned plasmids and insert among the pBin438, resulting expression plasmid is again through particle bombardment AGL1.

Utilization 35S promoter, Acfui promotor import plant through particle bombardment.

3. the conversion of plant, regeneration and screening.

Transforming with the host is dicotyledonous or monocotyledons such as strawberry (Fragaria chiloensis), tobacco (Nicotiana tabacum) paddy rice, corn, clover and turfgrass etc.Be example with strawberry and tobacco down.

The aseptic tobacco leaf of aseptic strawberry meristematic tissue piece and about 5mm size is immersed respectively in the AGL1 agrobacterium liquid of 5 times of dilutions, take out after about 30 minutes and be placed on the aseptic filter paper, bacterium liquid is removed in suction.Strawberry is seeded in MS1 substratum (MS minimum medium+10mg/L 6-BA+0.5mg/L 2,4-D), tobacco is seeded in to cultivate altogether in the MS2 substratum (MS minimum medium+1mg/L6-BA+0.1mg/L IAA) and changes screening culture medium (strawberry: MS1+20mg/L kantlex+600mg/L cephamycin after 3 days over to; Tobacco: MS2+100mg/L kantlex+600mg/L cephamycin).Contrast other each step except that infecting without Agrobacterium is identical.Anti-kantlex plant carried out Agrobacterium inspection bacterium to regrowth and salt tolerance is identified after repeating to screen 4～5 times on the identical screening culture medium in average 25 days.

4. the screening of transfer-gen plant

Strawberry meristematic tissue piece after cultivating is altogether adding 6BA 10mg/L, 2, on the MS substratum of 4-D 0.5mg/L, kantlex 20mg/L, 600mg/L cephamycin, cultivate the budlet that regenerates after 20 days, these budlets 10 days rear sections in the MS substratum (MS0) of the no hormone of additional 30mg/L kantlex form plantlet, after in containing 50mg/L kantlex MS substratum, screening for 3 generations, obtain 17 those resistant plants of strain card altogether, the tobacco leaf of cotransformation is at additional 0.1mg/LLAA, regeneration plantlet after 30 days in the 1mg/L6-BAr MS substratum.On 100mg/L kantlex concentration altogether 12 strain tobacco resistant plants.

5.BADH activation analysis

After the 2g plant tissue grinds in liquid nitrogen, add protein extract (50mmol/LHepes/KOH pH8.0,1mmol/L EDTA, 5mmol/L DTT) extracting under the room temperature, centrifugal 10 minutes of 4 ℃ of following 1400rpm, protein concentration is with ultraviolet spectrophotometer 280nm colorimetric estimation.

The enzyme assay reaction system is: 50mmol/L Hepes/KOH (pH8.0), 5mmol/L DTT, 1mmol/L EDTA, the 1mmol/L betaine aldehyde chloride, 1mmol/L NAD and zyme extract 1.0mg albumen, cumulative volume 1.0ml, 37 ℃ were reacted ultraviolet spectrophotometer 340nm colorimetric estimation 10 minutes.The NAD of per minute consumption 1nmol is defined as 1 enzyme activity unit under the above-mentioned reaction system.

6. the BADH determination of activity of transfer-gen plant

Transgene tobacco and each 5 strain of strawberry carry out the BADH determination of activity to select salt tolerance to show in detecting preferably, and its activity unit produced 1nmNADH and is defined as 1 enzyme activity unit under the reaction system that provides in per 10 minutes.Measurement result is shown in table 1.By table 1 as seen, contrast fails to measure the BADH activity, all can measure the BADH activity in the transgenosis strain, but bigger individual difference is arranged.

Table 1 transgenosis strawberry, tobacco BADH determination of activity

The transfer-gen plant kind	Strain number	?1	?2	?3	?4	?5	Contrast CK
								Tobacco	Tobacoo	?0.30	?0.45	?4.00	?4.55	?5.1	?0
Strawberry	Strawberry	?0.45	?2.65	?10.01	?5.0	?4.3	?0

7. the salt tolerance of kalamycin resistance plant is identified

Transformed plant all shows certain salt tolerance, and wherein strawberry is all dead to impinging upon in the 0.4% NaCl substratum after 20 days, and 12 strain transgenosis strawberries growth normal (Fig. 6-1) substantially.Wherein 7 strains in 0.7% NaCl substratum, still can slowly grow (Fig. 6-2).Transgene tobacco has notable difference with contrast on 1% NaCl level; On the 2%NaCl level, transfer-gen plant can be taken root in the MS0 substratum, and adjoining tree can not (Fig. 6-3,4).

8. the Molecular Detection of transfer-gen plant, the PCR of transfer-gen plant detects, Southerm hybridization, Northem hybridization are all carried out according to a conventional method.

A. the PCR of transfer-gen plant detects, the PCR that transfer-gen plant is carried out with prunella asiatica BADH cDNA amplimer detects explanation, anti-kantlex strawberry of 17 strains and the anti-kantlex tobacco of 12 strains all have an appointment 1.0kb amplified band and adjoining tree does not have (Fig. 6-5).

B. transfer-gen plant Northern hybridization analysis carries out the Northern hybridization analysis to detecting active transgene tobacco of BADH and strawberry, and wherein tobacco and strawberry respectively have 2 strain enzymes higher plant alive to detect transcription (Fig. 6-6).

9. the mensuration of plant leaf relative conductivity, take by weighing the fresh blade of 0.5g, add the 5ml ultrapure water, be divided into two equal portions, a in 25 ℃, the 40rpm 4h that vibrate, another part heated 5 minutes in boiling water bath, measure electrical conductivity of solution with DDB-6200 type digital conductivity meter respectively, the former is Rc ', and the latter is Rc, and relative conductivity is Rc/Rc ' * 100%.

10. the mensuration of plant macromole leakage values is revised slightly according to the Leopeld method and to be carried out, and drills through 5 disks (0.5cm) with the punch tool fresh leaves of making a fresh start, and adds ultrapure water 2ml, ultraviolet colorimetric estimation OD behind the 40rpm vibration 4h under the room temperature ₂₅₄Absorb, what obtain is total leakage values.

11. the mensuration of transfer-gen plant relative conductivity and macromole leakage values is got above-mentioned transgenosis strawberry, relative conductivity and macromole leakage value mensuration (table 2) under the salt stress are carried out in each 5 strain of tobacco.The specific conductivity of transfer-gen plant and macromole leakage values are lower than contrast, show that transfer-gen plant is subjected to the salt damage degree to be lower than contrast.

Relative conductivity of table 2 transgenosis strawberry, tobacco and macromole leakage values

Plant number		Contrast CK	?1	?2	?3	?4	?5
								Strawberry	The macromole leakage values	0.31	?0.41	?0.29	?0.21	?0.23	?0.19
Relative electric conductivity	0.43	?0.39	?0.47	?0.12	?0.17	?0.29
							Tobacco		The macromole leakage values	0.29	?0.37	?0.28	?0.22	?0.17	?0.24
Relative electric conductivity	0.42	?0.51	?0.37	?0.15	?0.21	?0.23

Description of drawings:

Fig. 1 is to be the agarose electrophoretic analysis figure of template through primer 1,2 pcr amplification product with prunella asiatica cDNA.

Fig. 2 is a BADH cDNA sequence chart.

Fig. 3 is that BADH and other aldehyde dehydrogenase all contain 10 conserved amino acid sequences and deamination acid residue figure on similar position.

Fig. 4 is the structure iron of pBin438.

Fig. 5 is the binary vector design of graphics.

Fig. 6 is the salt tolerance figure of transgenosis and adjoining tree.

Embodiment 1

The extraction of prunella asiatica RNA and CDNA are synthetic

With reference to molecular cloning one book, extracting RNA tissue (prunella asiatica 3 grams) is milled in liquid nitrogen, up to the powder shape; Add 2ml and extract damping fluid (4M guanidini thiocyanate, 25mM sodiumcitrate 0.5% sarcosyl, 100 μ LB-mercaptoethanoL) vibration mixes, add 1.5ml3MNaAc (pH5.2) and 8ml acid phenol, at least be incubated 20 minutes in the ice bath, leave the heart 20 minutes for 4 ℃ 6000, supernatant liquor is transferred in the new 10ml pipe, discard precipitation, add equal-volume 4MLiCL, quiescent setting RNA, 6500 left the heart 20 minutes, abandon supernatant, precipitation is deposited in the aseptic DEP water of 300 μ l.DEP water is a kind of biological chemical reagent that suppresses nuclease, and commercial DEP is that not diluted is crossed, and needs during use could use after 1: the 1000 part of water dilution, and therefore the DEP after the dilution claims DEP water.DEP can read up the literature in " American Academy of Sciences's newspaper " rolled up 93 pages in 1970 67, be that people such as NJ. deliver, the English full name of DEP is DIETMYLPYROCARBONAFE, chemical molecular formula is COH1005, molecular weight 162.1, numbering D5758 (Sigma products catalogue) can the side agency can have been bought as the magnificent company in Pekinese, Orient Company etc. from the trust of U.S. Sigma company.The first chain cDNA is synthesized in reverse transcription, 1 μ l0.5 μ g/ μ loligo (dT) primer, 20 μ l (4.7 μ g) totol RNA, 7.5 μ l H ₂65 ℃ of O 5 minutes are put ice bath then, add ultimate density 5mM Mgcl ₂, 2 μ l10 * reverse transcription damping fluid, the reversed transcriptive enzyme of 1.5 units, the rRNasin of 2.5 units (promega), cumulative volume 20ml, 42 ℃ 1 hour, 95 ℃ 5 minutes.

Embodiment 2

The pcr amplification of prunella asiatica BADH gene;

Get above-mentioned synthetic first chain CDNA 2 μ l, touch plate as pcr amplification.In 50 μ l reaction systems, add TaQ enzyme 0.5 μ l (su/ μ l), 4 kinds of dNTP (every kind of dNTP final concentration is 200 μ mol/L) Mg ²⁺(final concentration is 1.5mMol/L, 10 * reaction buffer, 5 μ l, and each 2 μ l of both-end primer (5 ' end is 5 ' AGAATGGCGTTCCCAATTCCTGCTC3 ', and 3 ' end is 5 ' TTCAAGGAGACTTGTACCATCCCCA3 '), all the other add the distilled water polishing.Reaction conditions is: 94 ℃ of pre-sex change 10 minutes, and 55 ℃ of renaturation 1 minute, 72 ℃ were extended 1 minute, totally 35 circulations, last 72 ℃ are extended 10 minutes with the polishing end.The amplified production electrophoresis in 2% agarose (available from Promega company) gel that takes a morsel is identified.

Embodiment 3

The clone of BADH gene and sequential analysis:

With the BADH gene product of the about 1.5bp of size of pcr amplification with restriction endonuclease BamH1 and KPn1 370 ° of digestion 2 hours, 75 ℃ of reactions 10 minutes are with the inactivation restriction endonuclease then; Be connected to the puc19 carrier of handling through same enzyme, 16 ℃ of connections are spent the night, transformed competence colibacillus intestinal bacteria JM83 then, and the BADH orientation is inserted into BamH1 and the KPnI site of puc19 like this; On LB (1 liter of LB contains 10g albumin glue, 10g sodium-chlor, 5g yeast extract powder, the PH7.0) flat board that contains each 800 μ g of 100 μ g/ μ l ampicillins and X-g al and IPTG, go out positive colony through pearl opal spot screening system.Sequential analysis shows, clone's CDNA segment.Its length is 1.509bp, and it is the sequence of aldehyde dehydrogenase high conservative that the continuous sign indicating number of 503 amino acid whose openings of coding framework is arranged.Homology analysis, prunella asiatica BADH gene has 87.5% homology with the BADHCDNA of the spinach of having delivered, and 3 ' end fragment specificity analysis shows that with spinach and the total DNA of prunella asiatica be template, and the code sequence of 2 different sources BADH genes is shown high homology.And their subarea that includes exists very big-difference, and the intron of prunella asiatica is 106bp, and spinach is 479bp, no obvious homology between them.

Embodiment 4

The structure of the plant expression carrier plasmid of BADH gene:

Inserted the pUC19 carrier of the about 1.5Kp BADH gene of size with restriction enzyme BamH1 and the digestion of KpnI double digestion, be connected on the plant expression vector PBin438 of same enzyme processing, 16 ℃ of connections are spent the night, the transformed competence colibacillus bacillus coli DH 52 then, and BADH gene orientation is inserted into PB4 38 plasmid BamH1 and Kpn1 site like this.Its 5 ' end has the caMV35s promotor that efficiently expresses in the plant, and 3 ' end has the no terminator that strengthens expression, efficiently expresses in plant to guarantee the BADH gene.Kalamycin resistance gene on the PBin438 is as the selection markers of transformed plant; Use BamH1 then, the KPnI double digestion is identified the insertion of BADH gene, and compare with the PB438 carrier that does not insert BADH, the carrier that makes up has cut out the BADH gene of 1.509Kb, illustrate that BADH correctly has been inserted into plasmid BADH and the KPnI site of PB438, the plant expression vector of BADH gene successfully constructs like this, can use transformation technologies such as Agrobacterium, particle gun, laser, polyoxyethylene glycol to import in the plant.

Description of drawings:

Fig. 1: with prunella asiatica cDNA be template through primer 1,2PCR amplified production and agarose electrophoretic analysis, 1 is standard molecular weight, 2 is prunella asiatica cDNA pcr amplification product.

Fig. 5: binary vector design of graphics.

Among Fig. 5: NPTII: kalamycin resistance gene

RB: the sequence right side

LB: a sequence left side

35S: cauliflower mosaic virus 35S promoter

Nos: terminator

Apr: ampicillin resistance gene

Ω: enhanser gene

32S: prunella asiatica promotor

Among Fig. 6: 1. transgenosis strawberry and to impinging upon the growing state on the 0.4%NaCl substratum, a left side 1 and right 1 is contrast, the centre is a transfer-gen plant; 2. transgenosis strawberry and contrast and the growing state on the 0.7%NaCl substratum thereof; 3. transgene tobacco reaches impinging upon the growing state on the 2.0%NaCl substratum, and the left side is a transfer-gen plant, and the right is contrast; 4. transgene tobacco reaches impinging upon the situation of taking root on the 2.0%NaCl substratum, and the right side is linked as transfer-gen plant, and a left side is linked as contrast; 5. transgenosis strawberry, tobacco PCP detect: 1-4 is a tobacco, and 1 is contrast, and 5-10 is a strawberry, and 5 are contrast; 6. transgenosis strawberry, tobacco Northern detect: 1-4 is a strawberry, and 1 is contrast, and 5-7 is a tobacco, and 5 are contrast.

Claims (5)

1. the prunella asiatica betaine aldehyde dehydrogenase gene that has DNA base sequence shown in Figure 2.

2. improve the method for plant salt endurance, it is characterized in that: to vegetable cell, plant transformed cell regeneration becomes plantlet with the described gene transformation of claim 1.

3. method according to claim 2, wherein plant is dicotyledonous and monocotyledons.

4. method according to claim 2, wherein conversion process is by agriculture bacillus mediated or particle bombardment.

5. method according to claim 2, wherein said gene are carried by plant expression vector and are transformed plant tissue or cell.

Images