CN107858414B - High-throughput sequencing joint, preparation method thereof and application thereof in ultralow frequency mutation detection - Google Patents
High-throughput sequencing joint, preparation method thereof and application thereof in ultralow frequency mutation detection Download PDFInfo
- Publication number
- CN107858414B CN107858414B CN201710983188.XA CN201710983188A CN107858414B CN 107858414 B CN107858414 B CN 107858414B CN 201710983188 A CN201710983188 A CN 201710983188A CN 107858414 B CN107858414 B CN 107858414B
- Authority
- CN
- China
- Prior art keywords
- sequencing
- sequence
- strand
- library
- chain
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6806—Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6869—Methods for sequencing
-
- C—CHEMISTRY; METALLURGY
- C40—COMBINATORIAL TECHNOLOGY
- C40B—COMBINATORIAL CHEMISTRY; LIBRARIES, e.g. CHEMICAL LIBRARIES
- C40B50/00—Methods of creating libraries, e.g. combinatorial synthesis
- C40B50/06—Biochemical methods, e.g. using enzymes or whole viable microorganisms
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Engineering & Computer Science (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Immunology (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Medicinal Chemistry (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a high-throughput sequencing joint, a preparation method thereof and application thereof in ultralow frequency mutation detection. The high-throughput sequencing joint is a Y-shaped joint and comprises a first chain and a second chain partially complementary to the first chain, wherein the first chain comprises a library amplification primer sequence A, a sequencing primer sequence, a single-chain source distinguishing sequence and GT bases, and the second chain comprises C bases, a single-chain source distinguishing sequence complementary to the first chain, a sequencing primer sequence partially complementary to the first chain, a template source distinguishing sequence, a sample distinguishing sequence and a library amplification primer sequence B. According to the invention, a template source sequence and a single-chain source distinguishing sequence are additionally arranged, and errors introduced in the process of library amplification and sequencing can be eliminated according to the position where mutation occurs, so that the precision of mutation detection is improved; the sequencing linker provided by the invention is used for constructing an experimental flow of a sequencing library without change, is simple and convenient to operate, and does not need to carry out optimization conditions.
Description
Technical Field
The invention relates to the technical field of high-throughput sequencing, in particular to a high-throughput sequencing joint, a preparation method thereof and application thereof in ultralow frequency mutation detection.
Background
With the gradual maturity of high-throughput sequencing technology, the application field is wider and widerGenerally, the diagnosis of tumors is screened from prenatal, and with the advance of precise medical treatment, gene sequencing is taken as the front end of the precise medical treatment, and the industry faces explosive growth opportunities, but also faces certain challenges in actual operation. Tumors are highly heterogeneous, in that the causative mutations may be present in very low proportions, e.g., less than 0.1% to 0.01%, or even lower, whereas the error rate of the single base is around 0.2% for the most accurate high throughput sequencing itself at present, plus the well-known intrinsic error rate of DNA polymerases (10%-7～10-5) Therefore, the conventional library construction method cannot achieve 1% or even higher detection accuracy, and the error makes it difficult to detect some low-frequency variations (less than 1%). Although there are many improved methods for sequencing libraries for low frequency mutations, there are many limitations in practical applications.
Currently, detection methods for low-frequency mutation are roughly classified into three types, namely, Personalized Profiling by deep sequencing analysis (hereinafter referred to as "CAPP-seq"), Single-Molecule rolling circle Amplification (circle sequencing), circularization Single-Molecule Amplification and re-sequencing Technology (hereinafter referred to as "cSMART").
The experimental flow of CAPP-seq is not greatly changed, only the information analysis flow is optimized on the premise of deep sequencing, and the detection precision is improved by correcting the overlapping sequence of the original reads of the overlapping part of double-end sequencing to reduce the sequencing error rate, but the method cannot eliminate the errors caused by the experimental method.
The single-molecule rolling circle amplification technology utilizes a single-molecule rolling circle replication mode to amplify template molecules for multiple times to form a long chain which is formed by connecting sequences from the same template, the long chain is broken and then constructed, then amplicons from the same template are sequenced, and amplification products from the same template are analyzed through a later information analysis method to reduce errors caused by sequencing and experiment. However, this method has two limitations: 1) the cyclization efficiency of single-chain molecules is low, and the template loss can be caused for trace samples; 2) longer sequencing reads are required.
The cSMART technology was independently developed by bery and kang (international patent, patent No. US 20140234850a 1). The technology comprises the steps of firstly adding specially-made joints with tag sequences at two ends of all circulating tumor DNA fragments, then cyclizing the circulating tumor DNA fragments added with the joints, designing back-to-back primers near mutation sites to perform reverse PCR amplification, enriching target DNA fragments to obtain linearized PCR amplification products, performing high-throughput sequencing on the amplified products, wherein the sequenced sequences have 3 types: (1) the start-stop site and the tag sequence are the same, are identified as products obtained by PCR amplification of the same free DNA fragment in the original plasma, and are counted only once; (2) identifying sequences with the same start and stop sites but different tag sequences as different free DNA fragments in original plasma, and counting respectively; (3) sequences with different start and stop sites were identified as different free DNA fragments in the original plasma and counted separately. By adopting the counting method, the circulating tumor DNA sequence carrying the gene mutation can be accurately identified, and the sequencing result is reduced back to the number of original circulating tumor DNA fragments in the blood plasma, but the method has the following application limit points: 1) because the target DNA fragment needs to be enriched by inverse PCR amplification, the gene mutation only aims at the known locus; 2) when a plurality of sites are amplified in the same tube, the design of primers is difficult; 3) the experimental procedure is tedious.
Disclosure of Invention
The invention aims to provide a high-throughput sequencing adapter aiming at the defects of the prior art.
Another objective of the invention is to provide a preparation method of the high-throughput sequencing joint.
Another object of the present invention is to provide the use of high throughput sequencing adaptors for ultra-low frequency mutation detection.
In order to achieve the purpose, the technical scheme adopted by the invention is as follows:
a high throughput sequencing adaptor, said adaptor being a wye-type adaptor comprising a first strand comprising a library amplification primer sequence a, a sequencing primer sequence, a single-strand origin discriminating sequence and a GT base, and a second strand partially complementary to said first strand comprising a C base, a single-strand origin discriminating sequence complementary to said first strand, a sequencing primer sequence complementary to said first strand portion, a template origin discriminating sequence, a sample discriminating sequence and a library amplification primer sequence B.
The sequencing joint in the technical scheme comprises a template distinguishing sequence and a single-chain distinguishing sequence, sequencing reads can be classified into the same molecular family according to a template source sequence, the sequences of the same molecular family can be divided into a group of plus-sense chains and a group of minus-sense chains according to the single-chain source distinguishing sequence, errors introduced in PCR amplification and errors introduced in a sequencing process of a target DNA molecule can be eliminated according to the position where mutation occurs, and therefore the precision of mutation detection is improved.
As a preferred embodiment of the high throughput sequencing linker of the present invention, the single-stranded source-distinguishing sequence is a random sequence.
As a preferred embodiment of the high throughput sequencing linker of the present invention, the template-derived discriminating sequence is a random sequence.
As a preferred embodiment of the high-throughput sequencing linker, the length of the single-chain source distinguishing sequence is 2-6 bp.
As a preferred embodiment of the high-throughput sequencing linker, the length of the template source distinguishing sequence is 2-4 bp.
As a preferred embodiment of the high throughput sequencing linker of the present invention, the nucleotide sequence of the first strand is: 5 '-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACG ACGCTCTTCCGATCTNNGT-3';
the nucleotide sequence of the second strand is: 5 '-CNNAGATCGGAAGAGCAC ACGTCTGAACTCCAGTCACNNNNXXXXATCTCGTATGCCGTCTTCTGCTTG-3';
wherein NN represents a single-stranded origin-discriminating sequence; the sequence formed by 4N on the right of TCAC in the second chain represents a template source distinguishing sequence; the sequence formed by the 4 XXXX to the left of the ATCT represents a sample discrimination sequence, i.e., an index sequence, which is fixed for each sample; the random base N is any one of A, T, C, G.
The invention also provides a preparation method of the high-throughput sequencing joint, which comprises the following steps:
(1) designing two single-stranded sequences of a high-throughput sequencing linker;
(2) synthesizing two single-stranded sequences;
(3) specifically annealing the two synthesized single-chain sequences to obtain a double-chain sequencing joint;
(4) and (4) mixing a plurality of pairs of test joints prepared in the step (3) in equal proportion to obtain a mixed high-throughput sequencing joint.
The preparation method of the high-throughput sequencing joint is simple and has no fussy experimental process.
The invention also provides a kit for constructing the ultralow frequency mutation sequencing library, which comprises a sequencing joint, wherein the sequencing joint is any one of the sequencing joints.
The invention also provides a construction method of the ultralow frequency mutation sequencing library, which comprises the following steps:
(1) constructing a whole gene sequencing library by adopting the kit;
(2) carrying out hybridization capture on the whole gene sequencing library to obtain a sequencing library containing a target fragment;
(3) and amplifying the captured sequencing library containing the target fragment to obtain the target library.
In the technical scheme, the sequencing joint is adopted to construct an experimental process of a sequencing library without any change, the operation is simple and convenient, and optimization conditions are not required.
The invention also provides a detection method of the ultralow frequency mutation, an ultralow frequency mutation sequencing library is constructed according to the method, the sequencing is carried out on a computer to obtain sequencing data, and the sequencing data is subjected to mutation site analysis to obtain mutation site data.
The detection method of the ultralow frequency mutation can classify sequencing reads into the same molecular family according to the source sequence of the template, and can classify the sequence of the same template into a group of plus-sense chains and a group of minus-sense chains according to the distinguishing sequence of single-stranded sources. The mutation site data can be divided into the following three cases: 1) the mutation of the sense strand group or the antisense strand group in one molecular family is only once or a few times, and the complementary antisense strand group or the sense strand group does not have the same mutation, which indicates that the mutation is random error, or copy error introduced later in the PCR process, or the base judgment error of a sequencing machine, and indicates that the sample has no mutation at the position; 2) the occurrence of a sense strand set or a antisense strand set in one molecular family is uniform, but the occurrence of a complementary antisense strand set or sense strand set is not uniform, which indicates that the mutation is a replication error introduced in the first cycle of PCR or an asymmetric mutation; 3) the positive-sense strand group or the negative-sense strand group in the molecular family uniformly appears, and the mutation corresponding to the complementary negative-sense strand group or the positive-sense strand group appears, which shows that the mutation is true and credible, thereby being capable of eliminating the mutation caused by error in library amplification or sequencing judgment and improving the detection accuracy.
Compared with the prior art, the invention has the beneficial effects that:
(1) the sequencing joint in the technical scheme comprises a template distinguishing sequence and a single-chain distinguishing sequence, sequencing reads can be classified into the same molecular family according to the template source sequence, the sequences of the same molecular family can be divided into a group of plus-sense chains and a group of minus-sense chains according to the single-chain source distinguishing sequence, errors introduced in PCR amplification and errors introduced in a sequencing process of a target DNA molecule can be eliminated according to the position where mutation occurs, and therefore the precision of mutation detection is improved.
(2) The sequencing joint provided by the invention is used for constructing an experimental process of a sequencing library without changing completely, is simple and convenient to operate and does not need optimization conditions.
Drawings
FIG. 1 is a 2100 detection graph of library T778 (1% frequency).
FIG. 2 is a 2100 detection graph of library T779 (0.1% frequency).
FIG. 3 is a 2100 detection graph of library M778 (1% frequency).
FIG. 4 is a 2100 detection graph of library M779 (0.1% frequency).
Detailed Description
To better illustrate the objects, aspects and advantages of the present invention, the present invention will be further described with reference to the accompanying drawings and specific examples. It will be understood by those skilled in the art that the specific embodiments described herein are merely illustrative of the invention and are not intended to limit the invention.
The test methods used in the following examples are all conventional methods unless otherwise specified; materials, reagents and the like used in the following examples are commercially available unless otherwise specified.
Examples
First, joint sequence manufacturing
(1) Design of synthetic sequences
Sequences S1 and S2 were synthesized separately, and S1 and S2 each represent a set of sequences.
S1：(5＇-3＇)：AATGATACGGCGACCACCGAGATCTACACTCTTTC CCTACACGACGCTCTTCCGATCTNNGT
S2：(5＇-3＇)：p*CNNAGATCGGAAGAGCACACGTCTGAACTCCA GTCACNNNNXXXXATCTCGTATGCCGTCTTCTGCTTG
Remarking: p is a phosphorylation modification
The sequence S1 contains a single-stranded source-specific sequence consisting of 2 to 6 random bases N, and since it is located in the double-stranded complementary region of the Y-junction, it is necessary to synthesize a plurality of sequences and mix them together in order to form the random bases N. The random base N may be A, T, C, G, and if the single-stranded discrimination sequence is 2 bases, 4 bases need to be synthesized2When the single-stranded sense sequence is 3 bases, 4 sequences need to be synthesized364 sequences, and so on. In this example, sequences shown in Table 1 were synthesized by taking the 2-base single-strand derived sense sequence as an example.
TABLE 1
The sequence S2 includes a single-strand-derived discriminating sequence composed of 2 random bases N, a template-derived discriminating sequence composed of 4 random bases N, and an index sequence composed of 4 bases. The index sequence was fixed for each sample, and in this case 4 bases were taken near the 3' end with reference to the Illumina Treseq 8 base index sequence. Although the template-derived discrimination sequence is a random base N, it is sufficient to directly synthesize the random base N because it is located in the single-stranded portion of the Y-shaped linker. The single-stranded discrimination sequence is located in the complementary region of the double strand of the Y-junction, and is formed by synthesizing a plurality of sequences and mixing them in order to form the random base N. The random base N may be A, T, C, G, and if the single-stranded discrimination sequence is 2 bases, 4 bases need to be synthesized2When the single-stranded sense sequence is 3 bases, 4 sequences need to be synthesized364 sequences, and so on. In this example, sequences shown in Table 2 were synthesized by using the sequence TAGC as index94 sequence, taking the single-strand origin of 2 bases as an example.
TABLE 2
Remarking: and 5' ends of the 16 sequences of the S2 group are modified by phosphorylation modification.
(2) Diluting the powder of each sequence by using nuclease-free water to obtain mother liquor with the concentration of 100 mu M, respectively taking equal amounts of S1 mother liquor and S2 mother liquor which are complementarily matched into a PCR tube, placing the PCR tube on an ABI 2720 PCR instrument, denaturing at 95 ℃ for 5min, and then closing the PCR instrument to naturally cool to room temperature.
(3) And (4) mixing the annealed 16 double-chain connector sequences in equal proportion, and finishing the manufacture of the connector.
Second, sample preparation
This example used a Multiplex I cfDNA Reference Standard Set, which is a commercial Standard of Horizon Discovery, as a sample to be examined. Catalogue #: HD778 is a cfDNA standard with 1% mutation frequency, Catalogue #: HD779 is a cfDNA standard substance with 0.1% mutation frequency, 2 parts of each standard substance with each frequency are equal, and the commercial Illumina Truseq adaptor and the adaptor of the invention are respectively used for subsequent library building, capturing and sequencing. Wherein, the corresponding relationship between each tag adaptor and sample and library label is shown in table 3:
TABLE 3
| Library labels | Sample numbering | Label joint |
| T778 | HD778 | Truseq-1 |
| T779 | HD779 | Truseq-1 |
| M778 | HD778 | Myseq-94 |
| M779 | HD779 | Myseq-94 |
Third, Pre-Capture library construction
(1) End repair and addition of A
1) The reaction solution was prepared in a PCR tube according to the following table, and gently mixed by up-and-down blowing and sucking with a gun.
TABLE 4
2) Placing into a PCR instrument, and carrying out reaction according to the set program in the following table
TABLE 5
| Step (ii) of | Temperature of | Time | Hot lid |
| 1 | 20℃ | 30min | 85℃ |
| 2 | 65℃ | 30min | 85℃ |
| 3 | 4℃ | Hold | 85℃ |
(2) End repair II
1) The reaction solution was prepared in the PCR tube of the previous step according to Table 6, and gently mixed by up-and-down blowing and sucking with a gun.
TABLE 6
| Reagent | Volume (μ L) |
| Products of the above step | 60 |
| PCR-grade water | 8.75 |
| Ligation Buffer | 30 |
| |
10 |
| Adapter | 1.25 |
| Total | 110 |
2) Placing into a PCR instrument, and heating at 20 deg.C for 15 min. Do not heat the lid of the PCR apparatus or open the lid of the PCR apparatus.
3) Purification of
Taking the AmpureXP magnetic bead solution out of a refrigerator at 4 ℃, incubating for 30 minutes at room temperature, and fully mixing.
To the library tube, 88. mu.L (0.8 Xvolume) of mixed AmpureXP and Votex was added and mixed for 5s, and the mixture was left at room temperature for 5 min.
Briefly, the tube was placed on a magnetic rack and allowed to stand for about 5min until the solution became clear.
The supernatant in the tube was carefully aspirated on a magnetic rack without touching the magnetic beads with the tip.
On a magnetic frame, 200 μ L of 80% ethanol was added to each tube, and the solution was left for 1min until it was clear, and the ethanol was removed by aspiration.
Repeating the previous step.
Air-drying at room temperature until the ethanol remained in the tube is completely volatilized (the magnetic beads are dried too much, so that the elution efficiency is obviously reduced).
Add 21. mu.L of Low EDTA TE, incubate for 5min at room temperature, briefly centrifuge, place the tube on a magnetic rack, stand for about 5min until the solution becomes clear, aspirate 20. mu.L of supernatant into a new labeled PCR tube.
(3) Amplification of a library with attached adaptor
1) The reaction solution was prepared in the PCR tube according to Table 7, and gently mixed by up-and-down aspiration with a gun.
TABLE 7
| Reagent | Volume (μ L) |
| 2×KAPA HIFI hotstart Ready mix | 25 |
| 10×Library Amplification Primer Mix | 5 |
| Purifying the product of the previous step | 20 |
| |
50 |
2) The reaction mixture was placed in a PCR apparatus and the procedure set forth in Table 8 was followed.
TABLE 8
3) Purification of
The AmpureXP magnetic bead suspension was mixed well until the suspension was uniform in color.
Add 50. mu.L (1 Xvolume) of pooled XP beads, Votex pool 5s to the library tubes and let stand at room temperature for 5 min.
Briefly, the tube was placed on a magnetic rack and allowed to stand for about 5min until the solution became clear.
The supernatant in the tube was carefully aspirated on a magnetic rack without touching the magnetic beads with the tip.
On a magnetic frame, 200. mu.L of 80% ethanol was added to each tube, and after allowing to stand for 1min to allow the magnetic beads to settle, the ethanol was aspirated off.
Repeating the previous step.
Air-drying at room temperature until the ethanol remained in the tube is completely volatilized (the magnetic beads are dried too much, so that the elution efficiency is obviously reduced).
Add 20. mu.L of Low EDTA TE, incubate for 5min at room temperature, briefly centrifuge, place the tube on a magnetic rack, stand for about 5min until the solution becomes clear, aspirate the supernatant into a new labeled PCR tube.
Fourth, Capture library construction
(1) Quantitative library mixing
Qubit 3.0 quantification was performed on 1. mu.L of the library to obtain the library concentration. The fragment size was measured at 2100 with 1. mu.L, and the results are shown in FIGS. 1, 2, 3 and 4. Wherein FIG. 1 is a 2100 test graph of library T778 (1% frequency); FIG. 2 is a 2100 detection graph of library T779 (0.1% frequency); FIG. 3 is a 2100 test graph of library M778 (1% frequency); FIG. 4 is a 2100 detection plot of library M779 (0.1% frequency);
the constructed 4 libraries, 2 libraries of HD778 and 2 libraries of HD779 were mixed together, each library mixed with 250ng, and the volume used for each library was calculated as shown in table 9:
TABLE 9
From the library exports in the table above, the exports of the linker of the invention are significantly higher than the exports of Illumina Truseq of the control group.
(2) Hybridization of
The reaction solution was prepared in the PCR tube according to Table 10, and gently mixed by up-and-down aspiration with a gun.
Concentrating with vacuum extractor at temperature not higher than 70 deg.C until the library is completely concentrated.
Hybridization Mix was prepared as in Table 11, and 13. mu.L of Hybridization Mix was added to each of the concentrated DNA libraries.
TABLE 11
Blowing and sucking for 8-10 times up and down by using a gun, then covering a tube cover tightly, carrying out high-speed vortex oscillation for 5s, carrying out short-time centrifugation to collect liquid on the tube wall to the tube bottom, and incubating for 10min at room temperature.
Placing into a PCR instrument, and heating at 95 deg.C for 10 min.
The hybridization program was set up with another PCR machine (hot lid temperature set at 75 ℃):
TABLE 12
| Step (ii) of | Number of cycles | Temperature of | Time |
| 1 | 1 | 65℃ | >4h |
The sample is taken down, 4 microliter of the probe is rapidly added into the library mixed solution, and the mixture is evenly blown and sucked up and down by a gun for 8 to 10 times.
Again, all caps were confirmed to be closed, vortexed at high speed for 5 seconds, centrifuged briefly, and then returned to the PCR machine where the hybridization program was set up for overnight hybridization. The importance is: it is important to ensure that the tube is covered tightly, so as to minimize the evaporation of the volume of the hybridization mixed liquid, otherwise, the hybridization effect will be influenced.
(3) Capture and elution
Dynabeads M-270Streptavidin beads were vortexed 30min earlier and allowed to equilibrate at room temperature.
The metal bath was preheated to 65 ℃.
a) Preparing an elution working solution:
b) prepare 1X working solution according to Table 13
Watch 13
Working solutions for incubation as per Table 14
TABLE 14
| Reagent | 1rxn volume (μ L) | Temperature of | Time |
| 1×Wash Buffer I | 100 | 65℃ | >2h |
| 1× |
400 | 65℃ | >2h |
The rest of the working solution is kept at room temperature.
a) Washing Dynabeads M-270Streptavidin beads:
100 μ L of vortexed Dynabeads M-270Streptavidin beads were taken from each library in a 0.2mL low adsorption centrifuge tube, and the tube was placed on a magnetic rack until the solution became clear and the supernatant was aspirated.
Adding 200 mu L of 1 Xbead Wash Buffer, blowing and sucking 8-10 times, and mixing uniformly. The tube was placed on a magnetic stand until the solution became clear and the supernatant was aspirated.
Repeating the previous step.
Add 100. mu.L of 1 × Bead Wash Buffer, suck 8-10 times of resuspension beads. The tube was placed on a magnetic stand until the solution became clear and the supernatant was aspirated.
Note that: immediately after this step, the next step is carried out.
b) Capturing:
transferring the hybridized library into a Beads tube, blowing and sucking for 8-10 times, and uniformly mixing.
Put on PCR, incubate for 45min at 65 ℃ and set the temperature of the hot lid at 75 ℃. The library was vortexed for 3s every 12min to ensure suspension of the beads.
c) And (3) elution:
add 100. mu.L of 1 × Wash Buffer I preheated to 65 ℃ and vortex gently for immediate isolation. The tube was placed on a magnetic stand, allowed to stand until the solution was clear, and the supernatant was aspirated.
200 μ L of 1 × Stringent Wash Buffer I preheated to 65 ℃ was added and the beads were resuspended by blowing up and down with a gun at least 10 times to avoid air bubbles. Incubate 5min at 65 ℃ on a metal bath. The tube was placed on a magnetic stand, allowed to stand until the solution was clear, and the supernatant was aspirated.
Repeating the previous step.
Add 200. mu.L of 1 × Wash Buffer I at room temperature, vortex for 2min, and flash-off. The tube was placed on a magnetic stand, allowed to stand until the solution was clear, and the supernatant was aspirated.
Add 200. mu.L of 1 × Wash Buffer II left at room temperature, vortex for 1min, and flash-detach. The tube was placed on a magnetic stand, allowed to stand until the solution was clear, and the supernatant was aspirated.
Add 200. mu.L of 1 × Wash Buffer III left at room temperature, vortex for 30sec, flash. The tube was placed on a magnetic stand, allowed to stand until the solution was clear, and the supernatant was aspirated.
After the last washing, the mixture is centrifuged for a short time and placed on the magnetic rack again to ensure that all Wash buffers are sucked.
Add 20. mu.L of clean-free water and blow up and down with the gun at least 10 times to resuspend the beads.
(4) PCR amplification after hybrid Capture
The AMPure XP bead is taken out 30min in advance, vortexed, uniformly mixed and placed at room temperature for balancing.
PCR reaction solution was prepared on ice according to the system of Table 15, and mixed by gently blowing up and down with a gun.
Watch 15
| Reagent | Volume (μ L) |
| Captured on-bead DNA | 20 |
| 2×KAPA HiFi HotStart Ready Mix | 25 |
| Reagent R1 | 5 |
| |
50 |
After confirming that the reaction solution containing the magnetic beads was mixed well, the tube was put into a PCR apparatus for amplification, and the tube cap was replaced with a new one, and the PCR apparatus parameters were set as shown in Table 16.
TABLE 16
(5) Purification of
AMPure XP bead suspension was mixed well until the suspension was uniform in color.
Add 75. mu.l (1.5 Xvolume) of the mixed AMPure XP bead suspension and PCR amplified DNA library to the PCR tube, mix them in a Votex, and let stand at room temperature for 5 min.
Briefly, the tube was placed on a magnetic rack and allowed to stand for about 3min until the solution became clear.
The supernatant in the tube was carefully aspirated on a magnetic rack without touching the magnetic beads with the tip.
On a magnetic frame, 200 μ L of 80% ethanol was added to each tube, and the solution was left for 1min until it was clear, and the ethanol was removed by aspiration.
Repeating the previous step.
Air-drying at room temperature until the ethanol remained in the tube is completely volatilized (the magnetic beads are dried too much, so that the elution efficiency is obviously reduced).
Add 20. mu.L of nucleic-free water, mix well on the votex, and let stand at room temperature for 5 min.
Briefly, the tube was placed on a magnetic rack and allowed to stand for about 2min until the solution became clear.
Aspirate approximately 20. mu.L of supernatant into a new labeled 1.5mL tube.
A1. mu.L sample was taken for the quantification of Qubit 3.0. A2. mu.L sample was taken for qPCR quantification.
Five, storehouse checking machine
And (3) after the library is qualified, operating the machine, and selecting a Nextseq 500 sequencer of an Illumina platform by using the operating platform, wherein the sequencing strategy is PE150, double-end index sequencing is performed, and the data volume of each library is 2G.
Sixthly, data analysis
Aiming at the data of the sequencer, and combining a sample information table, adopting Illumina bcl2FASTQ (v2.17) conversion software to convert the Base calling file into a FASTQ format file. Sample tag identification and splitting of samples are performed in a general FASTQ file, while random molecular tag identification is performed. And (3) performing quality control filtration on the obtained sequence, and comparing the reference genome by adopting a BWA tool. And (5) performing further redundancy elimination analysis by combining the alignment result with the molecular tag sequence. The results of the quality control data analysis of each sample are shown in Table 17:
TABLE 17
The above results show that use of the linker of the invention reduces linker contamination, increases the proportion of available data, which reduces the cost of detection compared to the control Illumina Truseq linker.
The samples were further analyzed for mutations by unique alignment sequences and aligned to predicted values, as shown in table 18:
watch 18
As can be seen from table 18, in the method of example 1, in the detection of 1% mutation frequency standard HD778, both the linker of the present invention and the linker of Illumina Truseq can detect positive sites, but the mutation site frequency of the linker detection kit of the present invention has good agreement with the expected value; in the detection of a 0.1% mutation frequency standard HD779, all positive sites are detected by the linker of the invention, but the positive sites are not detected by the linker of Illumina Truseq. The results show that the joint of the invention is simple to manufacture, does not change the existing library building process, and can detect mutation frequency as low as 0.1%.
The sequencing joint disclosed by the invention is simple in preparation process, can improve the detection precision in the application of ultralow frequency mutation detection, and can accurately detect the mutation frequency of 0.1%.
Finally, it should be noted that the above embodiments are only used for illustrating the technical solutions of the present invention and not for limiting the protection scope of the present invention, and although the present invention is described in detail with reference to the preferred embodiments, it should be understood by those skilled in the art that modifications or equivalent substitutions can be made on the technical solutions of the present invention without departing from the spirit and scope of the technical solutions of the present invention.
SEQUENCE LISTING
<110> Guangzhou Diffuse bioinformatics technologies, Inc
<120> high-throughput sequencing joint, preparation method thereof and application thereof in ultralow frequency mutation detection
<160> 32
<170> PatentIn version 3.3
<210> 1
<211> 62
<212> DNA
<213> Artificial sequence
<400> 1
aatgatacgg cgaccaccga gatctacact ctttccctac acgacgctct tccgatctaa 60
gt 62
<210> 2
<211> 62
<212> DNA
<213> Artificial sequence
<400> 2
aatgatacgg cgaccaccga gatctacact ctttccctac acgacgctct tccgatctag 60
gt 62
<210> 3
<211> 62
<212> DNA
<213> Artificial sequence
<400> 3
aatgatacgg cgaccaccga gatctacact ctttccctac acgacgctct tccgatctat 60
gt 62
<210> 4
<211> 62
<212> DNA
<213> Artificial sequence
<400> 4
aatgatacgg cgaccaccga gatctacact ctttccctac acgacgctct tccgatctac 60
gt 62
<210> 5
<211> 62
<212> DNA
<213> Artificial sequence
<400> 5
aatgatacgg cgaccaccga gatctacact ctttccctac acgacgctct tccgatctca 60
gt 62
<210> 6
<211> 62
<212> DNA
<213> Artificial sequence
<400> 6
aatgatacgg cgaccaccga gatctacact ctttccctac acgacgctct tccgatctcc 60
gt 62
<210> 7
<211> 62
<212> DNA
<213> Artificial sequence
<400> 7
aatgatacgg cgaccaccga gatctacact ctttccctac acgacgctct tccgatctcg 60
gt 62
<210> 8
<211> 62
<212> DNA
<213> Artificial sequence
<400> 8
aatgatacgg cgaccaccga gatctacact ctttccctac acgacgctct tccgatctct 60
gt 62
<210> 9
<211> 62
<212> DNA
<213> Artificial sequence
<400> 9
aatgatacgg cgaccaccga gatctacact ctttccctac acgacgctct tccgatctga 60
gt 62
<210> 10
<211> 62
<212> DNA
<213> Artificial sequence
<400> 10
aatgatacgg cgaccaccga gatctacact ctttccctac acgacgctct tccgatctgc 60
gt 62
<210> 11
<211> 62
<212> DNA
<213> Artificial sequence
<400> 11
aatgatacgg cgaccaccga gatctacact ctttccctac acgacgctct tccgatctgg 60
gt 62
<210> 12
<211> 62
<212> DNA
<213> Artificial sequence
<400> 12
aatgatacgg cgaccaccga gatctacact ctttccctac acgacgctct tccgatctgt 60
gt 62
<210> 13
<211> 62
<212> DNA
<213> Artificial sequence
<400> 13
aatgatacgg cgaccaccga gatctacact ctttccctac acgacgctct tccgatctta 60
gt 62
<210> 14
<211> 62
<212> DNA
<213> Artificial sequence
<400> 14
aatgatacgg cgaccaccga gatctacact ctttccctac acgacgctct tccgatcttc 60
gt 62
<210> 15
<211> 62
<212> DNA
<213> Artificial sequence
<400> 15
aatgatacgg cgaccaccga gatctacact ctttccctac acgacgctct tccgatcttg 60
gt 62
<210> 16
<211> 62
<212> DNA
<213> Artificial sequence
<400> 16
aatgatacgg cgaccaccga gatctacact ctttccctac acgacgctct tccgatcttt 60
gt 62
<210> 17
<211> 69
<212> DNA
<213> Artificial sequence
<220>
<221> misc_feature
<222> (38)..(41)
<223> n is a, c, g, or t
<400> 17
caaagatcgg aagagcacac gtctgaactc cagtcacnnn ntagcatctc gtatgccgtc 60
ttctgcttg 69
<210> 18
<211> 69
<212> DNA
<213> Artificial sequence
<220>
<221> misc_feature
<222> (38)..(41)
<223> n is a, c, g, or t
<400> 18
cagagatcgg aagagcacac gtctgaactc cagtcacnnn ntagcatctc gtatgccgtc 60
ttctgcttg 69
<210> 19
<211> 69
<212> DNA
<213> Artificial sequence
<220>
<221> misc_feature
<222> (38)..(41)
<223> n is a, c, g, or t
<400> 19
catagatcgg aagagcacac gtctgaactc cagtcacnnn ntagcatctc gtatgccgtc 60
ttctgcttg 69
<210> 20
<211> 69
<212> DNA
<213> Artificial sequence
<220>
<221> misc_feature
<222> (38)..(41)
<223> n is a, c, g, or t
<400> 20
cacagatcgg aagagcacac gtctgaactc cagtcacnnn ntagcatctc gtatgccgtc 60
ttctgcttg 69
<210> 21
<211> 69
<212> DNA
<213> Artificial sequence
<220>
<221> misc_feature
<222> (38)..(41)
<223> n is a, c, g, or t
<400> 21
ccaagatcgg aagagcacac gtctgaactc cagtcacnnn ntagcatctc gtatgccgtc 60
ttctgcttg 69
<210> 22
<211> 69
<212> DNA
<213> Artificial sequence
<220>
<221> misc_feature
<222> (38)..(41)
<223> n is a, c, g, or t
<400> 22
cccagatcgg aagagcacac gtctgaactc cagtcacnnn ntagcatctc gtatgccgtc 60
ttctgcttg 69
<210> 23
<211> 69
<212> DNA
<213> Artificial sequence
<220>
<221> misc_feature
<222> (38)..(41)
<223> n is a, c, g, or t
<400> 23
ccgagatcgg aagagcacac gtctgaactc cagtcacnnn ntagcatctc gtatgccgtc 60
ttctgcttg 69
<210> 24
<211> 69
<212> DNA
<213> Artificial sequence
<220>
<221> misc_feature
<222> (38)..(41)
<223> n is a, c, g, or t
<400> 24
cctagatcgg aagagcacac gtctgaactc cagtcacnnn ntagcatctc gtatgccgtc 60
ttctgcttg 69
<210> 25
<211> 69
<212> DNA
<213> Artificial sequence
<220>
<221> misc_feature
<222> (38)..(41)
<223> n is a, c, g, or t
<400> 25
cgaagatcgg aagagcacac gtctgaactc cagtcacnnn ntagcatctc gtatgccgtc 60
ttctgcttg 69
<210> 26
<211> 69
<212> DNA
<213> Artificial sequence
<220>
<221> misc_feature
<222> (38)..(41)
<223> n is a, c, g, or t
<400> 26
cgcagatcgg aagagcacac gtctgaactc cagtcacnnn ntagcatctc gtatgccgtc 60
ttctgcttg 69
<210> 27
<211> 69
<212> DNA
<213> Artificial sequence
<220>
<221> misc_feature
<222> (38)..(41)
<223> n is a, c, g, or t
<400> 27
cggagatcgg aagagcacac gtctgaactc cagtcacnnn ntagcatctc gtatgccgtc 60
ttctgcttg 69
<210> 28
<211> 69
<212> DNA
<213> Artificial sequence
<220>
<221> misc_feature
<222> (38)..(41)
<223> n is a, c, g, or t
<400> 28
cgtagatcgg aagagcacac gtctgaactc cagtcacnnn ntagcatctc gtatgccgtc 60
ttctgcttg 69
<210> 29
<211> 69
<212> DNA
<213> Artificial sequence
<220>
<221> misc_feature
<222> (38)..(41)
<223> n is a, c, g, or t
<400> 29
ctaagatcgg aagagcacac gtctgaactc cagtcacnnn ntagcatctc gtatgccgtc 60
ttctgcttg 69
<210> 30
<211> 69
<212> DNA
<213> Artificial sequence
<220>
<221> misc_feature
<222> (38)..(41)
<223> n is a, c, g, or t
<400> 30
ctcagatcgg aagagcacac gtctgaactc cagtcacnnn ntagcatctc gtatgccgtc 60
ttctgcttg 69
<210> 31
<211> 69
<212> DNA
<213> Artificial sequence
<220>
<221> misc_feature
<222> (38)..(41)
<223> n is a, c, g, or t
<400> 31
ctgagatcgg aagagcacac gtctgaactc cagtcacnnn ntagcatctc gtatgccgtc 60
ttctgcttg 69
<210> 32
<211> 69
<212> DNA
<213> Artificial sequence
<220>
<221> misc_feature
<222> (38)..(41)
<223> n is a, c, g, or t
<400> 32
cttagatcgg aagagcacac gtctgaactc cagtcacnnn ntagcatctc gtatgccgtc 60
ttctgcttg 69
Claims (4)
1. A high throughput sequencing adaptor, wherein said adaptor is a wye-type adaptor, said wye-type adaptor comprising a first strand and a second strand partially complementary to said first strand, said first strand comprising a library amplification primer sequence a, a sequencing primer sequence, a single-strand derived discriminating sequence, and a GT base, said second strand comprising a C base, a single-strand derived discriminating sequence complementary to said first strand, a sequencing primer sequence partially complementary to said first strand, a template derived discriminating sequence, a sample discriminating sequence, and a library amplification primer sequence B; the nucleotide sequence of the first strand is: 5 '-AATGATACGGCGACCACCGAGATCTACACTCTTTCC CTACACGACGCTCTTCCGATCTNNGT-3';
the nucleotide sequence of the second strand is: 5 '-CNNAGATCGGAAGAGCAC ACGTCTGAACTCCAGTCACNNNNXXXXATCTCGTATGCCGTCTTCTGCTTG-3'.
2. The method for preparing a high throughput sequencing linker of claim 1, comprising the steps of:
(1) designing two single-stranded sequences of the high-throughput sequencing joint, wherein the nucleotide sequence of a first strand is as follows: 5 '-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCT CTTCCGATCTNNGT-3'; the nucleotide sequence of the second strand is: 5 '-CNNAGATCGGAAGAGCACACGTCTGAACTCAGTCACNNNXXATCTCGTATGCCGTCTTCTGCTTG-3';
(2) synthesizing two single-stranded sequences;
(3) specifically annealing the two synthesized single-chain sequences to obtain a double-chain sequencing joint;
(4) and (4) mixing a plurality of pairs of test joints prepared in the step (3) in equal proportion to obtain a mixed high-throughput sequencing joint.
3. A kit for constructing an ultra-low frequency mutation sequencing library, the kit comprising a sequencing adaptor, wherein the sequencing adaptor is the sequencing adaptor of claim 1.
4. A method for constructing an ultralow frequency mutation sequencing library, which is characterized by comprising the following steps:
(1) constructing a whole gene sequencing library using the kit of claim 3;
(2) carrying out hybridization capture on the whole gene sequencing library to obtain a sequencing library containing a target fragment;
(3) and amplifying the captured sequencing library containing the target fragment to obtain the target library.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710983188.XA CN107858414B (en) | 2017-10-18 | 2017-10-18 | High-throughput sequencing joint, preparation method thereof and application thereof in ultralow frequency mutation detection |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710983188.XA CN107858414B (en) | 2017-10-18 | 2017-10-18 | High-throughput sequencing joint, preparation method thereof and application thereof in ultralow frequency mutation detection |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN107858414A CN107858414A (en) | 2018-03-30 |
| CN107858414B true CN107858414B (en) | 2021-09-10 |
Family
ID=61697703
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710983188.XA Active CN107858414B (en) | 2017-10-18 | 2017-10-18 | High-throughput sequencing joint, preparation method thereof and application thereof in ultralow frequency mutation detection |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107858414B (en) |
Families Citing this family (14)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109295049A (en) * | 2018-09-26 | 2019-02-01 | 刘强 | Label specific linkers, primer sets and the banking process in the library Blood Trace cfDNA |
| CN109402242A (en) * | 2018-10-25 | 2019-03-01 | 翌圣生物科技（上海）有限公司 | The method of new-generation sequencing connector of the preparation with duplex molecule label |
| CN109371109A (en) * | 2018-10-25 | 2019-02-22 | 翌圣生物科技（上海）有限公司 | A method of preparing the two generation sequence measuring joints with multiple molecular labels |
| CN109321568A (en) * | 2018-10-25 | 2019-02-12 | 翌圣生物科技（上海）有限公司 | The method of new-generation sequencing connector of the preparation with molecular label |
| CN109295164A (en) * | 2018-10-25 | 2019-02-01 | 翌圣生物科技（上海）有限公司 | A method of preparing the two generation sequence measuring joints with molecular label |
| CN109371108A (en) * | 2018-10-25 | 2019-02-22 | 翌圣生物科技（上海）有限公司 | The method of new-generation sequencing connector of the preparation with multiple molecular labels |
| CN108913753B (en) * | 2018-10-25 | 2019-02-05 | 翌圣生物科技（上海）有限公司 | A method of preparing two generation sequence measuring joints |
| CN109355281A (en) * | 2018-10-25 | 2019-02-19 | 翌圣生物科技（上海）有限公司 | Method of the preparation with single-stranded and duplex molecule label new-generation sequencing connector |
| CN109402224A (en) * | 2018-10-25 | 2019-03-01 | 翌圣生物科技（上海）有限公司 | The method of two generation sequence measuring joints of the preparation with duplex molecule label |
| CN111139533B (en) * | 2019-09-27 | 2021-11-09 | 上海英基生物科技有限公司 | Sequencing library adaptors with increased stability |
| CN111471754B (en) * | 2020-05-14 | 2021-01-29 | 北京安智因生物技术有限公司 | Universal high-throughput sequencing joint and application thereof |
| CN111808855B (en) * | 2020-07-20 | 2021-02-09 | 北京安智因生物技术有限公司 | Construction method of universal gene detection library for hereditary familial hypercholesterolemia and kit thereof |
| CN114134214A (en) * | 2021-12-20 | 2022-03-04 | 浙江默乐生物科技有限公司 | Double-platform combined peripheral blood cfDNA base mutation and methylation detection method |
| CN116103383B (en) * | 2023-04-03 | 2023-06-20 | 北京百力格生物科技有限公司 | Method for identifying false base of NGS linker oligo and library thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105861710A (en) * | 2016-05-20 | 2016-08-17 | 北京科迅生物技术有限公司 | Sequencing joint and preparation method and application thereof in ultra-low frequency mutation detection |
| CN106599616A (en) * | 2017-01-03 | 2017-04-26 | 上海派森诺医学检验所有限公司 | duplex-seq-based ultralow-frequency mutation site detection analysis method |
| CN106834275A (en) * | 2017-02-22 | 2017-06-13 | 天津诺禾医学检验所有限公司 | The analysis method of the construction method, kit and library detection data in ctDNA ultralow frequency abrupt climatic changes library |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US8574832B2 (en) * | 2010-02-03 | 2013-11-05 | Massachusetts Institute Of Technology | Methods for preparing sequencing libraries |
-
2017
- 2017-10-18 CN CN201710983188.XA patent/CN107858414B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105861710A (en) * | 2016-05-20 | 2016-08-17 | 北京科迅生物技术有限公司 | Sequencing joint and preparation method and application thereof in ultra-low frequency mutation detection |
| CN106599616A (en) * | 2017-01-03 | 2017-04-26 | 上海派森诺医学检验所有限公司 | duplex-seq-based ultralow-frequency mutation site detection analysis method |
| CN106834275A (en) * | 2017-02-22 | 2017-06-13 | 天津诺禾医学检验所有限公司 | The analysis method of the construction method, kit and library detection data in ctDNA ultralow frequency abrupt climatic changes library |
Also Published As
| Publication number | Publication date |
|---|---|
| CN107858414A (en) | 2018-03-30 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107858414B (en) | High-throughput sequencing joint, preparation method thereof and application thereof in ultralow frequency mutation detection | |
| US20210254148A1 (en) | Measurement of nucleic acid variants using highly-multiplexed error-suppressed deep sequencing | |
| CN107190329B (en) | Fusion based on DNA is quantitatively sequenced and builds library, detection method and its application | |
| CN106676182B (en) | Method and device for detecting low-frequency gene fusion | |
| CN108300716B (en) | Linker element, application thereof and method for constructing targeted sequencing library based on asymmetric multiplex PCR | |
| CN105861710B (en) | Sequence measuring joints, its preparation method and its application in ultralow frequency variation detection | |
| CN110218781B (en) | Composite amplification system of 21 micro haplotype sites, next generation sequencing and typing kit and typing method | |
| CN108103164B (en) | Method for detecting copy number variation by using multiple fluorescent competitive PCR | |
| CN113373524B (en) | ctDNA sequencing tag joint, library, detection method and kit | |
| CN108517567B (en) | Adaptor, primer group, kit and library construction method for cfDNA library construction | |
| WO2018184495A1 (en) | Method for constructing amplicon library through one-step process | |
| CN109778321B (en) | Database building method, kit and sequencing method for metagenome sequencing | |
| CN107893109A (en) | A kind of low abundance gene mutation enrichment method based on removal wild-type sequence | |
| CN109385469A (en) | A kind of high sensitivity double-strand Circulating tumor DNA detection method and kit | |
| CN112266948A (en) | High-throughput targeting library building method and application | |
| CN109686404B (en) | Method and device for detecting sample confusion | |
| CN111748628B (en) | Primer and kit for detecting thyroid cancer prognosis related gene variation | |
| CN113265452A (en) | Bioinformatics pathogen detection method based on Nanopore metagenome RNA-seq | |
| CN105483267B (en) | Plasma DNA bimolecular label, label and method of detection blood plasma cfDNA and application thereof | |
| CN112259165A (en) | Method and system for detecting microsatellite instability state | |
| CN112680796A (en) | Target gene enrichment and library construction method | |
| CN114277114B (en) | Method for adding unique identifier in amplicon sequencing and application | |
| WO2020005159A1 (en) | Method for detection and quantification of genetic alterations | |
| CN114774522A (en) | Method and kit for constructing high fidelity sequencing library and application | |
| CN113462759A (en) | Method for enriching and sequencing single-stranded DNA sequence based on combination of multiplex amplification and probe capture and application of method in mutation detection |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20230531 Address after: Building B10, Yunzhi Science and Technology Valley, No.1 Rule of Law Street, Xushui Economic Development Zone, Xushui District, Baoding City, Hebei Province, 071000 Patentee after: Lanjing Kexin Hebei Biotechnology Co.,Ltd. Address before: Room G301, G302, g303, G zone, Guangzhou International Business Incubator, No.3, Science City, Langyue Road, Guangzhou hi tech Industrial Development Zone, Guangdong 510000 Patentee before: GUANGZHOU MANRUI BIOLOGICAL INFORMATION TECHNOLOGY Co.,Ltd. |
|
| TR01 | Transfer of patent right |