CN107858399A - Use methods of the luciferase reporter gene detection LRP6 for miR 29a target gene - Google Patents

Abstract

Methods of the luciferase reporter gene detection LRP6 for miR 29a target gene is used, it is an object of the present invention to pass through dual-luciferase reporter system, it was demonstrated that miR 29a can pass through the expression for 3 ' the UTR negative regulations LRP6 for targetting LRP6 genes.A kind of method for using luciferase reporter gene to detect target genes of the LRP6 for miR 29a, described method include the steps：(1) build plasmid vector and carry out point mutation：(2) double fluoroscopic examination beneficial effects of the present invention are as follows：Providing a kind of new checking confirms that miR 29a can contribute to illustrating for the pathogenesis into bone related disease that miR 29a, LRP6 and Wnt/ catenin signal paths participate in by the method for the expression for 3 ' the UTR negative regulations LRP6 for targetting LRP6 genes；The research and development of the potential drug into bone related disease and the screening of biomarker for contributing to miR 29a, LRP6 and Wnt/ catenin signal paths to participate in.

Description

Luciferase reporter gene is used to detect LRP6 as miR-29a target gene Method

Technical field

The present invention relates to a kind of method for using luciferase reporter gene detection LRP6 as miR-29a target gene.

Background technology

Microrna (MicroRNAs, miRNAs) is the non-coding small molecule that a kind of size is about 19~25 bases RNA, it realizes gene expression regulation by complementary match in 3 ' ends untranslated region (3 ' UTR) of the mRNA with target gene, Extremely important role is play in the process of a series of physiology and pathology.Press down after the transcription of the gene expression of miRNAs mediations Make and played an important role in the regulation and control of Osteoblast Differentiation.MiR-29a is the positive regulation factor of Osteoblast Differentiation, and controls differentiated The collagen expression of Gegenbaur's cell.In mesenchymal cell into human osteoblast cell's atomization, miR-29a is indispensable, in skeletonization In cell, miR-29a up-regulated expressions.

Research shows that miR-29a can play different effects by regulating and controlling multiple target genes in different diseases, Such as in systemic sclerosis, miR-29a can target the chains of type III collagen α 1 (collagen type III alpha 1chain, COL3A1) regulation and control collagen expression；In IBS, miR-29a target gene is the connection of glutamic acid ammonia Enzyme (glutamate-ammonia ligase, GLUL)；In insulin β cells, miR-29a selectively targetings monocarboxylic acid turns Albumen -1 (monocarboxylate transporter 1, MCT1) is transported, is prompted in the occurrence and development of different diseases, MiR-29a is to realize finely regulating by targetting different genes.

Differentiation of the miR-29a to human osteoblast cell is required.Bioinformatics software prediction Dickkopf-1 (Dkk- 1) it is miR-29a target genes.MiR-29a can be directly targeted Dkk-1 3 ' UTR regions, and simulate the endogenous miR- of organism The human osteoblast cell and human osteoblast cell's strain hFOB1.19 of 29a (miR-29a mimic) Transfected primary culture can lower endogenous Dkk-1 expression, Wnt/ β-catenin signal paths are further activated, promote osteoblast differentiation mark alkaline phosphatase (alkaline phosphatase, ALP) and BGP (osteocalcin, OC) expression.

Wnt/ β-catenin signal paths are the Wnt signal pathways being found earliest, when in the state not being activated When, Axin, APC and GSK3 β formed a huge protein complexes phosphorylation kytoplasm in β-catenin, be phosphorylated β-catenin and then by ubiquitination, are finally degraded by proteasome.When the seven-transmembrane on extracellular part Wnt and cell membrane by After body Frizzled (FZD) and single-transmembrane receptor LRP5/6 is combined, Wnt/ β-catenin signal paths are activated.Activation by Body further passes to signal the related system albumen in cytoplasm, including Dishevelled (Dsh), Axin, APC and GSK3 β etc., Axin-APC-GSK3 β complexs are caused to be corrupted such that β-catenin discharge from this degraded complex Come and accumulated in kytoplasm.A large amount of β-catenin subsequently into nucleus and transcription factor lymph enhancer/T cells because Sub (lymphoid enhancer factor/T cell factor, LEF/TCF) etc. is combined, and activates downstream target gene Runx2, ALP, OC etc. transcription, realize the regulation and control of Osteoblast Differentiation, such as Fig. 1.

The negative regulators of Wnt/ β-catenin signal paths have secreted frizzled related protein (secreted Frizzled-related protein, sFRP), WNT inhibiting factors -1 (WNT inhibitory factor-1, WIF-1), Hardened proteins (sclerositin, sost), kerman2 and Dkk-1 etc..MiR-29a can activate Wnt/ β-catenin signals and lead to Road, miR-29a generation can be induced after the latter is activated and in turn, form a positive feedback loop.

But whether miR-29a again may be by targetting its 3 ' UTR and realizes swashing for Wnt/-catenin signal paths Work is not yet proved.

The content of the invention

It is an object of the present invention to by dual-luciferase reporter system, detection miR-29a can pass through targeting 3 ' UTR negative regulations LRP6 of LRP6 genes expression.

It is a kind of to use luciferase reporter gene to detect LRP6 as the method for miR-29a target gene, described method Including the steps：

(1) build plasmid vector and carry out point mutation：

(1.1) reverse transcription is carried out after extracting RNA：

700ng RNA are added in PCR pipe, add DEPC water to be supplemented to 11ul, after piping and druming uniformly, put 65 DEG C of insulation 5min, It is denatured RNA, immediately refrigeration on ice, to prevent RNA renaturation；

Following reagent is added in the PCR pipe：

By above-mentioned 20 μ l reaction solutions, 30 DEG C of insulation 10min；42 DEG C of insulation 60min；72 DEG C of insulation 10mn.

(1.2) pcr amplification reaction is carried out：

Wherein, primer sequence is as follows：

M-LRP6-F：CCGCTCGAGCGAGAAAGTTGAGGGAGTGGTATA

M-LRP6-R：ATTTGCGGCCGCCAATTCAGCTGTTTGTAATAATC；

Reaction system is as follows：

Response procedures are as follows：

95 DEG C of pre-degeneration 3min；95 DEG C of denaturation 30s；59 DEG C of annealing 30s；72 DEG C of extension 1min, 35 circulations, last 72 DEG C re-extend 5min；4 DEG C of preservations；

PCR primer electrophoresis 30min under 120V voltage conditions with 2% Ago-Gel, detects the presence of specific purpose Band；

(1.3) purified pcr product；

(1.4) wild type carrier is built：Double digestion purifying is carried out to carrier PsicheckTM-2Vector and PCR primer, Then conversion is attached, connection adds connection product addition 10ul connection products to 100 μ L E.coli DH5 а after terminating In competent cell, the centrifuge tube for the competent cell for having added connection product is placed in heat shock 45s in 42 DEG C of water-bath, it is rear vertical 2min on ice is placed in, during which not shake centrifuge tube, adds SOC culture mediums, after concussion and cultivate 1h, takes bacterium solution to be applied to and contains Have on ammonia benzyl mycin SOC plating mediums, 37 DEG C are incubated overnight；Plasmid is extracted after selecting the bacterium solution culture containing recon；

Connection product is added when competent cell just thaws, mixing is flicked, 30min is placed in ice；

(1.5) rite-directed mutagenesis carrier is built：

Rite-directed mutagenesis primer designs：TGGTGCT sports GAAGTTC, wherein：

It is as follows to pinpoint primer sequence：

LRP6-Mut1F：AAGTGAAGGATCGAAGTTCGCTTTTGCTGTTTGTCCTT

LRP6-Mut1R:CAAACAGCAAAAGCGAACTTCGATCCTTCACTTGCAACAAG

LRP6-Mut2F：GACTTTGGAATGAGAAGTTCTTGCAAGGATGTATTTATATT

LRP6-Mut2R：TACATCCTTGCAAGAACTTCTCATTCCAAAGTCGATGTAC；

Rite-directed mutagenesis reaction system is as follows：

Fragment 1 expands：

Fragment 2 expands

Fragment 3 expands

Rite-directed mutagenesis response procedures are as follows：95 degree of pre-degeneration 3min；95 DEG C of denaturation 40s；60 DEG C of annealing 1min；72 DEG C are prolonged 1min is stretched, 35 circulations, last 72 DEG C re-extend 10min；4 DEG C of preservations；

(2) double fluoroscopic examinations

(2.1) cell transfecting is carried out with cationic-liposome method first；

(2.2) luciferase is detected, and sample Luciferase activity inspections are carried out using dual-luciferase reporter system Survey, after readings terminates, preserve data；

(2.3) interpretation of result, confirm that miR-29a-3p can suppress LRP6 gene expressions.

Described competent cell is cultivated in the following way：

1) culture of recipient bacterium

The E.coli DH5 α single bacterium colonies newly activated from picking on SOC flat boards, are inoculated in 3-5ml LB fluid nutrient mediums, Shaken cultivation 12 hours or so at 37 DEG C, until the logarithmic growth later stage：By the bacteria suspension with:100-1:50 ratio is inoculated in In 100ml LB fluid nutrient mediums, or so 37 DEG C of shaken cultivation 2-3 hours to OD600=0.5；

2) nutrient solution is transferred in centrifuge tube, placed on ice 10 minutes, then 3000g is centrifuged 10 minutes at 4 DEG C；

3) supernatant discarding, with the 0.05mol/L of precooling CaCl₂Solution 10ml gently suspension cells, place 15- on ice After 30 minutes, 3000g is centrifuged 10 minutes at 4 DEG C；

4) supernatant discarding, 0.05mol/L of the 4ml precoolings containing 15% glycerine CaCl2 solution is added, gently suspension cell, Place a few minutes on ice, competent cell suspension；

5) competent cell is distributed into 200 μ l aliquot, stand-by in -70 DEG C of storages.

Beneficial effects of the present invention are as follows：Providing a kind of new checking confirms that miR-29a can be by targetting LRP6 bases The method of 3 ' UTR negative regulations LRP6 of cause expression, contributes to miR-29a, LRP6 and Wnt/-catenin signal path The pathogenesis into bone related disease participated in illustrates；MiR-29a, LRP6 and Wnt/-catenin signal is contributed to lead to The research and development of the potential drug into bone related disease and the screening of biomarker that road participates in.

Brief description of the drawings

Fig. 1 is positive negative regulation schematic diagram of the Wnt/ β-catenin signal paths by a variety of factors；

Fig. 2 is the miR-29a and target gene LRP6 of bioinformatics software prediction complementary series；

Fig. 3 is PCR primer Gel electrophoresis results in embodiment；

Fig. 4 is PsicheckTM-2Vector carriers；

Fig. 5 is psi-CHECK2 carrier fundamental diagrams；

Fig. 6 is specific embodiment relative luciferase activity result compares figure；

Fig. 7 is test result.

Embodiment

1 material and method

1.1 main agents, instrument and consumptive material

1.2 solution are prepared

1.2.1Mglucose prepare：36g glucose (Glucose) is dissolved in 90ul deionization aqua sterilisas, is settled to 100ml, it is degerming with 0.22um membrane filtrations.

1.2.2 liquid SOC culture mediums are prepared：Tryptone 8.0g, yeast extract 2.0g, 1M kcl 1ml, 1M Mgso₄4ml, 1M MgCl 4ml, 1M NaCl 4ml, last constant volume 400ml. adjust PH=7.0.High pressure steam sterilization, it is cold But 4m l 4M glucose (Glucose) is all added.

1.2.3X-gal：100mg is dissolved in 2ml dimethylformamides, degerming with 0.22um membrane filtrations, -20 DEG C of preservations.

1.2.4IPTG：1.2g IPTG, deionization aqua sterilisa is added to final volume 50ul, is removed with 0.22um membrane filtrations Bacterium.

1.2.5Amp：100mg Amp, 1ml deionization aqua sterilisas are added, it is degerming with 0.22um membrane filtrations.

1.2.6 solid SOC culture mediums are prepared：Tryptone 8.0g, yeast extract 2.0g, 1M kcl 1ml 1M MgSO₄4ml, 1M MgCl 4ml, 1M NaCl 4ml, agar powder 6.0g, last constant volume 400ml. adjust PH=7.0.High pressure Steam sterilizing.Be cooled to 45 DEG C or so, add 4ml 4M glucose (Glucose), 400ul IPTG, 400ul X-Gal, 400ul Amp。

2. plamid vector construction and point mutation

1.3.1RNA extraction

(1) cell is collected, adds 1ml TRizol solution, is mixed with vortice or pipette tips is inhaled and play mixing, room temperature is placed 5min；

(2) 200 μ l chloroforms are added, is shaken vigorously by hand for 15 seconds, is stored at room temperature 15min；

At (3) 4 DEG C, 10,000g centrifugation 3min, solution is divided into three layers, and RNA is dissolved in aqueous phase, and transfer aqueous phase is to another Individual new RNase free EP pipes；

(4) 0.5 times of volume isopropanol is added, is vortexed and fully mixes；

At (5) 4 DEG C, 12,000g centrifugation 10min, there is RNA precipitate in ttom of pipe after centrifugation, removes supernatant；

(6) ethanol of 1ml 75% is added, is gently overturned with hand, 12,000g centrifugation 5min, removes supernatant；

(7) room temperature is dried or is dried in vacuo, and adds 20 μ l DEPC water dissolving precipitation.

1.3.2 reverse transcription adds 700ng RNA in RNase free PCR pipe, adds DEPC water to be supplemented to 11ul, blows After beating uniformly, 65 DEG C of insulation 5min are put, are denatured RNA.Immediately refrigeration on ice, to prevent RNA renaturation；In the PCR pipe Add following reagent (Promega)

By above-mentioned 20 μ l reaction solutions, 30 DEG C of insulation 10min；42 DEG C of insulation 60min；72 DEG C of insulation 10mn.

1.4PCR amplified reaction

1.4.1 design of primers：

M-LRP6-F：CCGCTCGAGCGAGAAAGTTGAGGGAGTGGTATA

M-LRP6-R：ATTTGCGGCCGCCAATTCAGCTGTTTGTAATAATC

1.4.2PCR amplification

Reaction system：

Response procedures：

95 degree of pre-degeneration 3min；95 DEG C of denaturation 30s；59 DEG C of annealing 30s；72 DEG C of extension 1min, 35 circulations, last 72 DEG C re-extend 5min；4 DEG C of preservations.

PCR primer electrophoresis 30min under 120V voltage conditions with 2% Ago-Gel, detects the presence of specific purpose Band, PCR primer is then observed by gel imaging system, and photographed to record, such as Fig. 3.

Marker sizes：2000bp、1000bp、750bp、500bp、250bp、100bp.

1.5PCR product purification

Product purification, using Tiangeng regular-PCR Product Purification Kit.Operating procedure is as follows：Please first rinsed before Absolute ethyl alcohol is added in liquid PW, addition volume refer to the label on bottle.

1) column equilibrations step：Into adsorption column CB2, (adsorption column is put into collecting pipe) adds 500 μ l equilibrium liquid BL, 12,000rpm (~13,400 × g) centrifuge 1min, outwell the waste liquid in collecting pipe, adsorption column CB2 is placed back in into collecting pipe In.(pillar that please be treated on the use same day)

2) estimates the volume of PCR reaction solutions or endonuclease reaction liquid, adds the combination liquid PB of 5 times of volumes thereto, fully Mix.

3) adds previous step resulting solution in one adsorption column CB2 (adsorption column is put into collecting pipe), and room temperature is placed 2min, 12,000rpm (~13,400 × g) centrifuge 30-60sec, outwell the waste liquid in collecting pipe, adsorption column CB2 is put into receipts In collector.

4) adds 600 μ l rinsing liquids PW (please first checked whether before use and added absolute ethyl alcohol) into adsorption column CB2, 12,000rpm (~13,400 × g) centrifuge 30-60sec, outwell the waste liquid in collecting pipe, adsorption column CB2 is put into collecting pipe In.

5) repeats step 4.

6) puts back to adsorption column CB2 in collecting pipe, 12,000rpm (~13,400 × g) centrifugation 2min, removes drift as far as possible Washing lotion.

Adsorption column CB2 is placed in into room temperature to place several minutes, thoroughly dried, to prevent one under the influence of the rinsing liquid of residual The experiment of step.

7) adsorption column CB2 is put into a clean centrifuge tube by, and 30 μ l are vacantly added dropwise to adsorbed film centre position and wash De- buffer solution EB, room temperature place 2min.12,000rpm (~13,400 × g) centrifugations 2min collects DNA solution.By collection DNA solution is added to adsorption column CB2 again, and room temperature places 2min.

12,000rpm (~13,400 × g) centrifuge 2min, collect DNA solution.

1.6 wild type vector constructions

1.6.1 carrier information

(1) container name：PsicheckTM-2Vector (Promega), such as Fig. 4

(2) restriction enzyme site XhoI, the Not I chosen carries out digestion

A.XhoI digestions

；

B. digestion products purifying (being purified see PCR primer)；

C.Not I digestions

Digestion products purify；

1.6.2PCR product X hoI, Not I double digestions

A.XhoI digestions

B. digestion products purify

C.Not I digestions

Digestion products purify.

1.6.3 prepared by competence

1) culture of recipient bacteriums

From the E.coli DH5 α single bacterium colonies that picking newly activates on SOC flat boards (solid SOC culture mediums), 3-5ml is inoculated in In LB fluid nutrient mediums, shaken cultivation 12 hours or so at 37 DEG C, until the logarithmic growth later stage.By the bacteria suspension with 1:100- 1:50 ratio is inoculated in 100ml liquid SOC culture mediums, or so 37 DEG C of shaken cultivation 2-3 hours to OD600=0.5.

2) nutrient solution is transferred in centrifuge tube by, is placed on ice 10 minutes, then 3000g is centrifuged 10 minutes at 4 DEG C.

3) supernatant discardings, with the 0.05mol/L of precooling CaCl2 solution 10ml gently suspension cell, 15- is placed on ice After 30 minutes, 3000g is centrifuged 10 minutes at 4 DEG C.

4) supernatant discardings, 0.05mol/L of the 4ml precoolings containing 15% glycerine CaCl2 solution is added, gently suspended thin Born of the same parents, place a few minutes on ice, competent cell suspension.

5) competent cells are distributed into 200 μ l aliquot, and half a year can be preserved by being stored in -70 DEG C

1.6.4 connection conversion

1) PCR primer that purifies double digestion and the company of the PsichekTM-2vector carriers of the purifying of double digestion Connect, linked system is：1.5 μ L PsichekTM-2vector Vector, 3.5 μ L PCR primers (template), 5 μ L SolutionⅠ.Gently mix, 16 DEG C of reaction more than 1.5h in PCR instrument；

2) after reactions terminate, 10ul connection products is added into 100 μ L E.coli DH5 а competent cells, paid attention to Connection product must be added when competent cell just thaws, flick mixing, 30min is placed in ice；

3) centrifuge tube for the competent cell for having added connection product is placed in heat shock 45s in 42 DEG C of water-bath by, after immediately 2min on ice is placed in, during which tries not to shake centrifuge tube；

4) additions 900ul liquid SOC culture mediums, 37 DEG C, 180r/min, shaken cultivation 1h.

5) takes appropriate bacterium solution to be applied to containing on ammonia benzyl mycin SOC plating mediums (solid SOC culture mediums), 37 DEG C of mistakes Night cultivates.

1.6.5 recon is identified

White single bacterium colony is selected within 2nd day in the 1ml liquid SOC culture mediums containing 1 μ l ammonia benzyl mycins, is shaken up.With original PCR primer bacterium solution is expanded, take 5 μ l PCR primers to be detected whether to contain purposeful piece with 2% agarose gel electrophoresis Section, the plasmid containing purpose fragment, carry out sequencing identification.

1.6.6 the culture and extraction of plasmid

Bacterium solution in centrifuge tube containing recon is all added to the nutrient solution containing 300mLSOC to sterilize in advance (to contain Ammonia benzyl mycin) small triangular flask in, 200r/min, 37 DEG C of overnight incubation cultures.2nd day extraction plasmid, plasmid extraction step ginseng According to the big extraction reagent kit of Tiangeng endotoxin-free plasmid.Plasmid extraction concretely comprises the following steps：Please first nothing is added before in rinsing liquid PW Water-ethanol, addition volume refer to the label on bottle.

1) column equilibration step：Into adsorption column CP6, (adsorption column is put into 50ml collecting pipes) adds 2.5ml equilibrium liquid BL, 8,000rpm (~8,228 × g) centrifuge 2min, outwell the waste liquid in collecting pipe, adsorption column is placed back in collecting pipe. (pillar treated with equilibrium liquid preferably uses immediately).

2) bacterium solution for taking 200ml to be incubated overnight adds centrifuge tube, room temperature 8, and 000rpm (~8,228 × g) centrifugations 3min is received Collect bacterium, absorb supernatant as far as possible.

3) supernatant is absorbed as far as possible, and to ensure that supernatant is all drawn, the water in bottle wall is please sucked with clean blotting paper Drop.

4) 8ml solution P1 (please first check whether and added RNase A) is added into the centrifuge tube for leave bacterial sediment, is made With pipettor or the thorough suspended bacterial cell precipitation of turbula shaker.

5) 8ml solution P2 are added into centrifuge tube, are leniently spun upside down 6-8 times immediately, room temperature places 5 min.

6) 8ml solution P4 are added into centrifuge tube, are leniently spun upside down 6-8 times immediately, fully mixes, goes out to solution The existing scattered flocculent deposit of white.Then room temperature places 10min or so.8,000rpm (~8,228 × g) centrifuge 5-10min, make From to ttom of pipe (can suitably increase centrifugation time), complete soln is carefully poured into filter CS1 (please avoid down white precipitate Enter and largely precipitate and blocking filter), push handle filtering is slowly promoted, filtrate is collected and (provided for oneself) in clean 50ml pipe.

7) isopropanol (adding isopropanol excessively easily causes RNA to pollute) of 0.3 times of filtrate volume is added into filtrate, Turn upside down and be transferred to after mixing in adsorption column CP6 (adsorption column is put into 50ml collecting pipes).

8) room temperature 8,000rpm (~8,228 × g) centrifugation 2min, outwell the waste liquid in collecting pipe, by adsorption column CP6 weights Newly put back in collecting pipe.

9) the addition 10ml rinsing liquids PW (please first check whether and added absolute ethyl alcohol) into adsorption column CP6,8,000rpm (~8,228 × g) centrifuges 2min, discards the waste liquid in collecting pipe, adsorption column is placed back in collecting pipe.

10) step 9 is repeated.

11) 3ml absolute ethyl alcohols are added into adsorption column CP6, room temperature 8,000rpm (~8,228 × g) centrifugation 2min, are fallen Fall waste liquid.

12) adsorption column CP6 is placed back in collecting pipe, 8,000rpm (~8,228 × g) centrifugations 5min, it is therefore an objective to will Remaining rinsing liquid removes in adsorption column.

13) adsorption column CP6 is placed in a clean 50ml collecting pipe, be vacantly added dropwise to the middle part of adsorbed film 1-2ml elution buffer TB, room temperature place 5min, then room temperature 8,000rpm (~8,228 × g) centrifugations 2min.By 50ml from Eluent in heart pipe all moves into a clean 1.5ml centrifuge tube, -20 DEG C of preservations.

14) 1.42ml isopropanols and 0.42ml 5M NaCl being added per 1ml eluents, mixed, room temperature places 5min, 8,000rpm (~8,228 × g) centrifuge 10min, carefully abandon supernatant.

15) 0.5ml 70% ethanol washing precipitation, room temperature 8 are added, 000rpm (~8,228 × g) centrifuges 5 min, carefully Abandon ethanol.

16) step 15 is repeated.

17) air drying precipitation about 5-10min, precipitated as needed with the TB buffer solutions of proper volume.

Plasmid is divided into three parts：5ul is taken, carries out sequencing identification；0.5ug is taken to be used for rite-directed mutagenesis；After remaining plasmid is used for Continuous transfection.

1.7 rite-directed mutagenesis vector constructions：Rite-directed mutagenesis uses SQE-PCR methods.

1.7.1 rite-directed mutagenesis primer designs：TGGTGCT sports GAAGTTC

LRP6-Mut1F：AAGTGAAGGATCGAAGTTCGCTTTTGCTGTTTGTCCTT

LRP6-Mut1R:CAAACAGCAAAAGCGAACTTCGATCCTTCACTTGCAACAAG

LRP6-Mut2F：GACTTTGGAATGAGAAGTTCTTGCAAGGATGTATTTATATT

LRP6-Mut2R：TACATCCTTGCAAGAACTTCTCATTCCAAAGTCGATGTAC.

1.7.2 rite-directed mutagenesis reacts

1) reaction system：

Fragment 1 expands：

Fragment 2 expands

Fragment 3 expands

2) response procedures：95 degree of pre-degeneration 3min；95 DEG C of denaturation 40s；60 DEG C of annealing 1min；72 DEG C extension 1min, 35 Circulation, last 72 DEG C re-extend 10min；4 DEG C of preservations.

1.7.3SQE-PCR connection：Fragment 1, fragment 2, fragment 3 use SQE-PCR connections successively.

Fragment 1, the connection of fragment 2 obtain fragment 1-2

95 degree of pre-degeneration 3min；95 DEG C of denaturation 40s, 66 DEG C of annealing 1min, 72 DEG C of extension 1min, 10 circulations, 95 DEG C become Property 40s, 60 DEG C annealing 1min, 72 DEG C extension 1min, 25 circulation；Last 72 DEG C re-extend 10min；

Fragment 1-2, the connection of fragment 2 obtain.

95 degree of pre-degeneration 3min；95 DEG C of denaturation 40s, 66 DEG C of annealing 1min, 72 DEG C of extension 1min, 10 circulations, 95 DEG C become Property 40s, 60 DEG C annealing 1min, 72 DEG C extension 1min, 25 circulation；Last 72 DEG C re-extend 10min；

1.7.4 digestion, connection, conversion, recon identification

1.7.5 wild type vector construction is shown in plasmid extraction, digestion identification

Plasmid is divided into 2 parts：5ul is taken, carries out sequencing identification；Remaining plasmid is used to subsequently transfect.

1.8 pairs of fluoroscopic examinations

1.8.1microRNA with plasmid co-transfection cell

Cationic-liposome method carries out cell transfecting：

(1) day before transfection, cell are inoculated on 24 orifice plates by 2 × 104/hole, and culture medium is containing 10%FBS's DMEM- high glucose mediums；

(2) on the transfection same day, cell confluency degree is about 50-60%, sucks old culture medium, is washed twice with PBS, then 300 μ L OPTI-MEM (Invitrogen companies) culture mediums are added per hole, are placed in 5%CO₂, in 37 DEG C of incubators；

(3) each hole OPTI-MEM culture mediums dilute lipofectamine2000 (Invitrogen companies) 1 μ L, eventually Volume is 50 μ L, stands 5min at room temperature；

(4) each hole microRNA1uL or microRNA inhibitor and 0.5ug plasmids for adding 20uM concentration, then add Enter OPTI-MEM to the μ L of cumulative volume 50, stand 5min at room temperature；(it is 50nM microRNA or 100nM in final Incubating Solution MicroRNA inhibitor)

(5) dilution in compound (3) and (4), stands 20min at room temperature；

(6) the transfection complex liquid added per hole in 100 μ L (5), rocks 24 orifice plates and slightly mixes；

(7) in 5%CO₂, be incubated 5hr in 37 DEG C of incubators, replaced with fresh complete medium (containing serum) containing turning Contaminate the culture medium of compound.

Note：Tip heads used go Rnase processing.

1.8.2 luciferase (Luciferase) detects

With dual-luciferase reporter system (the Dual-Luciferase Reporter Assay of Promega companies System) (E1910) carries out sample Luciferase Activity determinations.

After transfecting 48h, old culture medium is sucked, is washed twice with PBS, 100 μ L PLB is added per hole cell (Passive Lysis Buffer), room temperature slightly shakes 15 minutes, collects cell pyrolysis liquid.1st, using manual double fluorescents Detector (Promega, GloMax bioluminescent detection instrument)

1) after 20 μ l cell pyrolysis liquids being added into luminescent screen, background value 2s is read with GloMax bioluminescent detections instrument.

2) 100 μ l LAR II working solutions are added per sample, quick to mix, readings 2s.

3) after readings, 100 μ l Stop＆ are added per sampleReagent, after quick mixing, it is put into luminous In detector, readings 2s.

4) data are preserved.

2nd, using automatic luminous detector

1) Program pre-reading 2s, readings 10s, LAR II and Stop＆ are setThe each sample sizes of Reagent are 100 μ l.

2) the LAR II that will be prepared, Stop＆Reagent and the luminous tube or plate for having added cell pyrolysis liquid (taking 20 μ l per sample) is put into bioluminescent detection instrument.

3) operation program, fluorescent value is read.

4) after readings terminates, data are preserved.

2. result

2.1 sequencing result

Plasmid enzyme restriction, sequencing result, as described in Figure 7, wherein catastrophe point 191~197：TGGTGCT sports GAAGTTC, Catastrophe point 303~309：TGGTGCT sports GAAGTTC.

2.2 Analysis of test results

Fluc F

Renilla luciferase R

1) fold activity=(R/F) sample/(R/F) controls

Cell transfection assay group sets (every group of data set 3 multiple holes)

Remarks NC：Negative control, Mmu-miR-29a-3p：Mmu-miR-29a-3p mimics (have the sharp rich life in Guangzhou Thing Co., Ltd synthesizes)

2.3 experiment initial data are as follows

2.3.1 initial data after 293T cell transfectings

2.3.2 data are arranged

2.3.3 experimental result

2.3.4 data are mapped, that reference picture 6.

Relative luciferase activity (relative luciferase activity)；

Normal control (normal control, NC)；

Test result indicates that：MiR-29a-3p can suppress LRP6 gene expressions.

Sequence table

<110>Hong Kong University's Shenzhen hospital

<120>Use methods of the luciferase reporter gene detection LRP6 for miR-29a target gene

<130> PJ1710872.14

<160> 6

<170> SIPOSequenceListing 1.0

<210> 1

<211> 33

<212> DNA

<213>Artificial sequence " artificial sequence " (artificial sequence)

<400> 1

ccgctcgagc gagaaagttg agggagtggt ata 33

<210> 2

<211> 35

<212> DNA

<213>Artificial sequence (" ")

<400> 2

atttgcggcc gccaattcag ctgtttgtaa taatc 35

<210> 3

<211> 38

<212> DNA

<213>Artificial sequence (" ")

<400> 3

aagtgaagga tcgaagttcg cttttgctgt ttgtcctt 38

<210> 4

<211> 41

<212> DNA

<213>Artificial sequence (" ")

<400> 4

caaacagcaa aagcgaactt cgatccttca cttgcaacaa g 41

<210> 5

<211> 41

<212> DNA

<213>Artificial sequence (" ")

<400> 5

gactttggaa tgagaagttc ttgcaaggat gtatttatat t 41

<210> 6

<211> 40

<212> DNA

<213>Artificial sequence (" ")

<400> 6

tacatccttg caagaacttc tcattccaaa gtcgatgtac 40

Claims (2)

1. A kind of 1. method for using luciferase reporter gene detection LRP6 as miR-29a target gene, it is characterised in that institute The method stated includes the steps：

   (1) build plasmid vector and carry out point mutation：

   (1.1) reverse transcription is carried out after extracting RNA：

   RNA is added in PCR pipe, adds DEPC water, after piping and druming uniformly, 65 DEG C of insulation 5min is put, is denatured RNA, immediately ice Upper refrigeration, to prevent RNA renaturation；

   Following reagent is added in the PCR pipe：

   By above-mentioned 20 μ l reaction solutions, 30 DEG C of insulation 10min；42 DEG C of insulation 60min；72 DEG C of insulation 10mn.

   (1.2) pcr amplification reaction is carried out：

   Wherein, primer sequence is as follows：

   M-LRP6-F：CCGCTCGAGCGAGAAAGTTGAGGGAGTGGTATA

   M-LRP6-R：ATTTGCGGCCGCCAATTCAGCTGTTTGTAATAATC；

   Reaction system is as follows：

   Response procedures are as follows：

   95 DEG C of pre-degeneration 3min；95 DEG C of denaturation 30s；59 DEG C of annealing 30s；72 DEG C of extension 1min, 35 circulations, last 72 DEG C are prolonged again Stretch 5min；4 DEG C of preservations；

   PCR primer electrophoresis 30min under 120V voltage conditions with 2% Ago-Gel, detects the presence of specific purpose band；

   (1.3) purified pcr product；

   (1.4) wild type carrier is built：Double digestion purifying is carried out to carrier PsicheckTM-2Vector and PCR primer, then Conversion is attached, connection adds connection product into E.coli DH5 а competent cells after terminating, and will add connection product The centrifuge tube of competent cell be placed in heat shock 45s in 42 DEG C of water-bath, after be immediately placed on 2min on ice, during which not shake from Heart pipe, SOC culture mediums are added, after concussion and cultivate 1h, take bacterium solution to be applied to containing on ammonia benzyl mycin SOC plating mediums, 37 DEG C It is incubated overnight, plasmid is extracted after selecting the bacterium solution culture containing recon；

   Wherein per 10ul connection products and add into 100 μ L E.coli DH5 а competent cells；

   Connection product is added when competent cell just thaws, mixing is flicked, 30min is placed in ice；

   (1.5) rite-directed mutagenesis carrier is built：

   Rite-directed mutagenesis primer designs：TGGTGCT sports GAAGTTC, wherein：

   It is as follows to pinpoint primer sequence：

   LRP6-Mut1F：AAGTGAAGGATCGAAGTTCGCTTTTGCTGTTTGTCCTT

   LRP6-Mut1R:CAAACAGCAAAAGCGAACTTCGATCCTTCACTTGCAACAAG

   LRP6-Mut2F：GACTTTGGAATGAGAAGTTCTTGCAAGGATGTATTTATATT

   LRP6-Mut2R：TACATCCTTGCAAGAACTTCTCATTCCAAAGTCGATGTAC；

   Rite-directed mutagenesis reaction system is as follows：

   Fragment 1 expands：

   Fragment 2 expands

   Fragment 3 expands

   Rite-directed mutagenesis response procedures are as follows：95 degree of pre-degeneration 3min；95 DEG C of denaturation 40s；60 DEG C of annealing 1min；72 DEG C of extensions 1min, 35 circulations, last 72 DEG C re-extend 10min；4 DEG C of preservations；

   (2) double fluoroscopic examinations

   (2.1) cell transfecting is carried out with cationic-liposome method first；

   (2.2) luciferase detects, and carries out sample Luciferase Activity determinations using dual-luciferase reporter system, reads After value terminates, data are preserved；

   (2.3) interpretation of result, confirm that miR-29a-3p can suppress LRP6 gene expressions.
2. 2. a kind of as claimed in claim 1 use luciferase reporter gene to detect LRP6 as miR-29a target gene Method, it is characterised in that described competent cell is cultivated in the following way：

   1) culture of recipient bacterium

   The E.coli DH5 α single bacterium colonies newly activated from picking on solid SOC culture mediums, are inoculated in 3-5ml LB fluid nutrient mediums In, shaken cultivation 12 hours or so at 37 DEG C, until the logarithmic growth later stage：By the bacteria suspension with:100-1:50 ratio inoculation In 100ml LB fluid nutrient mediums, or so 37 DEG C of shaken cultivation 2-3 hours to OD600=0.5；

   2) nutrient solution is transferred in centrifuge tube, placed on ice 10 minutes, then 3000g is centrifuged 10 minutes at 4 DEG C；

   3) supernatant discarding, with the 0.05mol/L of precooling CaCl₂Solution 10ml gently suspension cells, 15-30 minutes are placed on ice Afterwards, 3000g is centrifuged 10 minutes at 4 DEG C；

   4) supernatant discarding, 0.05mol/L of the 4ml precoolings containing 15% glycerine CaCl2 solution is added, gently suspension cell, on ice Place a few minutes, competent cell suspension；

   5) competent cell is distributed into 200 μ l aliquot, stand-by in -70 DEG C of storages.