CN107858363A - A kind of anti-shearing Starch biosynthase recombination YXII and its application - Google Patents

Abstract

The invention discloses a kind of anti-shearing Starch biosynthase recombination YXII and its application, its nucleotide sequence such as SEQ ID NO:Shown in 1, separation obtains the glgC55 of ADP-glucose pyrophosphorylase encoding gene from the mutant strain of e. coli jm109 3, separates the Starch synthesis enzyme coding gene GBSSI promoters for obtaining ADP-glucose pyrophosphorylase AGPase small subunits encoding gene SSU cDNA and being combined with amylum body respectively from potato.Wherein, glgC55 encodes the AGPase subunits of 431 amino acid compositions, wherein there is specific mutagenesis at 4, they are K39E respectively, V71A, I248V and K304E, the above two are appeared in the Rossmann fold domains of oligomeric subunit N-terminal metabolism group, and rear both are appeared in the LbH groups of the regulation and control of oligomeric subunit C-terminal isomery and oligomerization.

Description

A kind of anti-shearing Starch biosynthase recombination YXII and its application

Technical field

The invention belongs to biomedicine technical field, and the invention discloses a kind of anti-shearing Starch biosynthase recombination YXII and its application.

Background technology

Starch is to be only second to cellulose, presently, there are one of the most universal, price is the cheapest luminous energy polymeric carrier；Form sediment Powder composition is single, is easy to storage, is widely used, is for building materials, weaving, papermaking and the essential industry of oil exploitation raw material, especially It is that the chemistry of its storage is readily susceptible to trans-utilization again, therefore, it is in the ascendant to re-recognize starch in strategic height.

Starch from vegetable seeds (such as rice, wheat and corn), stem tuber (such as potato) etc., because of food ingredients and The reasons such as starch property, farina are the raw materials of industry for accepting extensively and using；China potato producing region starch flour extraction (stem tuber amount needed for production per kilogram starch) is 1/ (7-8), and developed country is 1/ (3-4), and production efficiency is low, and its reason is China producing region content of starch is only 15%-18%.

Breeding is improvement or the Basic Ways for obtaining kind, and the principle of its foundation is the heredity original of Mendel and Morgan Reason, hybridization be realize character determine genetic recombination Basic Ways, American-European potato crossbreeding obtain current 80% with On the kind planted extensively, wherein, the content of starch for the kind of starch processing purpose is more than 20%.

In West Europe, Scotland agricultural sciences advisory organization official (Edinburg) is responsible for the European Potato Cultivars data safeguarded Storehouse, collect in storehouse and describe the Patents of crossbreeding acquisition kind in detail；HZPC, Jalving, Averis etc. are West Europe Main breeding companies, Potato Cultivars Agria, Desiree, Bintje, Lady Rosetta etc. of its breeding initiative are wide General cultivation.

The Russet series of products extensive uses cultivated by North America joint, resulting patent include Pat.No.5, 500,365,Pat.No.5,387,756,Pat.No.5,789,657,Pat.No.5,503,999,Pat.No.5,589,612, Pat.No.5,510,253,Pat.No.5,304,730,Pat.No.5,382,429,Pat.No.5,503,999,Pat.No.5, 648,249,Pat.No.5,312,912,Pat.No.5,498,533,Pat.No.5,276,268,Pat.No.4,900,676, Pat.No.5,633,434,Pat.No.4,970,168。

In recent years, in international market under the driving of starch great demand, the high quality starch such as high starch yield, high viscosity is even more The supreme arrogance of a person with great power, more than ten years in past, international chemical industry giant, such as Dutch Avbe and German BASF are numerous and confused to invest in starch quality improvement Breeding research, many breeding achievements are being achieved, wherein the representative potato for being that of obtaining genetic engineering improvement Kind Amflora.

Amylopectin content, by the starch of Amflora processing, only needs tradition more than 95% in Amflora tuber starch / 5th of farina dosage, you can reach same using effect；Under the pressure of the pressure of naturalist, European Union is for many years Genetically modified crops are planted in West Europe to resist always, but in view of the huge temptation of Amflora starch, BASF AG 2010 obtain European Union Authorize, ratify it and plant Amflora in Europe.

Starch is not only the composition of food needed for human survival, turns into power source by the alcohol fuel of Starch Production One of, therefore, starch is also the part of the energy needed for mankind's activity, in view of the thickness that people are expressed the energy that starch contains Hope, the following great demand to starch accumulates it is clear that plant amylum is significantly increased, and is in the past, today is even more facing mankind Key subjects.

Starch is made up of two class glucoside polymer, first, the straight chain that the linearly connected of glucose -1,4 accounts for the overwhelming majority forms sediment Powder, second, having the amylopectin of the branch of many places -1,6 connection in -1,4 connects chains；Directly participate in the main of the biosynthesis of starch Enzyme has：ADP-glucose pyrophosphorylase (AGPase.EC 2.7.7.27)), soluble starch synthase (SSS), with Amylosynthease (GBSS), Q-enzyrne (BE), the starch debranching enzyme (DBE) of amylum body combination.

Bacterium AGPase is that the AGPase of higher plant is the heterologous tetramer by the homotetramer of glgC gene codes (heterologous four subunit complex), two identical large subunits and two identical small subunits, small subunit (SS) exercise AGPase's Metabolic function, large subunit (LS) major regulatory AGPase activity, the isomery regulation and control of allosteric factor induction are the main tune of AGPase Control form.

The single subunits of bacterium AGPase homotetramers, the small subunit of the heterologous tetramers of plant AGPase are at it with oligomerization In the presence of body state, the metabolism group of its N-terminal exercises the function of ADP- glucose synthesis, i.e., using glucose 1-phosphate1- and ATP the bottom of as Thing, ADP- glucose is synthesized, ADP- glucose is-Isosorbide-5-Nitrae or -1, the substrate of 6 glucosides chain extensions.

AGPase subunits G336D mutation make its AGPase vigor improve 33% in e. coli k12 mutant strain 618, Under 35S promoter driving, express in 618 strains A GPase encoding gene glgC16 potato bodies, AGPase vigor and stem tuber form sediment Powder content improves more than 30%, and expression G336D is mutated in glgC cassava bodies, its AGPase vigor is improved 70%, root tuber starch Content improves more than 2 times.

Research it has been shown that plant AGPase small subunits with show activity in the presence of oligomeric forms, promote Starch synthesis, When forming intramolecular disulfide bond (dimer) between the 82nd cysteine of two small subunits, AGPase is inactivated, and suppresses Starch synthesis； The redox state of the 82nd cysteine of numerous allosteric Effects of Factors plant AGPase small subunits, make it sensitive to regulation and control.

Bacterium AGPase substitutes plant AGPase, has no that AGPase metabolism subunit dimers are formed, Starch synthesis is not suppressed System, this is also the reason for expression improves AGPase vigor in glgC16 potatos body.In plant AGPase encoding genes transcription, In AGPase vigor and Starch synthesis three, AGPase expressions and its activity level change elasticity are strong, improve plant AGPase vigor is the approach for increasing Starch biosynthase.

However, being found in further experiment, expressed with Patatin promoters driving glgC16 in potato body, though AGPase vigor in right transformation plant body is significantly increased, but tuber starch content and control are planted without significant difference, i.e. glgC16 Expression of results can not reproduce in object.Wherein possible cause includes glgC16 itself and promoter etc..

Research shows that glgC16 is expressed in potato body simultaneously, and its product AGPase expression quantity and its vigor are in line Property related, but Patatin promoters or the limit of 35S promoter driving glgC16 plant interior expression autogene copy numbers in the past System, can not realize the raising of AGPase expression quantity.

Stem tuber metabolic fluxes determination data shows that AGPase vigor is 0.55 to the control coefrficient of Starch synthesis；Antisense mRNA The Transformation of potato strain stem tuber fresh weight and dry-matter accumulation for suppressing AGPase vigor are reduced.Reducing AGPase vigor causes to store Tissue amylose is decreased obviously, the increase of short-chain branches starch accumulation, as a result not only confirms rate-limiting enzyme, and announcement is closed to starch Effect in.In addition to photoperiod triggering AGPase redox regulatory, arid is waited by AGPase to Starch synthesis Have an impact, the lower more sucrose of plant interior accumulation of arid, Starch synthesis significantly lowers.

The expression of differentiation analysis shows of the known small subunits of rice AGPase two and four large subunit isoform transcriptons, it is interior The isoform transcriptons of source size subunit are expressed with organ and differentiation of organelles, and large subunit OsAGPL2 is expressed in cytosol, Small subunit OsAGPS2a is expressed in blade, and small subunit OsAGPS2b is expressed in seed, and OsAGPL2 and OsAGPS2b mutation cause to form sediment Powder synthesis reduces and makes endosperm shrinkage；Small subunit OsAGPS1, large subunit OsAGPL1, OsAGPL3 and OsAGPL4 are in cytosome Interior expression.AGPase large subunits transcripton LS1and small subunit transcripton SS2 transcriptional expressions are reduced under the conditions of lens short-day, Transcripton SS1 expression increases.

AGPase is not only regulated and controled by factors such as arids, and photoperiod difference passes through redox regulatory AGPase subunits Bonding state, and the expression of differentiation of big small subunit transcripton；At present, just accumulated by its activity of AGPase autogenous controls and starch Tired identification and functional study stage still in big small subunit, but its sensitiveness to environment and metaboilic level determines that its is current The target gene of starch accumulation purpose can not still be turned into, be current stage feasible choosing with the endogenous AGPase of non-sensitive gene substitution Select.

The isoform of big small subunit is by multiple gene codes in endogenous AGPase composition, at present still in being identified to it and In the functional study stage, it is unsuitable for regulating and controlling starch accumulation with the isoform of big small subunit.

The content of the invention

The defects of it is an object of the invention to overcome above-mentioned technology to exist, the present invention provide a kind of anti-shearing starch biology and closed Into recombination and its application.

By agriculture bacillus mediated transgenic method, recombination is converted in potato body, by genome and transcription Group, AGPase enzyme activities and Phenotypic examination and screening, as a result show that the present invention possesses following characteristics, 1) recombination YXII contains Double copy glgC55, respectively by two GBSSI promoters driving expression；2) there is the SSU of 35S promoter driving in YXII MRNA structures, the structure can make plant inactivate the sensitive endogenous AGPase enzymes of regulation and control；3) YXII plant interior expressions, in stem tuber AGPase vigor improves 80%, 4 than control) YXII plant interior expressions, potato tubers content of starch can be made higher than control More than 30%, starch viscosity is higher than control more than 50%.

Its concrete technical scheme is：

A kind of anti-shearing Starch biosynthase recombination YXII, its nucleotide sequence such as SEQ ID NO:Shown in 1.

A kind of application of anti-shearing Starch biosynthase recombination during Starch biosynthase.

Compared with prior art, beneficial effects of the present invention are：

Although the expression quantity that glgC expresses generation AGPase in potato body is linearly related to its vigor, grind in the past Study carefully and limited by expression glgC gene copy numbers, hamper the further raising of AGPase expression quantity and activity；It is in addition, endogenous Big small subunit by multiple gene codes, to environment and metabolism adjust by the redox state for being especially metabolized subunit in AGPase compositions Control is sensitive；The present invention constructs the recombination being made up of double copy glgC and endogenous AGPase small ylidene genes antisense mRNA, Expression of results analysis display in recombination body, double copy glgC and small subunit antisense mRNA expression can effectively suppress quick to regulating and controlling Feel the expression of small ylidene gene, significantly improve AGPase expression quantity and its vigor.

Brief description of the drawings

Fig. 1 is anti-shearing Starch biosynthase recombination YXII schematic diagrames.

Embodiment

Technical scheme is described in more detail with specific embodiment below in conjunction with the accompanying drawings.

Present invention separation from the mutant strain of e. coli jm109-3 obtains ADP-glucose pyrophosphorylase volume GlgC55 (the GenBank of code gene:AY943834), separated respectively from potato and obtain adenosine diphosphate glucose pyrophosphoric acid Change enzyme AGPase small subunit encoding gene SSU cDNA (GenBank:DQ297414 the amylosynthease) and with amylum body combined Encoding gene GBSSI promoters.Wherein, glgC55 encodes the AGPase subunits (AAY18580) of 431 amino acid compositions, wherein There is specific mutagenesis at 4, they are K39E, V71A, I248V and K304E respectively, and the above two appear in oligomeric subunit N-terminal metabolism base In the Rossmann fold domains of group, rear both are appeared in the LbH groups of the regulation and control of oligomeric subunit C-terminal isomery and oligomerization.

The present invention uses glgC55, SSU cDNA and GBSSI promoters, constructs recombination YXII, and YXII is defined as Plant endogenous ADP-glucose pyrophosphorylase small subunit encoding gene SSU antisense mRNA structures are driven by 35S promoter Dynamic, the glgC55 at its both ends is driven by two GBSSI promoters respectively；The composition signal of YXII recombinations is as shown in Figure 1.

GlgC is obtained

E. coli jm109 genomic DNA is extracted according to Lee etc. method, using it as template, according to《Molecular cloning is real Test guide》P672-683 method, with glgC-F：5 '-gagttagccatggttagtttagag-3 ', glgC-R：5’- Aaagatctctgaacatacatg-3 ' are primer, 95 DEG C of pre-degeneration 4min, 95 DEG C denaturation 30sec, 53 DEG C annealing 45sec, Enter performing PCR, PCR productions under 72 DEG C of extension 1min, 30 circulations of reaction, last 72 DEG C of extensions 10min, 4 DEG C of reaction conditions preserved Thing purifying recovery (Promega；Wizard SV Gel and PCR Clean-Up System) after, with recovery product and pGEM- Carrier T (promega, pGEM-T Vector Systems, A1360) establishes coupled reaction, according to pGEM-T carrier specifications Method, connection product is converted into DH5 α (Takara companies) competent cell, the competent cell after conversion is spread evenly across On LB solid agar flat boards containing ampicillin, white colony is selected after 37 cultures 12 hours, is inoculated in containing ammonia benzyl mould In the LB liquid medium of element, shaken cultivation 12 hours.According to《Molecular Cloning:A Laboratory guide》P19-23 method, extract bacterium solution After DNA, fully washing, identify that it is pC-glgC to identify plasmid contained by correct monoclonal with NcoI and BglII double digestions, Expand culture recombinant bacterium containing pC-glgC, and purpose glgC in pC-glgC is sequenced, sequencing result is registered in GenBank, and it is noted Volume number is AY943834.

The acquisition of GBSSI promoters

According to《Molecular Cloning:A Laboratory guide》P672-683 method, CTAB methods extraction potato gene group DNA, and its For template, with PH-F：5 '-tccttccttttagcagtgtatcaat-3 ', PH-R：5’-gaacttgatctttgtgggt-3’ For primer, 95 DEG C of pre-degeneration 4min, 95 DEG C of denaturation 30sec, 53 DEG C of annealing 45sec, 72 DEG C of extension 1min, reactions 30 are set to follow Ring, last 72 DEG C of extensions 10min, the reaction condition of 4 DEG C of preservations enter performing PCR, PCR primer purifying recovery (Promega；Wizard SV Gel and PCR Clean-Up System) after, with recovery product and pGEM-T carriers (promega, pGEM-TVector Systems, A1360) coupled reaction is established, according to the method for pGEM-T carrier specifications, connection product is converted into DH5 α (Takara companies) competent cell, the competent cell after conversion is spread evenly across the LB solid agars containing ampicillin On flat board, white colony is selected after 37 cultures 12 hours, is inoculated in the LB liquid medium containing ampicillin, vibration training Support 12 hours.According to《Molecular Cloning:A Laboratory guide》P19-23 method, bacterium solution DNA is extracted, fully after washing,《Molecule Cloning experimentation guide》P237-259 method, identification is not cut with NcoI and BglII (Takara companies) are double, is identified correctly single Plasmid contained by clone is pG-GBSSIP, expands culture recombinant bacterium containing pG-GBSSIP, and purpose GBSSIP in pG-GBSSIP is surveyed Sequence, correct GBSSIP sequences are AY948720 in GenBank number of registrations.

Recombinate GBSSIP:GlgC is obtained

LB fluid nutrient mediums cultivate the Escherichia coli containing pG-GBSSIP and pC-0380 respectively, extract pG- respectively GBSSIP and pC-0380 plasmids, NcoI/PstI distinguish digestion by plasmid, purifying recovery GBSSIP and pC-0380；According to T4DNA The method of ligase (Takara company D2011A) specification, establishes coupled reaction, it is polyclonal that GBSSIP is connected into pC-0380 Between site NcoI and PstI；According to《Molecular Cloning:A Laboratory guide》P237-259 method, Hind III and BamHI digestion identification Whether connection is correct, obtains pC-GBSSIP.NcoI and BglII (Takara companies) digestion pG-glgC and pC-GBSSIP, purifying Reclaim glgC DNA fragmentations and pC-GBSSIP；According to the method for T4DNA ligases (Takara company D2011A) specification, build Vertical coupled reaction, the more downstreams of GBSSIP glgC being connected in pC-GBSSIP.HindIII and BamHI difference digestions, are obtained Whether about 1kb and about 1.2kb fragment, identification connection are correct；Secondly culture recombinant bacterium containing pC-Gpg is expanded, and in pC-Gpg Purpose GBSSIP:GlgC is sequenced, and the correct pC-Gpg of sequence is obtained, wherein including recombination GBSSIP:glgC.

Endogenous AGPase small subunits encoding gene SSU is obtained

According to RNA extracts kits (Amresco companies, K312-50RXN) specification, potato leaf total serum IgE is extracted, Using it as template, with primer APF：5 ' GCAATCACACTCTACCACA 3 ', APR：5’TTTTTTTTTGAGTAATTTATTT 3’ RT-PCR, PCR primer purifying recovery are completed with cDNA Synthesis kits (Takara companies, 6130) specification (Promega；Wizard SV Gel and PCR Clean-Up System) after, with recovery product and pGEM-T carriers (promega, pGEM-T Vector Systems, A1360) establishes coupled reaction, according to the method for pGEM-T carrier specifications, Connection product is converted into DH5 α (Takara companies) competent cell, the competent cell after conversion is spread evenly across benzyl containing ammonia On the LB solid agar flat boards of penicillin, white colony is selected after 37 cultures 12 hours, is inoculated in the liquid containing ampicillin In body LB culture mediums, shaken cultivation 12 hours.According to《Molecular Cloning:A Laboratory guide》P19-23 method, extract bacterium solution plasmid After DNA, fully washing, identify that it is pG-SSU to identify plasmid contained by correct monoclonal with PstI and NcoI double digestions, expand training Recombinant bacterium containing pG-SSU is supported, and purpose GBSSI in pG-SSU is sequenced, sequencing result is registered in GenBank, and its number of registration is DQ297414。

35S:Anti-SSU is obtained

LB fluid nutrient mediums cultivate the bacterial strain containing pG-SSU and pC-1305 respectively, extract plasmid pG-SSU and pC- respectively 1305, according to《Molecular Cloning:A Laboratory guide》P237-259 method, endonuclease reaction, NcoI and the double enzymes of SpeI difference are established respectively Cut pG-SSU and pC-1305, recovery purifying SSU and pC-1305 carrier purpose fragment, according to T4DNA ligases (Takara companies D2011A) the method for specification, coupled reaction is established, two fragments of connection obtain pC-SaS, respectively with EcoRI and HindIII enzymes It is correct to cut confirmation connection；Culture will be expanded containing the pC-SaS correctly connected, and purpose anti-SSU in pC-SaS is sequenced.

GBSSI:glgC::35S:anti-SSU

LB fluid nutrient mediums cultivate the bacterial strain containing pC-Gpg and pC-SaS respectively, extract pC-Gpg and pC-SaS matter respectively Grain DNA, according to《Molecular Cloning:A Laboratory guide》P237-259 method, with PstI/BamHI, PstI/BglII difference digestions pC- SaS and pC-Gpg, purifying recovery DNA fragmentation, according to the method for T4DNA ligases (Takara company D2011A) specification, builds Vertical coupled reaction, 35S promoter downstream is connected to by glgC；According to《Molecular Cloning:A Laboratory guide》P976-982 method, BamHI and PstI digestions are identified, subclone recombinant bacterial strain pC-SaS-Gpg are obtained, wherein including recombination GBSSI:glgC:: 35S:anti-SSU。

2×GBSSI:glgC::35S:anti-SSU

Using pC-Gpg vector plasmid DNAs template, with primer YXF:5 ' cacaggaaactagttatga3 ', YXR:5’ Agacacgcgtaataaagtaatc3 ' enters performing PCR, PCR primer and carrier pC-sas-Gpg through SpeI and MluI double digestions, returns Purified pcr product and vector backbone segment are received, according to the method for T4DNA ligases (Takara company D2011A) specification, is built Vertical coupled reaction, by recovery purifying PCR primer (GBSSI:GlgC) it is connected between pC-sas-GpgSpeI and MluI, according to《Point Sub- cloning experimentation guide》P976-982 method, BamHI and PstI digestions identification, subclone recombinant bacterial strain pYXI is obtained, wherein Include 2 × GBSSI of recombination:glgC::35S:anti-SSU.

Recombinate target gene Function detection

According to Visser etc. method, using potato aseptic seedling diameter 2-4mm stem sections as explant, with agriculture bacillus mediated way Footpath conversion target gene 35S:GlgC and GBSSIP:GlgC is in potato body；PCR positive transformants strains, by Southern Hybridize (Beijing Mei Laibo medical science and technologies Co., Ltd, method digoxigenin labeled kit, digoxin hybridization check kit) to obtain Single copy insertion strain, RT-PCR and Northern hybridization (Beijing Mei Laibo medical science and technologies Co., Ltd, the examination of method digoxigenin labeled Agent box, digoxin hybridization check kit) identify whether target gene transcribes, AGPase vigor is determined with Yao etc. method, is used Starch testing cassete (BioAssay companies, EnzyChrom Starch Assay Kit) determines stem tuber content of starch, stem tuber straight chain Content of starch is carried out according to Hovenkamp-Hermelink etc. method；The starch fully cleaned and dried, is made 4% (w/v) Suspension, according to 3mm (Shanghai Shen Yi glasswares Co., Ltd) capillary viscosimetry measure starch viscosity.

The methods of passing through PCR, realized under in vitro conditions by point mutation in glgC55 encoding proteins matter used in the present invention 4 mutation, obtain the same DNA sequence dnas of glgC55；In addition, the digestion connection described in present invention technical scheme obtains 35S:glgC::GBSSI:Anti-GBSSI recombinations, connected by other digestions unlike this, can also obtain restructuring base Because of 35S:GlgC and GBSSI:glgC.

The foregoing is only a preferred embodiment of the present invention, protection scope of the present invention not limited to this, any ripe Those skilled in the art are known in the technical scope of present disclosure, the letter for the technical scheme that can be become apparent to Altered or equivalence replacement are each fallen within protection scope of the present invention.

Sequence table

<110>Nanjing Gushan Mountain Bioisystech Co., Ltd

<120>A kind of anti-shearing Starch biosynthase recombination YXII and its application

<160> 1

<170> SIPOSequenceListing 1.0

<210> 1

<211> 7327

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 1

gatctctgaa catacatgta aaacctgcat tatcgctcct gtttatgccc taacttccgt 60

agcatttcgc gcgttaccag cacgatgcct tcttctgaac gatagaaacg acgtgcatct 120

tcctctgcgt tttcaccaat caccatgcct tccggaataa cacaagcacg atcgatgacg 180

cagcggcgca gacggcacga gcgacctacc catacttccg gtaacaatac ggcggaatca 240

atgttgcaga atgaattcac gcgaacgcgc gagaacagaa cggactgcac caccaccgaa 300

ccggagatca cacaaccgcc ggaaaccagt gagttaaggg tcatcccgtg gctaccggag 360

cgatcctgca cgaatttcgc tggcggtaat gattcattgt aggtgcgaat tggccaattg 420

cgatcgtaca tatccagttc cggcaccaca gaggccagat cgaggttcgc tttccagtaa 480

gcttccagcg tacccacatc gcgccagtac ggctcggcat ccgggtcgga ttgtacgcaa 540

gagagcggga acgggtgcgc ataggccaga ccggcttcgg tgaccttggg aatcaaatct 600

ttgccaaagt cgtggctgga gttctcatcg cgatcgtctt cttccagcag ttcatacaga 660

tagtcggcgt caaagacgta gatacccata ctcgccagag atttgctcgg atcgttcggc 720

attgacggcg ggttagcagg tttttcaacg aattcgataa ttttatcgtt ctcatcaacc 780

gccataacgc caaatgcgga ggcttcttca atcggtactg gcatacaagc aacggtgcaa 840

cgtgcgcctt tttcgacgtg atcgataagc atacgcgagt agtcttgctt gtagatatgg 900

tcgcccgcca ggatcaccac gtattccgct ttataacggc ggataatgtc gaggttttgg 960

gtgaccgcat ctgcggtgcc gcgataccag ttttcccctt tcattctctg ctgtgctggc 1020

agcagatcga caaactcgtt catttcttca ttgaagaatg accagccgcg ctgaatgtgc 1080

tgcaccagag tgtgggactg gtactgggtg atcgcgccca tacgacggat cccggagttg 1140

atgcagttag acagcgcaaa gtcgataatg cggaacttac cgccgaagtg tacggccggt 1200

tttgctcgct cattggttaa atccttcagg cgggtaccac gtcctcccgc cagtatcagg 1260

gcaacagatt tcaatggcag ctggcgcgcc aacattaagt gatcgttctt ctctaaacta 1320

accatggcgg ccgcgggaat tcgattaccc acaaagatca agttcactcc ctttccacaa 1380

acaatggtag ctgagcatcc aggtctcttg gtctcagttc tggatgccat cttgggtgtt 1440

accttagtat tagttcttga ttggagccca tcaagcttgt taacagccct taaaccattg 1500

tgagtcagag tatggttcct gagtcctatc tgtgacaagg ttgatttggt gtctagtgaa 1560

gtttggcttc ttgacacaaa gtggtgtgaa gctgtgatgc ttgccatgtg atgtgtcgtc 1620

tacaaaaagg ggaatctacc agagaataag ctacagatga acaagaacaa aacagaaatt 1680

gatttctgag aagaagaaga agaagaggaa gcattcacat ttatcaccga ttacacagta 1740

ggcaagagaa tcaaaatcag aatagatgat atgagatatg aaacaacgtt tatacaccat 1800

aacacgattc ataatagaat gtagggaaac atgcatgaga tcagaaataa ttagaggaga 1860

tgagtaaaag ttaccacttg ttgagctgtg tgagtgagtg agtgagtgag tgagtgtgag 1920

aatgaggagg tgcctgcctt attagtagca ggtttcagtg acacgtgtca agagaataac 1980

gggtggctat cccttagcgg aaggcaactg tggacactgt attataggga aatgctcatc 2040

gacagtattg tgggccctct ctttgttgat tcacggctgg acttcaactt gggccttgca 2100

atgggcccct ccggttctgt ctcctagtat ctaaaaagct aaaccaactc cctcctaccg 2160

ctaccacttg acattcctat gtctcgtgtt aattaaatta ttattatagt aataaaaaat 2220

aatatctaat gtactggtac tggtccctcc actagaattt tgttgcattt tttagtatta 2280

agattgagat gcatggttct attacaaaat tgatacactg caggcatgca agcttggcac 2340

tggccgtcgt tttacaacgt cgtgactggg aaaaccctgg cgttacccaa cttaatcgcc 2400

ttgcagcaca tccccctttc gccagctggc gtaatagcga agaggcccgc accgatcgcc 2460

cttcccaaca gttgcgcagc ctgaatggcg aatgctagag cagcttgagc ttggatcaga 2520

ttgtcgtttc ccgccttcag tttagcttca tggagtcaaa gattcaaata gaggacctaa 2580

cagaactcgc cgtaaagact ggcgaacagt tcatacagag tctcttacga ctcaatgaca 2640

agaagaaaat cttcgtcaac atggtggagc acgacacact tgtctactcc aaaaatatca 2700

aagatacagt ctcagaagac caaagggcaa ttgagacttt tcaacaaagg gtaatatccg 2760

gaaacctcct cggattccat tgcccagcta tctgtcactt tattgtgaag atagtggaaa 2820

aggaaggtgg ctcctacaaa tgccatcatt gcgataaagg aaaggccatc gttgaagatg 2880

cctctgccga cagtggtccc aaagatggac ccccacccac gaggagcatc gtggaaaaag 2940

aagacgttcc aaccacgtct tcaaagcaag tggattgatg tgatatctcc actgacgtaa 3000

gggatgacgc acaatcccac tatccttcgc aagacccttc ctctatncat aaggaagttc 3060

atttcatttg gagagaacac gggggactct tgaccatggc ggccgcggga attcgattat 3120

tctagacgaa taatttttac agcatccagt cttctcttgt aggggtaatg agaagtatca 3180

taacagaaag atgtacacta gatttctaca gctcaggaaa ataaaagttc agcacgtttc 3240

tacctcatgg ctgtttagcc aaaatcttgg aggacaacca agttaaaacg cattccttca 3300

gatgatgatt ccacttggaa tcaaagcatc cttgatgacg gtgacaatcc cactcttgat 3360

gaagtatcca tctgtttccc tagccgcttc ttgaacgttg tctttgttaa tgatcttcac 3420

attgtcccct atacgggcat tcttgtcgat aatggctctt ttaatgtgac aattcttgcc 3480

gatgccaatt gggacactgc cctttgcagc cagcaacttc ctgtcagcat cagtctcata 3540

gtaatctgcc cccatcaaaa gtgagtcttc tataattgct ccctctgata tgcatgatct 3600

gagtccaacc acggaatgat gaatcttaca gctcttgatc acacaacctt caccaatgac 3660

actatctgtg acatcagcat caagcatttt tgatggtggt agatatcgag gttgggtgta 3720

gattggggct gatcggtcgt aaaagctaaa atctggcacc ggcttttttg taatgcccaa 3780

attggcattg tagaaagctt caatggtacc aatatcttcc cagtacccat catataaata 3840

agcttgcact ctcatcccaa gtgaagttgc accaggaata acttcactac caaaatcatt 3900

ggccccaggg aacttgtcac gaagtaggct taacatcacg tctttgctaa tgacatatat 3960

acccatactg gcaatgaaag gcatttcttt agctctcttg tcatcaagac ctaaaatggt 4020

agtatccact ttcattgctt gcaattgctc tccttgcggt ttctctgcaa attcaataat 4080

gcgtccttct tcgtcaatct tcatgagacc gaatgcagtg gcacgcttct cgtccattgg 4140

cagtgcggca acggtaatat cagcatctgt ttctctgtgg gcttgaataa acttttcata 4200

atccattcga tacagatgat ctccagcaag tataaggtat tcaagaacag tatgctcctc 4260

aaacaaccac agatattgtc tgacagcatc agccgtgccc tggaaccaat cggggttctc 4320

tggactttgt tgagcagcaa gaacttccac aaagccctcg tttttgtatc ctcccatgtt 4380

gctagcatat gctcgtgaaa ggtggcgatt cagagaggca gagttgaatt gtgtgagaac 4440

atagatcttg gatatgttac tgttcaagca gttgcttaca ggaatgtcaa tcagacgata 4500

atttgctcca agtggaacag ctggctttgc tcttttttta gttagaggat aaagtcgggt 4560

cccagctcca cctccaagaa taattcccaa aacactccgg ctagcatctg ggtctagaca 4620

tgtctgtgaa ttctgcgaat cagaaacagc cttaggcggc acaatcaatg aacttcttct 4680

cacattgaat cggactcctt gggaacgtaa ggacgatata ggcatcaact tgtctccggc 4740

gagatgagaa gacgaaaatg agagatttct gctggatact gcacgtgtag aatcatttct 4800

tctctcattg atgcaattgt tagaagaagg tgaagatttt aaggctccaa tggaagccgc 4860

cattgttaac aaagcttgtt atcaactgat ctctctacta gagagtgtgt ggtagagtgt 4920

gattgcaatc actagtcaca ggaaacagct atgaccatga ttacgaattc gagctcggta 4980

cccggggatc ctctagagtc gacctgcagt gtatcaattt tgtaatagaa ccatgcatct 5040

caatcttaat actaaaaaat gcaacaaaat tctagtggag ggaccagtac cagtacatta 5100

gatattattt tttattacta taataataat ttaattaaca cgagacatag gaatgtcaag 5160

tggtagcggt aggagggagt tggtttagct ttttagatac taggagacag aaccggaggg 5220

gcccattgca aggcccaagt tgaagtccag ccgtgaatca acaaagagag ggcccacaat 5280

actgtcgatg agcatttccc tataatacag tgtccacagt tgccttccgc taagggatag 5340

ccacccgtta ttctcttgac acgtgtcact gaaacctgct actaataagg caggcacctc 5400

ctcattctca cactcactca ctcactcact cactcacaca gctcaacaag tggtaacttt 5460

tactcatctc ctctaattat ttctgatctc atgcatgttt ccctacattc tattatgaat 5520

cgtgttatgg tgtataaacg ttgtttcata tctcatatca tctattctga ttttgattct 5580

cttgcctact gtgtaatcgg tgataaatgt gaatgcttcc tcttcttctt cttcttctca 5640

gaaatcaatt tctgttttgt tcttgttcat ctgtagctta ttctctggta gattcccctt 5700

tttgtagacg acacatcaca tggcaagcat cacagcttca caccactttg tgtcaagaag 5760

ccaaacttca ctagacacca aatcaacctt gtcacagata ggactcagga accatactct 5820

gactcacaat ggtttaaggg ctgttaacaa gcttgatggg ctccaatcaa gaactaatac 5880

taaggtaaca cccaagatgg catccagaac tgagaccaag agacctggat gctcagctac 5940

cattgtttgt ggaaagggag tgaacttgat ctttgtgggt aatcgaattc ccgcggccgc 6000

catggttagt ttagagaaga acgatcactt aatgttggcg cgccagctgc cattgaaatc 6060

tgttgccctg atactggcgg gaggacgtgg tacccgcctg aaggatttaa ccaatgagcg 6120

agcaaaaccg gccgtacact tcggcggtaa gttccgcatt atcgactttg cgctgtctaa 6180

ctgcatcaac tccgggatcc gtcgtatggg cgcgatcacc cagtaccagt cccacactct 6240

ggtgcagcac attcagcgcg gctggtcatt cttcaatgaa gaaatgaacg agtttgtcga 6300

tctgctgcca gcacagcaga gaatgaaagg ggaaaactgg tatcgcggca ccgcagatgc 6360

ggtcacccaa aacctcgaca ttatccgccg ttataaagcg gaatacgtgg tgatcctggc 6420

gggcgaccat atctacaagc aagactactc gcgtatgctt atcgatcacg tcgaaaaagg 6480

cgcacgttgc accgttgctt gtatgccagt accgattgaa gaagcctccg catttggcgt 6540

tatggcggtt gatgagaacg ataaaattat cgaattcgtt gaaaaacctg ctaacccgcc 6600

gtcaatgccg aacgatccga gcaaatctct ggcgagtatg ggtatctacg tctttgacgc 6660

cgactatctg tatgaactgc tggaagaaga cgatcgcgat gagaactcca gccacgactt 6720

tggcaaagat ttgattccca aggtcaccga agccggtctg gcctatgcgc acccgttccc 6780

gctctcttgc gtacaatccg acccggatgc cgagccgtac tggcgcgatg tgggtacgct 6840

ggaagcttac tggaaagcga acctcgatct ggcctctgtg gtgccggaac tggatatgta 6900

cgatcgcaat tggccaattc gcacctacaa tgaatcatta ccgccagcga aattcgtgca 6960

ggatcgctcc ggtagccacg ggatgaccct taactcactg gtttccggcg gttgtgtgat 7020

ctccggttcg gtggtggtgc agtccgttct gttctcgcgc gttcgcgtga attcattctg 7080

caacattgat tccgccgtat tgttaccgga agtatgggta ggtcgctcgt gccgtctgcg 7140

ccgctgcgtc atcgatcgtg cttgtgttat tccggaaggc atggtgattg gtgaaaacgc 7200

agaggaagat gcacgtcgtt tctatcgttc agaagaaggc atcgtgctgg taacgcgcga 7260

aatgctacgg aagttagggc ataaacagga gcgataatgc aggttttaca tgtatgttca 7320

gagatct 7327

Claims (2)

1. A kind of 1. anti-shearing Starch biosynthase recombination YXII, it is characterised in that its nucleotide sequence such as SEQ ID NO:1 It is shown.
2. 2. the answering during Starch biosynthase of the anti-shearing Starch biosynthase recombination YXII described in claim 1 With.