CN1078494A - Protein compound, coding nucleotide sequence produces clone and its application - Google Patents
Protein compound, coding nucleotide sequence produces clone and its application Download PDFInfo
- Publication number
- CN1078494A CN1078494A CN 93104064 CN93104064A CN1078494A CN 1078494 A CN1078494 A CN 1078494A CN 93104064 CN93104064 CN 93104064 CN 93104064 A CN93104064 A CN 93104064A CN 1078494 A CN1078494 A CN 1078494A
- Authority
- CN
- China
- Prior art keywords
- cell
- clone
- compound
- epithelial tumor
- substratum
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
- C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
- C07K14/4702—Regulators; Modulating activity
- C07K14/4703—Inhibitors; Suppressors
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
Abstract
The present invention relates to a kind of proteinic composition that is essentially, said composition energy selectivity suppresses the division of the tumour cell of oestrogenic hormon sensitivity and/or can apply cytotoxic effect on said tumour cell.The present invention also relates to a kind of knurl is separated in people's fat can be cultivation splitted clone (this clone produces said composition) and relate to its in addition the substratum (having said composition to exist wherein) of condition control the invention still further relates to said product in diagnosis and various application clinically.
Description
The present invention relates to a kind of proteinic composition that is essentially, said composition energy selectivity suppresses the division of the tumour cell of oestrogenic hormon sensitivity and/or can apply cytotoxic effect to said tumour cell.The present invention also relates to a kind of from people's liposarcoma be separated to can be cultivation splitted clone (clone produces said composition in this culturing process) and the cultural method that is involved in this clone in the conditioned medium that wherein has described composition.
The invention still further relates to said product in diagnosis and application clinically.
Known in the state of the art a large amount of can be in the clone that is separated at first of growth in vitro from people's tumour.These clones aspect its physiological characteristics of research and the generation aspect of specific factor particularly useful.
Although a large amount of trials are arranged so far, but still do not find known clone in the prior art, do not find the clone that the known tumour that belongs to the liposarcoma class is separated to yet with phenotypic differentiation relevant with adipocyte (adipose cell or adipocytes).(there be limited evidence currently of is known the characteristic of this tissue, considers some function that adjacent tissue rises, and this tissue is considered to start to control make and uses) is then particularly useful if these cells come from matrix organization.In fact, the body inherence has in the mammary gland of hormone testosterone existence, lipocyte is induced epithelium degeneration [Kratochwill, K.Development and loss of androgen responsiveness in the emtryonic rudiment of thd mouse mammary gland.Dev.Biol 61: 358-365,1977], thereby effect (Paracrine action) by applying, one or more compound mediated [Kratochwill that this effect may be discharged by said lipocyte, K.1987, in cellular and Molecular Biology of Mammary Cancer one book (D.Medina, W.K.dweel, G.Heppner, e.E.Anderson, eds.pp 1-8 Plenum, New York].
Above-mentioned research specifically provides with the in-vitro separation of the clone of observed function in the energy perfect aspect and the required evidence of growth.
Author of the present invention is separated to for the first time and can divides in cultivation, has the clone of lipocyte phenotypic correlation phenotype, and explains its characteristic.Surprisingly, this clone produces at least a epithelial tumor cell splitted compound that can selectivity suppresses to come to epithelium (epithelila) tumour of oestrogenic hormon sensitivity in conditioned medium is main substratum.
" with lipocyte phenotypic correlation phenotype " speech is meant at least a manifestation as the synthetic distinctive differentiating characteristic of lipocyte of lipid." epithelial tumor cell " speech is meant the tumour cell that comes from epithelial tumor, and said cell is separated or still is present on the tumor mass." the responsive epithelial tumor of oestrogenic hormon " speech is meant by having the tumour that at least a cell that belongs to female hormone parahormone acceptor is formed." conditioned medium " speech is meant under the temperature, temperature and the PH condition that are suitable for the cell growth, cultivates at least 6 hours substratum of described cell therein." inhibition cell division capacity " is meant in said cell culture environment and cultivates that compound suppresses the ability that at least 50% cell is grown after at least 3 days in cultivation.
Therefore, the characteristic that can selectivity suppresses to come from these compounds of the epitheliomatous oncocyte splitted of estrogen-sensitive is distinguished and identified to significant need.
The document of recent publication [Proc.Natl.Acad.Sci.USA such as Mendelsohn M.E., 88,11212-11216, " heat-shocked " (" heat shock ") P27 people's albumen [HSD27 is disclosed 1991], by identification and sequencing such as Hickey E., Nucl.Acids Res., 14,10 4127-4145(1986)] has the 199aa aminoacid sequence, identical with the protein sequence relevant and be called P29[Coffer A.I. etc. with estrogen-receptor, Cancer Ressearch 45,3686-3693,1990].
[Carper S.W. etc. recently, Nucl.Acids Res.18,6457,1990] a kind of C DNA cloning that obtains from lung cancer A549 cell system is by sequencing, nucleotide sequence coded 205 amino acid whose protein of this clone, wherein 193 amino acid and known people HS at first
pThose amino acid of 27 are consistent just.Detect and inserted two cytosine(Cyt) residues with the password Z corresponding section of coding 194 bit amino sulphonate residues, it has determined to read sign indicating number (reading frame) and has shifted to the next termination codon Z place that is positioned at place, nucleotide sequence 6161-618 position, and this insertion causes HS
pThe modification of 27 protein Cs-terminal sequence makes last 5 amino acid differences (from 195 to 199) and shows to prolong 6 amino acid (from 200 to 205).
In the protein of the prior art of describing, there is not evidence to show wherein any inhibition activity that has tumour cell division.
From generation of LSA clone and excretory compound, the present inventor identifies a kind of compound, and identified its characteristic, its composition is actual in essence to be protein, can selectivity suppress the responsive tumour epithelial cell division of oestrogenic hormon, and can apply cytotoxic effect these tumour cells.The contriver has explained the biochemical characteristic of said compound, and it is called P1LSA, and has measured its aminoacid sequence, proves that it is made up of 205 amino acid.The contriver is surprised to find said aminoacid sequence, and ibid with Carper S.W(document except that a single amino acids) the people HS that measures
p27 protein sequences are identical.Not viewed not being both at 194 amino acids (arginine substituted prolines), by coded protein HS
p581 of 27 sequence sentence guanine and have replaced cytosine(Cyt) and determine.
Therefore, the contriver identifies a kind of new compound to the specific tool anti-tumor biological of the responsive epithelial tumor cell tool of oestrogenic hormon.
The contriver has discerned the nucleotide sequence of coded protein P1LSA, and has measured its aminoacid sequence.
Accordingly, an object of the present invention is a kind of compound, it is proteinic that its composition is actually in itself, and said compound can selectivity suppress the cell fission of the responsive epithelial tumor cell of oestrogenic hormon and/or can apply cellular cytoxicity activity to said tumour; The molecular weight ranges of said compound is 27 to 30 kilodaltons (KDa); Said compound also contains basically with coming from corresponding human protein HS
p27(heat-shocked p27) aminoacid sequence from 1 amino acids to 193 amino acids of sequence is related to a segment of the bioactive described compound of tool in other words.
" homologous aminoacid sequence basically " speech is meant 50% to the 100% homologous indication sequence that does not cause the protein loss of bioactivity within the scope of the invention." biological activity " speech is meant and can selectivity suppresses the ability that the estrogen-sensitive epithelial tumor cell divides (cell growth inhibiting activity) and/or said tumour cell applied cytotoxic effect.
According to embodiment preferred of the present invention, its composition is actual in itself to be that proteinic said compound contains a kind of aminoacid sequence that comes from following sequence basically together at its C-terminal:
GluAlaAlaLysSerAspGluThrAlaAlaLys-NH2
Preferred saidly be essentially proteinic compound and comprise following amino acid sequences:
MetThrGluArgArgValProPheSerLeuLeuArgGlyProSer 15
TrpAspProPheArgAspTrpTyrProHisSerArgLeuPheAsp 30
GlnAlaPheGlyLeuProArgLeuProGluGluTrpSerGlnTrp 45
LeuGlyGlySerSerTrpProGlyTyrValArgProLeuProPro 60
AlaAlaIleGluSerProAlaValAlaAlaProAlaTyrSerArg 75
AlaLeuSerArgGlnLeuSerSerGlyValSerGluIleArgHis 90
ThrAlaAspArgTrpArgValSerLeuAspValAsnHisPheAla 105
ProAspGluLeuThrValLysThrLysAspGlyValValGluIle 120
ThrGlyLysHisGluGluArgGlnAspGluHisGlyTyrIleSer 135
ArgCysPheThrArgLysTyrThrLeuProProGlyValAspPro 150
ThrGlnValSerSerSerLeuSerProGluGlyThrLeuThrVal 165
GluAlaProMetProLysLeuAlaThrGlnSerAsnGluIleThr 180
IleProValThrPheGluSerArgAlaGlnLeuGlyGlyArgGlu 195
AlaAlaLysSerAspGluThrAlaAlaLys 205.
According to a preferred version of the present invention, saidly be essentially proteinic compound and produce by LSA cell (DSM ACC.N.2029), preferably in substratum, secrete by said cell.
Another object of the present invention is as medicinal composition, is preferred for dirty tumour, more preferably is used for the treatment of the responsive epithelial tumor of oestrogenic hormon.Said composition contains the acceptable salt on proteinic compound or its physiology that is essentially of the present invention.
Another object of the present invention is the said medicinal compound that acceptable salt preparation on proteinic compound or its physiology is used for antineoplaston that is essentially of the present invention used according to the invention, is preferred for treating the estrogen-sensitive epithelial tumor.
Another object of the present invention is the nucleic acid that contains the nucleotide sequence of coding compound of the present invention (its composition is proteinic according to the present invention in essence).Preferred said nucleic acid comprises following nucleotide sequence:
ATGACCGAGCGCCGCGTCCCCTTCTCGCTCCTGCGGGGCCCCAGC 45
TGGGACCCCTTCCGCGACTGGTACCCGCATAGCCGCCTCTTCGAC 90
CAGGCCTTCGGGCTGCCCCGGCTGCCGGAGGAGTGGTCGCAGTGG 135
TTAGGCGGCAGCAGCTGGCCAGGCTACGTGCGCCCCCTGCCCCCC 180
GCCGCCATCGAGAGCCCCGCAGTGGCCGCGCCCGCCTACAGCCGC 225
GCGCTCAGCCGGCAACTCAGCAGCGGGGTCTCGGAGATCCGGCAC 270
ACTGCGGACCGCTGGCGCGTGTCCCTGGATGTCAACCACTTCGCC 315
CCGGACGAGCTGACGGTCAAGACCAAGGATGGCGTGGTGGAGATC 360
ACCGGTAAGCACGAGGAGCGGCAGGACGAGCATGGCTACATCTCC 405
CGGTGCTTCACGCGGAAATACACGCTGCCCCCCGGTGTGGACCCC 450
ACCCAAGTTTCCTCCTCCCTGTCCCCTGAGGGCACACTGACCGTG 495
GAGGCCCCCATGCCCAAGCTAGCCACGCAGTCCAACGAGATCACC 540
ATCCCAGTCACCTTCGAGTCGCGGGCCCAGCTTGGGGGCCGAGAA 585
GCTGCAAAATCCGATGAGACTGCCGCCAAGTAA 618
Another object of the present invention is to contain the plasmid or the phagotype carrier of nucleotide sequence of the present invention.
Another object of the present invention is and to have Mammalia clone with the relevant phenotype of lipocyte in external division, it also produces at least a energy selectivity and suppresses tumour cell division in its conditioned medium, preferred epithelial tumor cell more preferably comes from estrogen-sensitive epithelial tumor cell splitted compound.
According to a preferred version of the present invention, said clone is isolated from liposarcoma (preferably deriving from the people), and this clone more preferably is that to be deposited at the DSM registration number be 2029 LSA clone.Emphasize that again said clone produces the proteinic compound that is actually with above-mentioned open sequence according to the present invention.
Another object of the present invention is the substratum with the condition that is grown to of disclosed herein and claimed clone.
Preferred said conditioned medium comprises that at least a energy selectivity suppresses tumour cell (preferred epithelial tumor cell, more preferably come from the cell of the responsive epithelial tumor of oestrogenic hormon) the splitted compound, preferred said compound is a protein compound disclosed by the invention.
According to a preferred version of the present invention, said substratum is a condition with growth LSA clone (DSM ACC.N.2029).
Another object of the present invention is to use said conditioned medium to produce the pharmaceutical composition of treatment tumour (preferred epithelial tumor, the more preferably responsive tumour of oestrogenic hormon).
Another object of the present invention is to use said conditioned medium to purify, and differentiates and characterize at least aly can selectivity suppress tumour cell (preferred epithelial tumor cell more preferably comes from the cell of the responsive epithelial tumor of oestrogenic hormon) splitted compound.
The present invention will be disclosed with some embodiment, and these embodiment only are used for explaining and explanation the present invention, and not be used for limiting the present invention.Here accompanying drawing for reference has:
Accompanying drawing 1 expression LSA ties up to the growth curve under two kinds of situations that exist with serum-free;
Accompanying drawing 2a represents the cell fluorescence analytical results of people's normal thymus cell;
Accompanying drawing 2b represents the cell fluorescence analytical results of LSA cell;
Accompanying drawing 3 is illustrated in the various clones and mixes 3[H]-LSA-CM of thymidine stimulates bar graph.Wherein, the 1st, control sample, the 2nd, the LSA-CM when 1/4 dilution, the 3rd, the LSA-CM when 1/2 dilution, the 4th, the LSA-CM when undiluted, the 5th, control sample, the 6th, the LSA-CM when undiluted, the 7th, control sample, the 8th, the LSA-CM when undiluted;
Accompanying drawing 4 be illustrated in and two kinds of situations when not having LSA-CM and existing under the growth curve of MCF-7 clone;
Accompanying drawing 5 is illustrated in and the growth curve of ZR-75-1 clone under two kinds of situations when not having LSA-CM and existing;
Accompanying drawing 6 is illustrated in and the growth curve of MDAMB-231 clone under two kinds of situations when not having LSA-CM and existing;
Accompanying drawing 7 is illustrated in when having or not LSA-CM to exist the growth curve of NMNG clone under two kinds of situations;
The growth curve of people's cell that accompanying drawing 8 is illustrated in and obtains from ovary (ovaric) cancer under two kinds of situations when not having LSA-CM and existing;
Accompanying drawing 9 is illustrated in and the P1LSA that do not have LSA-CM and/or a purifying two kinds of situations when existing under the bar graph of the human cell growth that obtains from ovarian cancer.
Embodiment 1
The separation of LSA clone
Take out from 65 years old adult women's shank with the surgical operation of sterile manner and to be mixed into lipocyte-fibroblast-type people liposarcoma segment.
Segment is smashed to pieces with chisel (chisel) machinery, to obtain the 1mm fragment, the gained material is with being equivalent to 20 μ/ml collagenase (CLSP, Worthington, Regno Unito), 075mg/ml trypsin 1/300, Inc.Pharmaceuticals), the CTC solution-treated of 2% chicken serum is at 37 ℃ with constantly stir and tremble down at no Ca
2+And Mg
2+Ionic Hank substratum (Soil) (GIBCO) and contain the Ham F of 5% bovine serum
12Substratum (Soil) (GIBCO) in hot deactivation and saturating folding 4 hours, to obtain single-cell suspension liquid.
Cell suspending liquid is to be supplemented with the Ham F of 5% bovine serum (GIBCO), penicillin (31 μ g/ml), Streptomycin sulphate (50 μ g/ml) and amphotericin B (25 μ g/ml)
12(GIBCO) substratum dilution.Cell is layered on the plate that diameter is 100mm (Costar) with 200,000 cells/ware.
A kind of can in cultivation, divide and have the cell clone that is specific to the lipocyte characteristics from substratum, obtain, said clone is known as LSA, is deposited in DSM, preserving number is ACC 2029.
Accompanying drawing 1 illustrates the growth curve of LSA system, wherein have with serum-free in the presence of growth curve be tangible.LSA system shows 90% plate bedding rate (plating efficiency), and when having serum to exist, its doubling time is 50-52 hour, when serum-free exists, then is 102 hours, and substratum changed once in per 72 hours.
Embodiment 2
The characteristic statement of LSA system
The DNA inclusion of LSA cell is analyzed by cytofluorometer (Partec Pas II flow-cytometer).Cell is fixed through the Trypsin enzymolysis and with 70% ethanol, with containing 5 μ g/ml ethidium bromides, 12.5 μ g/ml Plicamycin and 15mg MgCl
2Solution-dyed in 0.1M Tris damping fluid (PH 7.5).Percentage of cells Flintoff in Mitotic circulates each step, W.E., Davidson, S.V. and Siminowitch, L. in " Isolation and partial Charcterization of Methotrexate-Resistent phenotype from Chinese hamster ovary cell " (Somatic cell Genet.2: 245-261 1976) literary composition and Ambesi-Impiom-bato, F.S., Parks, L.A.M. obtain with Coon H.G. disclosed method in " Culture of hormone-dependent functional epithelial cells from rat thyroid " (Proc.Natl.Acad.Sci.USA 77: 3455-3459,1980) literary composition.
Shown in accompanying drawing 2b, these values with compare as the value that the method for ploidy standard obtains with the normal human thymocyte cell.G with thymocyte
1-G
0Peak value is decided to be 1, under identical condition, and the G of LSA cell
1-G
0Peak value is 1.79, this means that the DNA inclusion almost is four times.Shown in accompanying drawing 2a, DNA inclusion/cell also almost is the twice that obtains with thymocyte.
Various stages of cell distribution situations in the cell cycle of the LSA of logarithmic phase cell mass are shown in tabulation 1 down.
Table 1
Stage cell per-cent
G
1-G
059
S 27
G
2/M 14
S stages of cell per-cent explanation cell mass is in active growth phase.
Chromosome counting proof chromosome number/cell is between 80 and 90.
When observing under opticmicroscope, the LSA cell looks to resemble and has abundant (abudant) cytoplasmic elongated body.And under electron microscope, find that then nucleus contains many kernels and is positioned at the organoid of distinguishing in nuclear week.The mutual homology of cell, plastosome is abundant relatively, tenuigenin bubble quantitatively with size on invariable.The most tangible characteristics are to have the vacuole zone in tenuigenin, this zone be electron reflection and be the typical case of high lipid content band, then they are removed under electron microscope, observing the result that cell is handled preparation.In addition, also there is a well-developed golgi body (Golgi).In order to estimate the content of fat, the LSA cell is taped against Lab-Teck(NUNC) cultivate on the inclined-plane, partly converging (Semi-confluence) growth down.After the cell flushing, with 4% Paraformaldehyde 96 with at PBS(phosphoric acid brine buffer solution) in 15% saturated picric acid fix 6 minutes, with distilled water flushing cell 2 times, use oil red O solution-dyed 5 minutes then, with PBS flushing twice, dyeed for 10 seconds again with 1% methylamine is blue.
If cell is grown in the presence of 5% bovine serum, lipoid is dispersed in the tenuigenin, becomes the bubble of garden shape.Then do not form lipoid in the cell of in serum free medium, growing, generated but after cultivating 48 hours again, then stimulate with methyl xanthine/desamethasone culturing cell 48 hours with Regular Insulin.
With LSA(SA-CM) be of the effect of the substratum of condition to different clone growth in vitro
The LSA cell is filling the F that contains 5% bovine serum
12After length is converged to 80% in the 100mm plate (Costar) of substratum,, use serum-free F with PBS washed cell individual layer
12Culture medium culturing.After 24 hours, replace former substratum, collected once in the every 6-24 of this conditioned medium hour, continue 30 days with fresh culture.The cell continued growth, after Trypan Blue (Trypan Bluc) dyeing, they structurally with on the function all show it is lived contrasting the microscopically observation.
With the LSA cell is the growth that the substratum of condition can stimulate normal epithelium cell, as CHO(CCL-61), FRTL-5(CRL-1468) and NIH-3T3(ECACC-87100803) 24 hours situation of growth under serum-free, as by
3The H-thymidine mixes (the seeing accompanying drawing 3) that test proves.Opposite with The above results, be the substratum of condition with the LSA cell, when usefulness contains the tumour cell analyzed in vitro of estrogen receptor, show the restraining effect of pair cell lytic activity growth.The cell that uses is:
MCF-7 cell (Land from the acquisition of human breast cancer, H. etc., Science 222: 778(1980), ECACC-86012803), this cell has estrogen receptor (Soule, H.O. etc., Natl.Cancer Inst.S1,1409-1413(1973)), androgen receptor (Horowity, K.B. etc., Steroids 26,785-795(1975)), Regular Insulin and triodothyronine acceptor (MacGrath, C.M.Cancer Res., 43: 1355-1360(1983));
ZK-75-1(CRL-1504 from the acquisition of human breast cancer) cell, said cell is positive to estrogen receptor.
MDAMB-231(ATCC-HTB26 from the acquisition of human breast cancer) cell, and it is negative to estrogen receptor.
From the NMMG(Burker that mouse breast epithelium obtains, R.E. etc., Cancer Res., 38: 3769-3773(1978), and CRL-1636) cell, said cell is the slight positive to estrogen receptor.
Shift ovarian cancer people's cell that the women of the peritoneal effusion cause obtains etc. from suffering from because of ovarian cancer.Said clone is positive to estrogen receptor.
The growth curve of the clone of mentioning here is that 100mm fills and has in 10% N of tire serum (FCS, 10ml DMEM(GIBCO GIBCO)) substratum and obtain by overlay on diameter by 100,000 cells/ware shop.There is 2ml LSA-CM to be added in each ware.
The growth curve of accompanying drawing 4 expression MCF-7 systems, wherein the restraining effect of LSA-CM is obvious.Particularly, after handling in 4 days, because the multiplication capacity that LSA-CM still can not recover the MCF-7 cell is again removed in the molten effect of born of the same parents.
Accompanying drawing 5 is illustrated in or does not have the growth curve of 7R-75-1 system under two kinds of situations that LSA-CM exists, and the existence of LSA-CM causes the effect of intensive growth-inhibiting, there is no the molten effect of any born of the same parents.
The growth curve of accompanying drawing 6 and 7 expression MDAMB-231 cells and normal epithelial NMMG cell, the growth-inhibiting effect of wherein obviously having no way of and causing in LSA-CM, such cell does not show estrogen receptor.
Accompanying drawing 8 shows that even after cultivating 24 hours, the LSA-CM conditioned medium has cytotoxic effect to Proliferation of Human Ovarian Cell.
LSA-CM is right in different clones
3The effect that the H-thymidine mixes is listed in the following table 2.
Table 2
LSA-CM is right in different clones
3The effect that H-thymus gland glycosides mixes
Clone does not have effect and activates inhibition
MCF 7 +
ZR-75-1 +
NMMG +
FRTL-S +
CHO +
NTH-3T3 +
LSA-CM is to the effect of animal
Selecting 20 Balb/c fc 3H mouse (Charles River) that are subjected to the Bittner virus infection that obvious tumor mass is arranged, is to suffer from oestrogenic hormon to rely on mastocarcinoma, itself is induced and is caused by virus.
Every day, peritoneal injection 200 μ l LSA-CM were after 15 days, observed in 80% the mouse through treating that tumor tissue growth is suppressed and downright bad.
Separate P1LSA protein from LSA-CM
The LSA-CM substratum concentrates 100 times, in the molten phosphate buffered saline buffer dialysis of 7.4 times equities of PH, goes up gel-filtration at P6 resin (Pharmacia) then.Elution fraction is used for the ability of test and Selection inhibition MCF-7 cell growth.Only a component shows said biological activity.With a sample of said component under non-sex change condition on polyacrylamide gel electrophoresis and separating, differentiate protein into a kind of about 29KDa, be called P1LSA.With said protein electroelution, be used for producing following said polyclonal antibody and be used for sequential analysis.
This protein sequence is as shown in table 3 below.
As shown in Figure 9, the P1LSA protein of purifying has the significant cytotoxicity effect to people's ovary cancer cell.
Table 3
P1LSA proteinic hydrogen base acid sequence and corresponding coding sequence
ATGACCGAGCGCCGCGTCCCCTTCTCGCTCCTGCGGGGCCCCAGC 45
TGGGACCCCTTCCGCGACTGGTACCCGCATAGCCGCCTCTTCGAC 90
TrpAspProPheArgAspTrpTyrProHisSerArgLeuPheAsp 30
CAGGCCTTCGGGCTGCCCCGGCTGCCGGAGGAGTGGTCGCAGTGG 135
GlnAlaPheGlyLeuProArgLeuProGluGluTrpSerGlnTrp 45
TTAGGCGGCAGCAGCTGGCCAGGCTACGTGCGCCCCCTGCCCCCC 180
LeuGlyGlySerSerTrpProGlyTyrValArgProLeuProPro 60
GCCGCCATCGAGAGCCCCGCAGTGGCCGCGCCCGCCTACAGCCGC 225
AlaAlaIleGluSerProAlaValAlaAlaProAlaTyrSerArg 75
GCGCTCAGCCGGCAACTCAGCAGCGGGGTCTCGGAGATCCGGCAC 270
AlaLeuSerArgGlnLeuSerSerGlyValSerGluIleArgHis 90
ACTGCGGACCGCTGGCGCGTGTCCCTGGATGTCAACCACTTCGCC 315
ThrAlaAspArgTrpArgValSerLeuAspValAsnHisPheAla 105
CCGGACGAGCTGACGGTCAAGACCAAGGATGGCGTGGTGGAGATC 360
ProAspGluLeuThrValLysThrLysAspGlyValValGluIle 120
ACCGGTAAGCACGAGGAGCGGCAGGACGAGCATGGCTACATCTCC 405
ThrGlyLysHisGluGluArgGlnAspGluHisGlyTyrIleSer 135
CGGTGCTTCACGCGGAAATACACGCTGCCCCCCGGTGTGGACCCC 450
ArgCysPheThrArgLysTyrThrLeuProProGlyValAspPro 150
ACCCAAGTTTCCTCCTCCCTGTCCCCTGAGGGCACACTGACCGTG 495
ThrGlnValSerSerSerLeuSerProGluGlyThrLeuThrVal 165
GAGGCCCCCATGCCCAAGCTAGCCACGCAGTCCAACGAGATCACC 540
GluAlaProMetProLysLeuAlaThrGlnSerAsnGluIleThr 180
ATCCCAGTCACCTTCGAGTCGCGGGCCCAGCTTGGGGGCCGAGAA 585
IleProValThrPheGluSerArgAlaGlnLeuGlyGlyArgGlu 195
GCTGCAAAATCCGATGAGACTGCCGCCAAGTAA 618
AlaAlaLysSerAspGluThrAlaAlaLys 205
By comparing with the sequence that is stored in the database, prove that this sequence is except that amino acid only, identical with the corresponding people HSp27 protein of being described by Carper S.W. above-mentioned, dissimilarity is the replacement of 194 amino acids, and said amino acid is by the arginine substituted prolines.
Anti--the production of P1LSA polyclonal antibody and inhibition of P1LSA protein active
To be dissolved in 1ml PBS(phosphoric acid brine buffer solution from 100 μ g P1LSA protein of wash-out on 10% polyacrylamide gel), and mix with the 1ml Freund.Every 10 days with mixture by the intramuscularly rabbit, totally four times.Every other day take out the 30ml immune serum in 20 days from rabbit.By manufacturer's explanation Mab Trap G(Pharmacia) purifying immunoglobulin (Ig) (Ig) part.
Immunoprecipitation and immunoblotting (immunoblotting) test shows that immunoglobulin (Ig) is with the P1LSA proteins react in a kind of ad hoc fashion and LSA-CM source.
37 ℃ down pre-cultivates the 100 μ l that have 10 μ l 1mg/ml Ig solution and can stop suppressing tumour epithelial cell (MCF-7) splitted activity in LSA-CM30 minute, returns to be similar to untreated control sample
3H-thymus gland mixes and growth curve, proves that cultivating back LSA-CM activity with pre-immune serum does not change.
These experimental datas show, separate and purifying by above embodiment 5 disclosed methods, and in fact the P1LSA protein with the disclosed sequence of table 3 play a major role to the said epithelial cell splitted of inhibition this paper activity.
Embodiment 7
The proteic nucleotide sequence of coding P1LSA
The proteinic nucleotide sequence of coding P1LSA is by the RNA poly A that purifies from the LSA cell by standard method
+, use following primer to carry out PCR and react and measure:
Oligo 5'：GGGAATTCTGAGCAGACGTCCAGAG
ECORI
Oligo 3'：CGGAATTCCGGGCTAAGGCTTTACTTG
ECORI
This two sequence is not translated the sequence of coding HSp27 gene respectively and is inferred from 5' and 3' position.
Amplified production is at carrier pGEM4Z(Promega) the EcorI site directly cloned, and with two deoxidation (dideoxy) methods order-checkings.The sufficient sequence of coded protein is shown in table 3.
The present invention to be being disclosed in conjunction with its preferred version, but needs to understand, the modification of being done by those skilled in the art and change and do not deviate from the spirit and scope of the present invention.
Claims (28)
1, a kind ofly is essentially proteinic compound, it is characterized in that its can selectivity suppress the cell fission of the responsive epithelial tumor cell of oestrogenic hormon and/or can apply cytotoxic effect on said tumour cell; Its molecular weight ranges is between 27 to 30KDa, contains the aminoacid sequence of and people HSp27 (heat-shocked p27) protein homology basic from 1 amino acids to 193 amino acids; Or a kind of biological activity segment of said compound.
2, a kind of proteinic compound that is essentially as claimed in claim 1, said compound contains one and following amino acid sequences homologous aminoacid sequence at its C-terminal:
GluAlaAlaLysSerAspGluThrAlaAlaLys-NH
2
3, a kind of proteinic compound that is essentially as claimed in claim 2, this compound contain a basic and following amino acid sequences homologous aminoacid sequence:
MetThrGluArgArgValProPheSerLeuLeuArgGlyProSer 15
TrpAspProPheArgAspTrpTyrProHisSerArgLeuPheAsp 30
GlnAlaPheGlyLeuProArgLeuProGluGluTrpSerGlnTrp 45
LeuGlyGlySerSerTrpProGlyTyrValArgProLeuProPro 60
AlaAlaIleGluSerProAlaValAlaAlaProAlaTyrSerArg 75
AlaLeuSerArgGlnLeuSerSerGlyValSerGluIleArgHis 90
ThrAlaAspArgTrpArgValSerLeuAspValAsnHisPheAla 105
ProAspGluLeuThrValLysThrLysAspGlyValValGluIle 120
ThrGlyLysHisGluGluArgGlnAspGluHisGlyTyrIleSer 135
ArgCysPheThrArgLysTyrThrLeuProProGlyValAspPro 150
ThrGlnValSerSerSerLeuSerProGluGlyThrLouThrVal 165
GluAlaProMetProLysLeuAlaThrGlnSerAsnGluIleThr 180
IleProValThrPheGluSerArgAlaGlnLeuGlyGlyArgGlu 195
AlaAlaLysSerAspGluThrAlaAlaLys 205.
4, as among the claim 1-3 any one be essentially proteinic compound, it is produced by LSA cell (DSM ACC.N.2029), this compound is preferably secreted in substratum by said cell.
5, a kind of medicinal compositions, preferred antitumor usefulness comprises the proteinic compound of being essentially of one of above any claim or its physiologically acceptable salt.
6, composition as claimed in claim 5 is used for treating the estrogen-sensitive epithelial tumor.
7, a kind of purposes that is essentially acceptable salt on proteinic compound or its physiology of one of above claim is used to prepare the composition for the treatment of tumour, preferred therapeutic estrogen-sensitive epithelial tumor.
8, a kind of nucleic acid, it contains any one said nucleotide sequence that is essentially proteinic compound in the requirement of coding aforesaid right.
9, nucleic acid as claimed in claim 8, contain following nucleotide sequences:
ATGACCGAGCGCCGCGTCCCCTTCTCGCTCCTGCGGGGCCCCAGC 45
TGGGACCCCTTCCGCGACTGGTACCCGCATAGCCGCCTCTTCGAC 90
CAGGCCTTCGGGCTGCCCCGGCTGCCGGAGGAGTGGTCGCAGTGG 135
TTAGGCGGCAGCAGCTGGCCAGGCTACGTGCGCCCCCTGCCCCCC 180
GCCGCCATCGAGAGCCCCGCAGTGGCCGCGCCCGCCTACAGCCGC 225
GCGCTCAGCCGGCAACTCAGCAGCGGGGTCTCGGAGATCCGGCAC 270
ACTGCGGACCGCTGGCGCGTGTCCCTGGATGTCAACCACTTCGCC 315
CCGGACGAGCTGACGGTCAAGACCAAGGATGGCGTGGTGGAGATC 360
ACCGGTAAGCACGAGGAGCGGCACGACGAGCATCCCTACATCTCC 405
CGGTGCTTCACGCGGAAATACACGCTGCCCCCCGGTGTGGACCCC 450
ACCCAAGTTTCCTCCTCCCTGTCCCCTGAGGGCACACTGACCGTG 495
GAGGCCCCCATGCCCAAGCTAGCCACGCAGTCCAACGAGATCACC 540
ATCCCAGTCACCTTCGAGTCGCGGGCCCAGCTTGGGGGCCGAGAA 585
GCTGCAAAATCCGATGAGACTGCCGCCAAGTAA 618
10, the plasmid or the phagotype carrier that contain one of claim 8 or 9 described nucleotide sequence.
11, a kind of Mammalia clone can be in external division, and has relevant phenotype with lipocyte, and it produces one of at least a claim 1-4 in its substratum or conditioned medium described, can selectivity suppresses the compound of tumour cell division.
12, as the Mammalia clone of claim 10, wherein said tumour cell comprises epithelial tumor cell.
13, as the Mammalia clone of claim 12, wherein said epithelial tumor cell comes from the estrogen-sensitive epithelial tumor.
14, as the Mammalia clone of one of claim 1-13, can have with two kinds of situations of serum free medium under external division.
15, as the Mammalia clone one of among the claim 11-14, wherein said clone is isolated from people's liposarcoma.
16, as the Mammalia clone of claim 15, wherein said clone is isolated from people's liposarcoma.
17, as the Mammalia clone of claim 16, wherein said clone is LSA system (DSM ACC.N.2029).
18, a kind of substratum is being condition according to the said cell line growth of one of claim 11-17.
19, according to the substratum of claim 18 applying condition, said substratum contains the compound that at least a energy selectivity suppresses tumour cell division.
20, according to the substratum of claim 19 applying condition, wherein said tumour cell is an epithelial tumor cell.
21, according to the substratum of claim 20 applying condition, wherein said epithelial tumor cell comes from the estrogen-sensitive epithelial tumor.
22, according to the substratum of claim 21 applying condition, wherein said clone is LSA clone (DSM ACC.N.2029).
23,, be used for the pharmaceutical composition of production for treating tumour according to the purposes of the conditioned medium one of among the claim 18-22.
24, according to the purposes of the conditioned medium of claim 23, wherein said tumour is an epithelial tumor.
25, according to the purposes of the conditioned medium of claim 24, wherein said epithelial tumor is an estrogen-sensitive.
26,, be used to purify, differentiate and characterize the compound that at least a energy selectivity suppresses tumour cell division according to the purposes of the conditioned medium among the claim 18-22.
27, according to the purposes of the conditioned medium of claim 26, wherein said cell comes from the estrogen-sensitive epithelial tumor.
28, according to the purposes of the conditioned medium of claim 27, wherein said cell comes from the estrogen-sensitive epithelial tumor.
Applications Claiming Priority (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| ITRM920161A IT1255038B (en) | 1992-03-09 | 1992-03-09 | Mammal cell line and conditioned culture medium |
| IT92-A/000161 | 1992-03-09 | ||
| IT92-A000716 | 1992-09-30 | ||
| IT000716 IT1262997B (en) | 1992-09-30 | 1992-09-30 | New protein homologous to human heat shock P27 protein - is obtd. from liposarcoma cells, used for treating oestrogen-dependent epithelial tumours |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN1078494A true CN1078494A (en) | 1993-11-17 |
Family
ID=26332011
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 93104064 Withdrawn CN1078494A (en) | 1992-03-09 | 1993-03-09 | Protein compound, coding nucleotide sequence produces clone and its application |
Country Status (7)
| Country | Link |
|---|---|
| EP (1) | EP0630404A1 (en) |
| KR (1) | KR950700412A (en) |
| CN (1) | CN1078494A (en) |
| CA (1) | CA2130089A1 (en) |
| FI (1) | FI944102A (en) |
| HU (1) | HUT70972A (en) |
| WO (1) | WO1993018147A1 (en) |
Families Citing this family (19)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5744155A (en) * | 1993-08-13 | 1998-04-28 | Friedman; Doron | Bioadhesive emulsion preparations for enhanced drug delivery |
| US5750119A (en) * | 1994-01-13 | 1998-05-12 | Mount Sinai School Of Medicine Of The City University Of New York | Immunotherapeutic stress protein-peptide complexes against cancer |
| US5997873A (en) * | 1994-01-13 | 1999-12-07 | Mount Sinai School Of Medicine Of The City University Of New York | Method of preparation of heat shock protein 70-peptide complexes |
| US5961979A (en) * | 1994-03-16 | 1999-10-05 | Mount Sinai School Of Medicine Of The City University Of New York | Stress protein-peptide complexes as prophylactic and therapeutic vaccines against intracellular pathogens |
| US5985270A (en) * | 1995-09-13 | 1999-11-16 | Fordham University | Adoptive immunotherapy using macrophages sensitized with heat shock protein-epitope complexes |
| US5935576A (en) | 1995-09-13 | 1999-08-10 | Fordham University | Compositions and methods for the treatment and prevention of neoplastic diseases using heat shock proteins complexed with exogenous antigens |
| US5837251A (en) * | 1995-09-13 | 1998-11-17 | Fordham University | Compositions and methods using complexes of heat shock proteins and antigenic molecules for the treatment and prevention of neoplastic diseases |
| US5830464A (en) | 1997-02-07 | 1998-11-03 | Fordham University | Compositions and methods for the treatment and growth inhibition of cancer using heat shock/stress protein-peptide complexes in combination with adoptive immunotherapy |
| US6017540A (en) | 1997-02-07 | 2000-01-25 | Fordham University | Prevention and treatment of primary and metastatic neoplastic diseases and infectious diseases with heat shock/stress protein-peptide complexes |
| US5948646A (en) | 1997-12-11 | 1999-09-07 | Fordham University | Methods for preparation of vaccines against cancer comprising heat shock protein-peptide complexes |
| ES2439014T3 (en) | 1998-02-20 | 2014-01-21 | The University Of Miami | Complex of antigenic peptide-modified heat shock protein |
| US7449557B2 (en) | 2000-06-02 | 2008-11-11 | University Of Connecticut Health Center | Complexes of alpha (2) macroglobulin and antigenic molecules for immunotherapy |
| KR20040064688A (en) | 2001-08-20 | 2004-07-19 | 유니버시티 오브 코네티컷 헬스 센터 | Methods for preparing compostions comprising heat shock proteins or alpha-2-macroglobulin useful for the treatment of cancer and infectious disease |
| ITMI20020404A1 (en) * | 2002-02-28 | 2003-08-28 | Ist Naz Stud Cura Dei Tumori | NEW MANGANESE SUPEROXIDE HUMAN DISMUTATION |
| WO2009114085A2 (en) | 2008-03-03 | 2009-09-17 | The University Of Miami | Allogeneic cancer cell-based immunotherapy |
| JP2011515399A (en) | 2008-03-20 | 2011-05-19 | ユニバーシティー オブ マイアミ | Heat shock protein GP96 vaccination and method using the same |
| AU2016215175B2 (en) | 2015-02-06 | 2021-09-16 | Heat Biologics, Inc. | Vector co-expressing vaccine and costimulatory molecules |
| US11666649B2 (en) | 2016-10-11 | 2023-06-06 | University Of Miami | Vectors and vaccine cells for immunity against Zika virus |
| WO2018187260A1 (en) | 2017-04-04 | 2018-10-11 | Heat Biologics, Inc. | Intratumoral vaccination |
-
1993
- 1993-03-08 EP EP93906779A patent/EP0630404A1/en not_active Withdrawn
- 1993-03-08 HU HU9402317A patent/HUT70972A/en unknown
- 1993-03-08 WO PCT/IT1993/000020 patent/WO1993018147A1/en not_active Application Discontinuation
- 1993-03-08 CA CA002130089A patent/CA2130089A1/en not_active Abandoned
- 1993-03-09 CN CN 93104064 patent/CN1078494A/en not_active Withdrawn
-
1994
- 1994-09-01 KR KR1019940703052A patent/KR950700412A/en not_active Application Discontinuation
- 1994-09-07 FI FI944102A patent/FI944102A/en not_active Application Discontinuation
Also Published As
| Publication number | Publication date |
|---|---|
| EP0630404A1 (en) | 1994-12-28 |
| CA2130089A1 (en) | 1993-09-16 |
| HU9402317D0 (en) | 1994-10-28 |
| FI944102A0 (en) | 1994-09-07 |
| WO1993018147A1 (en) | 1993-09-16 |
| HUT70972A (en) | 1995-11-28 |
| KR950700412A (en) | 1995-01-16 |
| FI944102A (en) | 1994-09-07 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN1078494A (en) | Protein compound, coding nucleotide sequence produces clone and its application | |
| CN1191491A (en) | Connective tissue growth factor | |
| CN1113518A (en) | A novel peptide related to human programmed cell death and DNA encoding it | |
| CN1058782A (en) | Last hide collagen (Epithclins): the new growth regulator matter that is rich in halfcystine | |
| CN1284134A (en) | Methods of producing anti-angiogenic proteins: endostation, angiostation or restin, using pichia yeast expression system | |
| CN1328567A (en) | Mammaglobin, a secreted mammary-specific breast cancer protein | |
| CN1075148A (en) | New megalokaryocyte amplification gene | |
| CN1216909C (en) | Human cervical cancer suppressor protein, polynucleotide encoding the protein cell transformed with the polynucleotide and method | |
| CN1753909A (en) | Peptides and pharmaceutical compositions comprising said peptides and medical composition for treating cancer | |
| CN1910195A (en) | Uses of spatial configuration to modulate protein function | |
| CN1297916A (en) | Human bromo structure domain-containing protein 95 as one new kind of polypeptide and polynucleotides encoding this polypeptide | |
| CN1635849A (en) | Bone anti-resorptive compounds | |
| CN1190491C (en) | PRV-1 gene and the use thereof | |
| CN1506375A (en) | Azurin as bacterial protein with wide-spectrum antitumor function and its use and medicinal composition | |
| CN1216910C (en) | Novel liver regeneration related protein, its code sequence and application | |
| CN1055389A (en) | Has active new protein of oncostatin M and preparation method thereof | |
| CN1082091C (en) | Recombination human tumour necrofactor and preparation method | |
| CN1084888A (en) | By the dimerization IL-2 of enzymatic reaction preparation and the neural trans-glutaminases that comes from that is used to prepare this IL-2 | |
| CN1111910A (en) | Mammamodulin, a hormone-independent mammary tumor cells specific protein | |
| CN1385441A (en) | Novel human lymphokine, its coding sequence and use | |
| JPH07501695A (en) | IFN-gamma-antagonist cytokine | |
| CN1406982A (en) | Polypeptide-human protein containing transferring growth factor family characteristic sequential fragments-12.87 and polynucleotide for encoding it | |
| CN1388132A (en) | Cell death inducing protein and its coding sequence and use | |
| CN101028522A (en) | Function and use of MNSF-beta gene during process of embryo nidation | |
| CN1600789A (en) | Promotive factor for activating NF-kappa B and usage |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C03 | Withdrawal of patent application (patent law 1993) | ||
| WW01 | Invention patent application withdrawn after publication |