CN107828823A - A kind of method of evaluation EML4 ALK inhibitor to lung cancer therapy effect - Google Patents
A kind of method of evaluation EML4 ALK inhibitor to lung cancer therapy effect Download PDFInfo
- Publication number
- CN107828823A CN107828823A CN201710903091.3A CN201710903091A CN107828823A CN 107828823 A CN107828823 A CN 107828823A CN 201710903091 A CN201710903091 A CN 201710903091A CN 107828823 A CN107828823 A CN 107828823A
- Authority
- CN
- China
- Prior art keywords
- mouse
- eml4
- alk
- lung cancer
- mrosa
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
- C12N15/90—Stable introduction of foreign DNA into chromosome
- C12N15/902—Stable introduction of foreign DNA into chromosome using homologous recombination
- C12N15/907—Stable introduction of foreign DNA into chromosome using homologous recombination in mammalian cells
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; CARE OF BIRDS, FISHES, INSECTS; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K67/00—Rearing or breeding animals, not otherwise provided for; New breeds of animals
- A01K67/027—New breeds of vertebrates
- A01K67/0275—Genetically modified vertebrates, e.g. transgenic
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K49/00—Preparations for testing in vivo
- A61K49/0004—Screening or testing of compounds for diagnosis of disorders, assessment of conditions, e.g. renal clearance, gastric emptying, testing for diabetes, allergy, rheuma, pancreas functions
- A61K49/0008—Screening agents using (non-human) animal models or transgenic animal models or chimeric hosts, e.g. Alzheimer disease animal model, transgenic model for heart failure
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
- C12N9/22—Ribonucleases RNAses, DNAses
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; CARE OF BIRDS, FISHES, INSECTS; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2227/00—Animals characterised by species
- A01K2227/10—Mammal
- A01K2227/105—Murine
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; CARE OF BIRDS, FISHES, INSECTS; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2267/00—Animals characterised by purpose
- A01K2267/03—Animal model, e.g. for test or diseases
- A01K2267/0331—Animal model for proliferative diseases
Abstract
The invention discloses a kind of method for evaluating the lung cancer therapy effect that medicine drives to EML4 ALK L1196M oncogenes, this method is to build the mROSA genetic fragments of 5 ' mROSA CAG lox stop lox EML4 ALK L1196M 3 ' in vitro, then by the genetic fragment and cas9 enzymes and gRNA co-injections into the embryo of mouse, the mouse containing homologous recombination gene is identified after mouse birth, treat that mouse is developed to adult, activate EML4 ALK L1196M oncogenes, the primary tumor of lung cancer will be induced, then to mouse drug treatment, therapeutic effect is evaluated.The evaluation method of the present invention can truly simulate the clinical process of lung cancer, and performance of the medicine in lung cancer clinical can be predicted exactly using the mouse model of the present invention:The acute toxicity of accurate evaluation medicine, chronic toxicity, pharmacokinetics, the therapeutic effect to lung cancer.
Description
Technical field
The invention belongs to biomedicine field, and in particular to one kind evaluation medicine drives to EML4-ALK L1196M oncogenes
The method of dynamic lung cancer therapy effect.
Background technology
Lung cancer is the incidence of disease and fatal rate highest cancer in global range.Lung cancer is divided into ED-SCLC and non-small cell
Lung cancer.Non-small cell lung cancer is divided into gland cancer, squamous carcinoma and large cell carcinoma by histological type again.Being of conventional treatments of lung cancer
Treat, but it is limited the effect of chemotherapy, and have larger side effect.
In recent years, targeted therapies illustrate good clinical manifestation in lung cancer therapy.The theory of targeted therapy
Basis is:The existence of lung carcinoma cell depends on a specific protein constantly perform function, rather than cancerous lung tissue cell then to disobey
Rely;With the inhibitor for treating patient of the albumen, the death of lung carcinoma cell can be caused, and other cells are then unaffected.Therefore, target
There is the characteristics of high efficiency, low side effect to treatment.
EML4-ALK fusion oncogenes are positive in about 5% lung cancer in China patient.Clinically use EML4-ALK suppression
Preparation can effectively treat the lung cancer of the gene masculine (as gram azoles replaces Buddhist nun).But the lung cancer of these patients is after of short duration regression
It can recur again.One major reason of recurrence is that EML4-ALK fusions are mutated in itself, causes medicine to press down again
EML4-ALK processed Kinase activity.L1196M is mutation of the clinically common anti-gram azoles for the EML4-ALK of Buddhist nun's medicine.Exploitation
The EML4-ALK of anti-L1196M mutation medicine is a focus of current research field, also has some medicines doing clinical examination
Test or granted applied to clinic.
At present, two classes can be probably divided into by evaluating the method for the EML4-ALK of L1196M mutation inhibitor for treating lung cancer:
Cell model and Transplanted tumor model.Now with some lung carcinoma cells or the laborious transferring cell formed, its survival depends on EML4-
The lasting function of ALK L1196M mutant.The function of the cancer protein is closed with inhibitor will cause Apoptosis.Measure is withered
Die the ability that seriousness can reflect the inhibitor for treating lung cancer.It is this that drug therapy EML4-ALK is determined directly on cell
The method of L1196M effects, there is the shortcomings that its is intrinsic:Performance of the medicine on live body can not be reflected, such as acute toxicity is chronic
Toxicity, pharmacokinetics etc..
Another method is that above-mentioned cell is transplanted on the mouse of immune deficiency, after mouse grows transplantable tumor, medication
Thing treats mouse, measures the Volume Changes of tumour to infer the therapeutic effect of medicine.The shortcomings that model is:The transplantable tumor of inoculation
The microenvironment of real simulation lung cancer generation is unable to, while immune system plays an important role in tumor therapeutic procedure.Therefore,
The probability for having comparison high to evaluate the ability of drug therapy lung cancer with the transplantable tumor of immune deficiency is judged by accident:I.e. medicine is being transplanted
On knurl model effectively, do not imitate clinically.
The content of the invention
The defects of in order to overcome prior art, it is an object of the invention to provide one kind evaluation medicine to EML4-ALK
The method of the lung cancer therapy effect of L1196M oncogenes driving, the key of this method is to build 5 ' mROSA-CAG-lox- in vitro
Stop-lox-EML4-ALK L1196M-3 ' mROSA genetic fragments, it is then that the genetic fragment and cas9 enzymes and sgRNA is common
It is expelled in the embryo of mouse, identifies the mouse containing homologous recombination gene after mouse birth, treat that mouse is developed to adult, activate
EML4-ALK L1196M oncogenes, the primary tumor of lung cancer will be induced, then to mouse drug treatment, evaluate therapeutic effect.This
The evaluation method of invention can simulation tumor microenvironment in patient body to greatest extent, be a kind of more science and objective appraisal side
Method.
The purpose of the present invention is achieved through the following technical solutions:
A kind of method for evaluating the lung cancer therapy effect that medicine drives to EML4-ALK L1196M oncogenes, including it is following
Step:
(1) added respectively using PCR method amplification EML4-ALK L1196M genetic fragments and at its 5 ' end and 3 ' ends
EcoRI and NotI restriction enzyme sites, resulting fragment is connected on pClatent plasmids, obtains pClatent-EML4-ALK
L1196M plasmids;Expand mouse rosa 26 two sections of site sequence as homology arm by the use of PCR method, respectively by EcoRV and PacI,
EcoRV and AscI is inserted on pClatent-EML4-ALK L1196M plasmids, so as to obtain mRosa-lsl-EML4-ALK
L1196M plasmids;The carrier segments (2.7Kb) on plasmid are cut away with EcoRV enzymes, obtain 5 ' mROSA-CAG-lox-stop-
Lox-EML4-ALK L1196M-3 ' mROSA genetic fragments (9.5Kb);
The sequence such as SEQ.ID.NO.1 of the EML4-ALK L1196M genetic fragments plus restriction enzyme site described in step (1)
It is shown;
Two sections of the mouse rosa 26 site of step (1) sequence is respectively as shown in SEQ.ID.NO.9 and SEQ.ID.NO.10;
5 '-mROSA-CAG-lox-stop-lox-EML4-ALK L1196M-3 ' mROSA gene pieces described in step (1)
Its sequence of section is as shown in SEQ.ID.NO.11;
(2) by the transgenic fragment 5 ' of Cas9mRNA fragments, gRNA fragments and inducible expression EML4-ALK L1196M
MROSA-CAG-lox-stop-lox-EML4-ALK L1196M-3 ' mROSA are mixed, and are expelled to mixture by microinjection
In the embryo of mouse, cas9 cuts ROSA26 sites under gRNA guiding, by homologous recombination by the gene of inducible expression
Fragment inserts genome;
In mixture described in step (2), the preferred 80ng/ μ L of concentration of Cas9mRNA fragments;The concentration of gRNA fragments is excellent
Select 30ng/ μ L;The mROSA-CAG-lox-stop-lox-EML4-ALKL1196M-3 ' of transgenic fragment 5 ' mROSA concentration is preferred
8ng/μL;
GRNA described in step (2), its sequence is as shown in SEQ.ID.NO.12;
Injection described in step (2), the preferred 15pL of injection volume;
(3) transgenic embryo transfer that step (2) obtains is entered into replace-conceive mouse uterus, raises and treat that mouse is born, design three
Enter performing PCR identification to 5 ' insertion points, 3 ' insertion points and EML4-ALK L1196M genes respectively to primer, screen all sun
The transgenic mice of property;
Transgenic embryo transfer is entered to replace-conceive mouse uterus described in step (3), is after the replace-conceive mouse of false pregnancy is anaesthetized, from abdomen
Portion's opening, fallopian tubal mouth is exposed, after transgenic embryo transfer is entered into replace-conceive mouse uterus, skin is closed with wound clips;
(4) Mouse feeder of transgenic positive instills the virus containing CRE recombinant protein enzyme genes from nasal cavity to growing up
In mouse lung, so that by the EML4-ALK L1196M oncogene activations in pulmonary epithelial cells, mouse obtains adenocarcinoma of lung after 20 days;It is logical
Crossing CT detections and pathological section confirms the presence of cancerous lung tissue;
Adult described in step (4) is 6-8 week old;
(5) mouse is administered, administration terminates, CT detection lung cancer sizes, compared with the size before treatment;
(6) after treatment end, mouse is put to death, prepares the pathological section of mouse lung tissue, reads the lung cancer on pathological section
Pathological change;Again with CT associations, the ability that drug therapy EML4-ALK L1196M drive lung cancer is judged.
The present invention is had the following advantages relative to prior art and effect:
Farthest the pulmonary carcinosis that EML4-ALK L1196M drive can be treated using the method for the present invention by aids drug
People, really simulates generation of the lung cancer from oncogene, pulmonary epithelial cells canceration, the formation of lung cancer, and last mouse dies from lung cancer
Clinical process.Performance of the medicine in lung cancer clinical can be predicted exactly using the mouse model of the present invention:Accurately comment
The acute toxicity of valency medicine, chronic toxicity, pharmacokinetics, the therapeutic effect to lung cancer.
Brief description of the drawings
Fig. 1 is the electrophoretogram of EML4-ALK L1196M fragment PCR products;Wherein, swimming lane 1 and 2 is PCR primer.
Fig. 2 is EML4-ALK L1196M mouse first to primer PCR product electrophoretogram;Wherein, swimming lane 11 is PCR primer.
Fig. 3 is EML4-ALK L1196M mouse second to primer PCR product electrophoretogram;Wherein, swimming lane 11 is PCR primer.
Fig. 4 is the 3rd pair of primer PCR product electrophoretogram of EML4-ALK L1196M mouse;Wherein, swimming lane 11 is PCR primer.
Fig. 5 is with the pretherapy and post-treatment lung cancer CT testing result figures of PF-06463922;Wherein, the result before A- treatments, B- treatments
Result afterwards.
Fig. 6 is with the pretherapy and post-treatment lung cancer CT testing result figures of Ceritinib;Wherein, the result before A- treatments, after B- treatments
Result.
Fig. 7 is lung cancer CT testing result figures before and after HKI Solution In The Treatments;Wherein, the result before A- treatments, the knot after B- treatments
Fruit.
Fig. 8 is the pathological section figure of mouse lung tissue;Wherein, result before A- treatments, B- is the knot after HKI Solution In The Treatments
Fruit, C- treated with PF-06463922 after result, D- treated with Ceritinib after result.
Embodiment
With reference to embodiment and accompanying drawing, the present invention is described in further detail, but embodiments of the present invention are unlimited
In this.
Embodiment
A kind of method for evaluating the lung cancer therapy effect that medicine drives to EML4-ALK L1196M oncogenes, including it is following
Step:
(1) using PCR method amplification EML4-ALK L1196M genetic fragments (deriving from people, Homosapiens) and at it
5 ' ends and 3 ' ends add EcoRI and NotI restriction enzyme sites respectively, and gained gene fragment order is as shown in SEQ.ID.NO.1, sequence
Length 3.2Kb;The electrophoretogram of PCR primer is as shown in Figure 1;
Primer sequence is:
Sense primer:5’-3’cggaattcatggacggtttcgccggcag(SEQ.ID.NO.2)
Anti-sense primer:5’-3’tatgcggccgcttcagggcccaggctggttca(SEQ.ID.NO.3)
By pClatent plasmids, (construction method is shown in document Mikse OR., et.al., The impact of the MYB-
NFIB fusion protooncogene in vivo.Oncotarget.2016May 18.doi:10.18632/
Oncotarget.9426 double digestion) is carried out with EcoRI and NotI enzymes, recovery obtains pClatent linearized fragments, and (sequence is such as
Shown in SEQ.ID.NO.4);This fragment is entered with EML4-ALK L1196M genetic fragments (SEQ.ID.NO.1) by T4 ligases
The Escherichia coli of row connection transformed competence colibacillus, picking monoclonal, obtain pClatent-EML4-ALK L1196M plasmids.
Design following two pairs of primers:
Primer 1:
Sense primer:5’-3’ccgatatcaggcctgtgcacctcctggcttctgaggacc(SEQ.ID.NO.5)
Anti-sense primer:5’-3’agcttaattaacgtgtagaatgccatga(SEQ.ID.NO.6)
Primer 2:
Sense primer:5’-3’acggcgcgcctggtctaaatgtgattttg(SEQ.ID.NO.7)
Anti-sense primer:5’-3’ccgatatcaggcctgtgcacaaactagaaaatctgattaa(SEQ.ID.NO.8)
With PCR method, using mouse (Mus musculus) B6 genome as two sections of template amplification mouse rosa 26 site
Sequence is as homology arm;Two sections of sequences are respectively as shown in SEQ.ID.NO.9 and SEQ.ID.NO.10;
It is inserted into respectively by EcoRV and PacI and EcoRV and AscI on pClatent-EML4-ALKL1196M plasmids,
So as to obtain mRosa-lsl-EML4-ALK L1196M plasmids;The carrier segments of 2.7kb on plasmid are cut away by EcoRV enzymes,
5 '-mROSA-CAG-lox-stop-lox-EML4-ALK L1196M-3 ' mROSA genetic fragments can be obtained, and (sequence is such as
Shown in SEQ.ID.NO.11);
(2) by 5 '-mROSA-CAG-lox-stop-lox-EML4-ALK L1196M-3 ' mROSA bases of inducible expression
Because fragment and cas9mRNA and gRNA (sequence as shown in SEQ.ID.NO.12, document Chu VT., et.al., BMC
Biotechnol.2016Jan 16;16:4.Efficient generation of Rosa26knock-in mice using
CRISPR/Cas9in C57BL/6zygotes. are also on the books) mixing, with 8ng/ μ L, 80ng/ μ L and 30ng/ μ L final concentration,
Mixture is injected into the embryo of mouse by 15pL by microinjection.Cas9 cuts ROSA26 sites under gRNA guiding,
The genetic fragment of inducible expression is inserted by genome by homologous recombination;
(3) after the replace-conceive mouse anesthesia of false pregnancy, from belly opening, fallopian tubal mouth is exposed, transgenic embryo transfer is entered small
Behind mouse uterus, skin is closed with wound clips;Treat that mouse is born, three pairs of primers of design are respectively to 5 ' insertion points, 3 ' insertion points
Enter performing PCR identification with EML4-ALK L1196M genes, screen the transgenic mice of total positives;
It is as follows for the pair of primers of 5 ' insertion points design, its sequence:
Sense primer:5’-3’ggacagatagctggcgtggata(SEQ.ID.NO.13)
Anti-sense primer:5’-3’tccggacacctggccttcat(SEQ.ID.NO.14)
The sequence of PCR primer is as shown in SEQ.ID.NO.15, sequence length 750bp, and electrophoretogram is as shown in Figure 2;
It is as follows for second pair of primer of 3 ' insertion points design, its sequence:
Sense primer:5’-3’cccaaagtcgctctgagttg(SEQ.ID.NO.16)
Anti-sense primer:5’-3’ggcgggccatttaccgtaag(SEQ.ID.NO.17)
The sequence of PCR primer is as shown in SEQ.ID.NO.18, sequence length 1402bp, and electrophoretogram is as shown in Figure 3;
It is as follows for the 3rd pair of primer of EML4-ALK L1196M genes design, its sequence:
Sense primer:5’-3’:ccatagaaaagccttgacttgaggttag(SEQ.ID.NO.19)
Anti-sense primer:5’-3’gactttggctgtgaagaatttggat(SEQ.ID.NO.20)
The sequence of PCR primer is as shown in SEQ.ID.NO.21, sequence length 1633bp, and electrophoretogram is as shown in Figure 4;
(4) transgenic mice is raised, when mouse is grown to 6 week old, the virus (purchase containing CRE recombinant protein enzyme genes
From lucky triumphant gene, AAV-cre) instilled from nasal cavity in mouse lung, so as to by the EML4-ALK L1196M cancer bases in pulmonary epithelial cells
Because of activation, mouse obtains adenocarcinoma of lung after 20 days;The presence of cancerous lung tissue is confirmed by CT detections and pathological section;
(5) dissolve PF-06463922 respectively with HKI solution (Tween 80 of 0.5% methylcellulose -0.4%) (Laura replaces
Buddhist nun) and Ceritinib (Ceritinib), and respectively with 10mg/kg and 50mg/kg dosage to mouse stomach.Control group is only used
Above-mentioned HKI solution gavage.PF-06463922 is taken twice daily, and Ceritinib is administered once a day, continuous 2 week.So
Lung cancer size is detected with CT afterwards, compared with the size before treatment;
(6) after treatment end, mouse is put to death, prepares the pathological section of mouse lung tissue, reads the lung cancer on pathological section
Pathological change;Again with CT associations, the ability that drug therapy EML4-ALK L1196M drive lung cancer is judged.
Administration group and the treatment results of control group are shown in Table 1:
Table 1
Mouse in embodiment, via intranasal application irrigated CRE adenovirus after 20 days, and mouse starts to breathe, hunchbacked and fried hair
Phenomena such as.Detected by CT, it is found that there is shade and shadow in lung, be suspected to be lung cancer (such as Fig. 7 A).Pathological analysis, hair are carried out to the mouse lung
There is poorly differentiated adenocarcinoma in existing lung, with the bronchoalveolar cancer of disperse, and atypical hyperplasia (such as Fig. 8 A).Illustrate in pulmonary epithelial cells
Expression EML4-ALK L1196M mutation physical efficiency quickly forms tumour.
Gavage (is compareed) as without medicine by the use of HKI solution to tumor-bearing mice to treat, and the development of mice lung cancer is recorded with CT.
As a result lung's shade and shadow in the treatment of two weeks is shown in continue to expand (such as Fig. 7 B).After treatment end, to the lung pathologies point of mouse
Analysis finds that the nuclear staining of lung carcinoma cell is shallow, and the volume of cell is big, and the core inhomogeneity between different cells is strong, shows at lung cancer
In strong active stage (such as Fig. 8 B).As a result the mice lung cancer rapid progress of control group is illustrated.
From two EML4-ALK suppression medicine:PF-06463922 and Ceritinib.After being dissolved with HKI solution, point
The two medicines are not treated to mouse stomach, and record the situation of lung cancer by CT afterwards before administration.CT results show PF-
Lung's shade and shadow rapid regression (such as Fig. 5 B) of 06463922 treatment group mouse.Prompt lung cancer response treatment.
Pathological analysis is carried out to the lung of mouse, as a result shows that there is the disperse remaining fiberizing zone of large area in tumour lung
Domain, the alveolar wall thickening of regional area, regional area still remaining have cancerous lung tissue, and show that lung carcinoma cell volume diminishes, core
Dyeing is deep, nucleus homogeneity height (such as Fig. 8 C).Illustrate that lung's major part cancer has disappeared, and rebuild normal lung tissue.
Treatment results illustrate that PF-06463922 has strong therapeutic effect to the EML4-ALK L1196M tumours driven.
It is similar with PF-06463922, it is found that Ceritinib has strong treatment EML4-ALK L1196M driving lung cancer
Ability (such as Fig. 6 B, Fig. 8 D).
Above-described embodiment is the preferable embodiment of the present invention, but embodiments of the present invention are not by above-described embodiment
Limitation, other any Spirit Essences without departing from the present invention with made under principle change, modification, replacement, combine, simplification,
Equivalent substitute mode is should be, is included within protection scope of the present invention.
Sequence table
<120>A kind of method of evaluation EML4-ALK inhibitor to lung cancer therapy effect
<160> 21
<170> SIPOSequenceListing 1.0
<210> 1
<211> 3200
<212> DNA
<213>People (Homo sapiens)
<400> 1
cggaattcat ggacggtttc gccggcagtc tcgatgatag tatttctgct gcaagtactt 60
ctgatgttca agatcgcctg tcagctcttg agtcacgagt tcagcaacaa gaagatgaaa 120
tcactgtgct aaaggcggct ttggctgatg ttttgaggcg tcttgcaatc tctgaagatc 180
atgtggcctc agtgaaaaaa tcagtctcaa gtaaaggcca accaagccct cgagcagtta 240
ttcccatgtc ctgtataacc aatggaagtg gtgcaaacag aaaaccaagt cataccagtg 300
ctgtctcaat tgcaggaaaa gaaactcttt catctgctgc taaaagtggt acagaaaaaa 360
agaaagaaaa accacaagga cagagagaaa aaaaagagga atctcattct aatgatcaaa 420
gtccacaaat tcgagcatca ccttctcccc agccctcttc acaacctctc caaatacaca 480
gacaaactcc agaaagcaag aatgctactc ccaccaaaag cataaaacga ccatcaccag 540
ctgaaaagtc acataattct tgggaaaatt cagatgatag ccgtaataaa ttgtcgaaaa 600
taccttcaac acccaaatta ataccaaaag ttaccaaaac tgcagacaag cataaagatg 660
tcatcatcaa ccaagaagga gaatatatta aaatgtttat gcgcggtcgg ccaattacca 720
tgttcattcc ttccgatgtt gacaactatg atgacatcag aacggaactg cctcctgaga 780
agctcaaact ggagtgggca tatggttatc gaggaaagga ctgtagagct aatgtttacc 840
ttcttccgac cggggaaata gtttatttca ttgcatcagt agtagtacta tttaattatg 900
aggagagaac tcagcgacac tacctgggcc atacagactg tgtgaaatgc cttgctatac 960
atcctgacaa aattaggatt gcaactggac agatagctgg cgtggataaa gatggaaggc 1020
ctctacaacc ccacgtcaga gtgtgggatt ctgttactct atccacactg cagattattg 1080
gacttggcac ttttgagcgt ggagtaggat gcctggattt ttcaaaagca gattcaggtg 1140
ttcatttatg tgttattgat gactccaatg agcatatgct tactgtatgg gactggcaga 1200
agaaagcaaa aggagcagaa ataaagacaa caaatgaagt tgttttggct gtggagtttc 1260
acccaacaga tgcaaatacc ataattacat gcggtaaatc tcatattttc ttctggacct 1320
ggagcggcaa ttcactaaca agaaaacagg gaatttttgg gaaatatgaa aagccaaaat 1380
ttgtgcagtg tttagcattc ttggggaatg gagatgttct tactggagac tcaggtggag 1440
tcatgcttat atggagcaaa actactgtag agcccacacc tgggaaagga cctaaagtgt 1500
accgccggaa gcaccaggag ctgcaagcca tgcagatgga gctgcagagc cctgagtaca 1560
agctgagcaa gctccgcacc tcgaccatca tgaccgacta caaccccaac tactgctttg 1620
ctggcaagac ctcctccatc agtgacctga aggaggtgcc gcggaaaaac atcaccctca 1680
ttcggggtct gggccatgga gcctttgggg aggtgtatga aggccaggtg tccggaatgc 1740
ccaacgaccc aagccccctg caagtggctg tgaagacgct gcctgaagtg tgctctgaac 1800
aggacgaact ggatttcctc atggaagccc tgatcatcag caaattcaac caccagaaca 1860
ttgttcgctg cattggggtg agcctgcaat ccctgccccg gttcatcctg ctggagctca 1920
tggcgggggg agacctcaag tccttcctcc gagagacccg ccctcgcccg agccagccct 1980
cctccctggc catgctggac cttctgcacg tggctcggga cattgcctgt ggctgtcagt 2040
atttggagga aaaccacttc atccaccgag acattgctgc cagaaactgc ctcttgacct 2100
gtccaggccc tggaagagtg gccaagattg gagacttcgg gatggcccga gacatctaca 2160
gggcgagcta ctatagaaag ggaggctgtg ccatgctgcc agttaagtgg atgcccccag 2220
aggccttcat ggaaggaata ttcacttcta aaacagacac atggtccttt ggagtgctgc 2280
tatgggaaat cttttctctt ggatatatgc cataccccag caaaagcaac caggaagttc 2340
tggagtttgt caccagtgga ggccggatgg acccacccaa gaactgccct gggcctgtat 2400
accggataat gactcagtgc tggcaacatc agcctgaaga caggcccaac tttgccatca 2460
ttttggagag gattgaatac tgcacccagg acccggatgt aatcaacacc gctttgccga 2520
tagaatatgg tccacttgtg gaagaggaag agaaagtgcc tgtgaggccc aaggaccctg 2580
agggggttcc tcctctcctg gtctctcaac aggcaaaacg ggaggaggag cgcagcccag 2640
ctgccccacc acctctgcct accacctcct ctggcaaggc tgcaaagaaa cccacagctg 2700
cagaggtctc tgttcgagtc cctagagggc cggccgtgga agggggacac gtgaatatgg 2760
cattctctca gtccaaccct ccttcggagt tgcacagggt ccacggatcc agaaacaagc 2820
ccaccagctt gtggaaccca acgtacggct cctggtttac agagaaaccc accaaaaaga 2880
ataatcctat agcaaagaag gagccacacg agaggggtaa cctggggctg gagggaagct 2940
gtactgtccc acctaacgtt gcaactggga gacttccggg ggcctcactg ctcctagagc 3000
cctcttcgct gactgccaat atgaaggagg tacctctgtt caggctacgt cacttccctt 3060
gtgggaatgt caattacggc taccagcaac agggcttgcc cttagaagcc gctactgccc 3120
ctggagctgg tcattacgag gataccattc tgaaaagcaa gaatagcatg aaccagcctg 3180
ggccctgaag cggccgcata 3200
<210> 2
<211> 28
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 2
cggaattcat ggacggtttc gccggcag 28
<210> 3
<211> 32
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 3
tatgcggccg cttcagggcc caggctggtt ca 32
<210> 4
<211> 6458
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 4
gcggccgcat actagtaact cctcaggtgc aggctgccta tcagaaggtg gtggctggtg 60
tggccaatgc cctggctcac aaataccact gagatctttt tccctctgcc aaaaattatg 120
gggacatcat gaagcccctt gagcatctga cttctggcta ataaaggaaa tttattttca 180
ttgcaatagt gtgttggaat tttttgtgtc tctcactcgg aaggacatat gggagggcaa 240
atcatttaaa acatcagaat gagtatttgg tttagagttt ggcaacatat gcccatatgc 300
tggctgccat gaacaaaggt tggctataaa gaggtcatca gtatatgaaa cagccccctg 360
ctgtccattc cttattccat agaaaagcct tgacttgagg ttagattttt tttatatttt 420
gttttgtgtt atttttttct ttaacatccc taaaattttc cttacatgtt ttactagcca 480
gatttttcct cctctcctga ctactcccag tcatagctgt ccctcttctc ttatgaagat 540
ccctcgacgg cgcgcgtgca caggcctgat atcggtacct ccagcttttg ttccctttag 600
tgagggttaa ttgcgcgctt ggcgtaatca tggtcatagc tgtttcctgt gtgaaattgt 660
tatccgctca caattccaca caacatacga gccggaagca taaagtgtaa agcctggggt 720
gcctaatgag tgagctaact cacattaatt gcgttgcgct cactgcccgc tttccagtcg 780
ggaaacctgt cgtgccagct gcattaatga atcggccaac gcgcggggag aggcggtttg 840
cgtattgggc gctcttccgc ttcctcgctc actgactcgc tgcgctcggt cgttcggctg 900
cggcgagcgg tatcagctca ctcaaaggcg gtaatacggt tatccacaga atcaggggat 960
aacgcaggaa agaacatgtg agcaaaaggc cagcaaaagg ccaggaaccg taaaaaggcc 1020
gcgttgctgg cgtttttcca taggctccgc ccccctgacg agcatcacaa aaatcgacgc 1080
tcaagtcaga ggtggcgaaa cccgacagga ctataaagat accaggcgtt tccccctgga 1140
agctccctcg tgcgctctcc tgttccgacc ctgccgctta ccggatacct gtccgccttt 1200
ctcccttcgg gaagcgtggc gctttctcat agctcacgct gtaggtatct cagttcggtg 1260
taggtcgttc gctccaagct gggctgtgtg cacgaacccc ccgttcagcc cgaccgctgc 1320
gccttatccg gtaactatcg tcttgagtcc aacccggtaa gacacgactt atcgccactg 1380
gcagcagcca ctggtaacag gattagcaga gcgaggtatg taggcggtgc tacagagttc 1440
ttgaagtggt ggcctaacta cggctacact agaaggacag tatttggtat ctgcgctctg 1500
ctgaagccag ttaccttcgg aaaaagagtt ggtagctctt gatccggcaa acaaaccacc 1560
gctggtagcg gtggtttttt tgtttgcaag cagcagatta cgcgcagaaa aaaaggatct 1620
caagaagatc ctttgatctt ttctacgggg tctgacgctc agtggaacga aaactcacgt 1680
taagggattt tggtcatgag attatcaaaa aggatcttca cctagatcct tttaaattaa 1740
aaatgaagtt ttaaatcaat ctaaagtata tatgagtaaa cttggtctga cagttaccaa 1800
tgcttaatca gtgaggcacc tatctcagcg atctgtctat ttcgttcatc catagttgcc 1860
tgactccccg tcgtgtagat aactacgata cgggagggct taccatctgg ccccagtgct 1920
gcaatgatac cgcgagaccc acgctcaccg gctccagatt tatcagcaat aaaccagcca 1980
gccggaaggg ccgagcgcag aagtggtcct gcaactttat ccgcctccat ccagtctatt 2040
aattgttgcc gggaagctag agtaagtagt tcgccagtta atagtttgcg caacgttgtt 2100
gccattgcta caggcatcgt ggtgtcacgc tcgtcgtttg gtatggcttc attcagctcc 2160
ggttcccaac gatcaaggcg agttacatga tcccccatgt tgtgcaaaaa agcggttagc 2220
tccttcggtc ctccgatcgt tgtcagaagt aagttggccg cagtgttatc actcatggtt 2280
atggcagcac tgcataattc tcttactgtc atgccatccg taagatgctt ttctgtgact 2340
ggtgagtact caaccaagtc attctgagaa tagtgtatgc ggcgaccgag ttgctcttgc 2400
ccggcgtcaa tacgggataa taccgcgcca catagcagaa ctttaaaagt gctcatcatt 2460
ggaaaacgtt cttcggggcg aaaactctca aggatcttac cgctgttgag atccagttcg 2520
atgtaaccca ctcgtgcacc caactgatct tcagcatctt ttactttcac cagcgtttct 2580
gggtgagcaa aaacaggaag gcaaaatgcc gcaaaaaagg gaataagggc gacacggaaa 2640
tgttgaatac tcatactctt cctttttcaa tattattgaa gcatttatca gggttattgt 2700
ctcatgagcg gatacatatt tgaatgtatt tagaaaaata aacaaatagg ggttccgcgc 2760
acatttcccc gaaaagtgcc acctaaattg taagcgttaa tattttgtta aaattcgcgt 2820
taaatttttg ttaaatcagc tcatttttta accaataggc cgaaatcggc aaaatccctt 2880
ataaatcaaa agaatagacc gagatagggt tgagtgttgt tccagtttgg aacaagagtc 2940
cactattaaa gaacgtggac tccaacgtca aagggcgaaa aaccgtctat cagggcgatg 3000
gcccactacg tgaaccatca ccctaatcaa gttttttggg gtcgaggtgc cgtaaagcac 3060
taaatcggaa ccctaaaggg agcccccgat ttagagcttg acggggaaag ccggcgaacg 3120
tggcgagaaa ggaagggaag aaagcgaaag gagcgggcgc tagggcgctg gcaagtgtag 3180
cggtcacgct gcgcgtaacc accacacccg ccgcgcttaa tgcgccgcta cagggcgcgt 3240
cccattcgcc attcaggctg cgcaactgtt gggaagggcg atcggtgcgg gcctcttcgc 3300
tattacgcca gctggcgaaa gggggatgtg ctgcaaggcg attaagttgg gtaacgccag 3360
ggttttccca gtcacgacgt tgtaaaacga cggccagtga gcgcgcgtaa tacgactcac 3420
tatagggcga attgggtacc gatatcaggc ctgtgcaatt aagctagtta ttaatagtaa 3480
tcaattacgg ggtcattagt tcatagccca tatatggagt tccgcgttac ataacttacg 3540
gtaaatggcc cgcctggctg accgcccaac gacccccgcc cattgacgtc aataatgacg 3600
tatgttccca tagtaacgcc aatagggact ttccattgac gtcaatgggt ggactattta 3660
cggtaaactg cccacttggc agtacatcaa gtgtatcata tgccaagtac gccccctatt 3720
gacgtcaatg acggtaaatg gcccgcctgg cattatgccc agtacatgac cttatgggac 3780
tttcctactt ggcagtacat ctacgtatta gtcatcgcta ttaccatggg tcgaggtgag 3840
ccccacgttc tgcttcactc tccccatctc ccccccctcc ccacccccaa ttttgtattt 3900
atttattttt taattatttt gtgcagcgat gggggcgggg gggggggggg cgcgcgccag 3960
gcggggcggg gcggggcgag gggcggggcg gggcgaggcg gagaggtgcg gcggcagcca 4020
atcagagcgg cgcgctccga aagtttcctt ttatggcgag gcggcggcgg cggcggccct 4080
ataaaaagcg aagcgcgcgg cgggcgggag tcgctgcgtt gccttcgccc cgtgccccgc 4140
tccgcgccgc ctcgcgccgc ccgccccggc tctgactgac cgcgttactc ccacaggtga 4200
gcgggcggga cggcccttct cctccgggct gtaattagcg cttggtttaa tgacggctcg 4260
tttcttttct gtggctgcgt gaaagcctta aagggctccg ggagggccct ttgtgcgggg 4320
gggagcggct cggggggtgc gtgcgtgtgt gtgtgcgtgg ggagcgccgc gtgcggcccg 4380
cgctgcccgg cggctgtgag cgctgcgggc gcggcgcggg gctttgtgcg ctccgcgtgt 4440
gcgcgagggg agcgcggccg ggggcggtgc cccgcggtgc gggggggctg cgaggggaac 4500
aaaggctgcg tgcggggtgt gtgcgtgggg gggtgagcag ggggtgtggg cgcggcggtc 4560
gggctgtaac ccccccctgc acccccctcc ccgagttgct gagcacggcc cggcttcggg 4620
tgcggggctc cgtgcggggc gtggcgcggg gctcgccgtg ccgggcgggg ggtggcggca 4680
ggtgggggtg ccgggcgggg cggggccgcc tcgggccggg gagggctcgg gggaggggcg 4740
cggcggcccc ggagcgccgg cggctgtcga ggcgcggcga gccgcagcca ttgcctttta 4800
tggtaatcgt gcgagagggc gcagggactt cctttgtccc aaatctggcg gagccgaaat 4860
ctgggaggcg ccgccgcacc ccctctagcg ggcgcgggcg aagcggtgcg gcgccggcag 4920
gaaggaaatg ggcggggagg gccttcgtgc gtcgccgcgc cgccgtcccc ttctccatct 4980
ccagcctcgg ggctgccgca gggggacggc tgccttcggg ggggacgggg cagggcgggg 5040
ttcggcttct ggcgtgtgac cggcggctct agagcctctg ctaaccatgt tcatgccttc 5100
ttctttttcc tacagctcct gggcaacgtg ctggttattg tgctgtctca tcattttggc 5160
aaagaattga ttaattcgag cgaacgcgta taacttcgta tagcatacat tatacgaagt 5220
tatctcgagt cggatttgat ctgatcaaga gacaggatga ggatcgtttc gcatgattga 5280
acaagatgga ttgcacgcag gttctccggc cgcttgggtg gagaggctat tcggctatga 5340
ctgggcacaa cagacaatcg gctgctctga tgccgccgtg ttccggctgt cagcgcaggg 5400
gcgcccggtt ctttttgtca agaccgacct gtccggtgcc ctgaatgaac tgcaggacga 5460
ggcagcgcgg ctatcgtggc tggccacgac gggcgttcct tgcgcagctg tgctcgacgt 5520
tgtcactgaa gcgggaaggg actggctgct attgggcgaa gtgccggggc aggatctcct 5580
gtcatctcac cttgctcctg ccgagaaagt atccatcatg gctgatgcaa tgcggcggct 5640
gcatacgctt gatccggcta cctgcccatt cgaccaccaa gcgaaacatc gcatcgagcg 5700
agcacgtact cggatggaag ccggtcttgt cgatcaggat gatctggacg aagagcatca 5760
ggggctcgcg ccagccgaac tgttcgccag gctcaaggcg cgcatgcccg acggcgagga 5820
tctcgtcgtg acccatggcg atgcctgctt gccgaatatc atggtggaaa atggccgctt 5880
ttctggattc atcgactgtg gccggctggg tgtggcggac cgctatcagg acatagcgtt 5940
ggctacccgt gatattgctg aagagcttgg cggcgaatgg gctgaccgct tcctcgtgct 6000
ttacggtatc gccgctcccg attcgcagcg catcgccttc tatcgccttc ttgacgagtt 6060
cttctgagcg ggactctggg gttcgaaatg accgaccaag cgacgcccaa cctgccatca 6120
cgagatttcg attccaccgc cgccttctat gaaaggttgg gcttcggaat cgttttccgg 6180
gacgccggct ggatgatcct ccagcgcggg gatctcatgc tggagttctt cgcccacccc 6240
atcgataact tgtttattgc agcttataat ggttacaaat aaagcaatag catcacaaat 6300
ttcacaaata aagcattttt ttcactgcat tctagttgtg gtttgtccaa actcatcaat 6360
gtatcttatc atgtctggat caatccgaac gcgtataact tcgtatagca tacattatac 6420
gaagttatct cgagtcgctc ggtacgattt aaattgaa 6458
<210> 5
<211> 39
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 5
ccgatatcag gcctgtgcac ctcctggctt ctgaggacc 39
<210> 6
<211> 28
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 6
agcttaatta acgtgtagaa tgccatga 28
<210> 7
<211> 29
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 7
acggcgcgcc tggtctaaat gtgattttg 29
<210> 8
<211> 40
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 8
ccgatatcag gcctgtgcac aaactagaaa atctgattaa 40
<210> 9
<211> 1229
<212> DNA
<213>Mouse (Mus musculus)
<400> 9
cgatatcagg cctgtgcacc tcctggcttc tgaggaccgc cctgggcctg ggagaatccc 60
ttccccctct tccctcgtga tctgcaactc cagtctttct agaagatggg cgggagtctt 120
ctgggcaggc ttaaaggcta acctggtgtg tgggcgttgt cctgcagggg aattgaacag 180
gtgtaaaatt ggagggacaa gacttcccac agattttcgg ttttgtcggg aagtttttta 240
ataggggcaa ataaggaaaa tgggaggata ggtagtcatc tggggtttta tgcagcaaaa 300
ctacaggtta ttattgcttg tgatccgcct cggagtattt tccatcgagg tagattaaag 360
acatgctcac ccgagtttta tactctcctg cttgagatcc ttactacagt atgaaattac 420
agtgtcgcga gttagactat gtaagcagaa ttttaatcat ttttaaagag cccagtactt 480
catatccatt tctcccgctc cttctgcagc cttatcaaaa ggtattttag aacactcatt 540
ttagccccat tttcatttat tatactggct tatccaaccc ctagacagag cattggcatt 600
ttccctttcc tgatcttaga agtctgatga ctcatgaaac cagacagatt agttacatac 660
accacaaatc gaggctgtag ctggggcctc aacactgcag ttcttttata actccttagt 720
acactttttg ttgatccttt gccttgatcc ttaattttca gtgtctatca cctctcccgt 780
caggtggtgt tccacatttg ggcctattct cagtccaggg agttttacaa caatagatgt 840
attgagaatc caacctaaag cttaactttc cactcccatg aatgcctctc tcctttttct 900
ccatttataa actgagctat taaccattaa tggtttccag gtggatgtct cctcccccaa 960
tattacctga tgtatcttac atattgccag gctgatattt taagacatta aaaggtatat 1020
ttcattattg agccacatgg tattgattac tgcttactaa aattttgtca ttgtacacat 1080
ctgtaaaagg tggttccttt tggaatgcaa agttcaggtg tttgttgtct ttcctgacct 1140
aaggtcttgt gagcttgtat tttttctatt taagcagtgc tttctcttgg actggcttga 1200
ctcatggcat tctacacgtt aattaagct 1229
<210> 10
<211> 1458
<212> DNA
<213>Mouse (Mus musculus)
<400> 10
gacggcgcgc ctggtctaaa tgtgattttg ccaagcttct tcaggaccta taattttgct 60
tgacttgtag ccaaacacaa gtaaaatgat taagcaacaa atgtatttgt gaagcttggt 120
ttttaggttg ttgtgttgtg tgtgcttgtg ctctataata atactatcca ggggctggag 180
aggtggctcg gagttcaaga gcacagactg ctcttccaga agtcctgagt tcaattccca 240
gcaaccacat ggtggctcac aaccatctgt aatgggatct gatgccctct tctggtgtgt 300
ctgaagacca caagtgtatt cacattaaat aaataaatcc tccttcttct tctttttttt 360
ttttttaaag agaatactgt ctccagtaga atttactgaa gtaatgaaat actttgtgtt 420
tgttccaata tggtagccaa taatcaaatt actctttaag cactggaaat gttaccaagg 480
aactaatttt tatttgaagt gtaactgtgg acagaggagc cataactgca gacttgtggg 540
atacagaaga ccaatgcaga ctttaatgtc ttttctctta cactaagcaa taaagaaata 600
aaaattgaac ttctagtatc ctatttgttt aaactgctag ctttacttaa cttttgtgct 660
tcatctatac aaagctgaaa gctaagtctg cagccattac taaacatgaa agcaagtaat 720
gataattttg gatttcaaaa atgtagggcc agagtttagc cagccagtgg tggtgcttgc 780
ctttatgcct ttaatcccag cactctggag gcagagacag gcagatctct gagtttgagc 840
ccagcctggt ctacacatca agttctatct aggatagcca ggaatacaca cagaaaccct 900
gttggggagg ggggctctga gatttcataa aattataatt gaagcattcc ctaatgagcc 960
actatggatg tggctaaatc cgtctacctt tctgatgaga tttgggtatt attttttctg 1020
tctctgctgt tggttgggtc ttttgacact gtgggctttc tttaaagcct ccttcctgcc 1080
atgtggtctc ttgtttgcta ctaacttccc atggcttaaa tggcatggct ttttgccttc 1140
taagggcagc tgctgagatt tgcagcctga tttccagggt ggggttggga aatctttcaa 1200
acactaaaat tgtcctttaa tttttttttt aaaaaatggg ttatataata aacctcataa 1260
aatagttatg aggagtgagg tggactaata ttaaatgagt ccctccccta taaaagagct 1320
attaaggctt tttgtcttat acttaacttt ttttttaaat gtggtatctt tagaaccaag 1380
ggtcttagag ttttagtata cagaaactgt tgcatcgctt aatcagattt tctagtttgt 1440
gcacaggcct gatatcgg 1458
<210> 11
<211> 9412
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 11
cctcctggct tctgaggacc gccctgggcc tgggagaatc ccttccccct cttccctcgt 60
gatctgcaac tccagtcttt ctagaagatg ggcgggagtc ttctgggcag gcttaaaggc 120
taacctggtg tgtgggcgtt gtcctgcagg ggaattgaac aggtgtaaaa ttggagggac 180
aagacttccc acagattttc ggttttgtcg ggaagttttt taataggggc aaataaggaa 240
aatgggagga taggtagtca tctggggttt tatgcagcaa aactacaggt tattattgct 300
tgtgatccgc ctcggagtat tttccatcga ggtagattaa agacatgctc acccgagttt 360
tatactctcc tgcttgagat ccttactaca gtatgaaatt acagtgtcgc gagttagact 420
atgtaagcag aattttaatc atttttaaag agcccagtac ttcatatcca tttctcccgc 480
tccttctgca gccttatcaa aaggtatttt agaacactca ttttagcccc attttcattt 540
attatactgg cttatccaac ccctagacag agcattggca ttttcccttt cctgatctta 600
gaagtctgat gactcatgaa accagacaga ttagttacat acaccacaaa tcgaggctgt 660
agctggggcc tcaacactgc agttctttta taactcctta gtacactttt tgttgatcct 720
ttgccttgat ccttaatttt cagtgtctat cacctctccc gtcaggtggt gttccacatt 780
tgggcctatt ctcagtccag ggagttttac aacaatagat gtattgagaa tccaacctaa 840
agcttaactt tccactccca tgaatgcctc tctccttttt ctccatttat aaactgagct 900
attaaccatt aatggtttcc aggtggatgt ctcctccccc aatattacct gatgtatctt 960
acatattgcc aggctgatat tttaagacat taaaaggtat atttcattat tgagccacat 1020
ggtattgatt actgcttact aaaattttgt cattgtacac atctgtaaaa ggtggttcct 1080
tttggaatgc aaagttcagg tgtttgttgt ctttcctgac ctaaggtctt gtgagcttgt 1140
attttttcta tttaagcagt gctttctctt ggactggctt gactcatggc attctacacg 1200
ttaattaagc tagttattaa tagtaatcaa ttacggggtc attagttcat agcccatata 1260
tggagttccg cgttacataa cttacggtaa atggcccgcc tggctgaccg cccaacgacc 1320
cccgcccatt gacgtcaata atgacgtatg ttcccatagt aacgccaata gggactttcc 1380
attgacgtca atgggtggac tatttacggt aaactgccca cttggcagta catcaagtgt 1440
atcatatgcc aagtacgccc cctattgacg tcaatgacgg taaatggccc gcctggcatt 1500
atgcccagta catgacctta tgggactttc ctacttggca gtacatctac gtattagtca 1560
tcgctattac catgggtcga ggtgagcccc acgttctgct tcactctccc catctccccc 1620
ccctccccac ccccaatttt gtatttattt attttttaat tattttgtgc agcgatgggg 1680
gcgggggggg ggggggcgcg cgccaggcgg ggcggggcgg ggcgaggggc ggggcggggc 1740
gaggcggaga ggtgcggcgg cagccaatca gagcggcgcg ctccgaaagt ttccttttat 1800
ggcgaggcgg cggcggcggc ggccctataa aaagcgaagc gcgcggcggg cgggagtcgc 1860
tgcgttgcct tcgccccgtg ccccgctccg cgccgcctcg cgccgcccgc cccggctctg 1920
actgaccgcg ttactcccac aggtgagcgg gcgggacggc ccttctcctc cgggctgtaa 1980
ttagcgcttg gtttaatgac ggctcgtttc ttttctgtgg ctgcgtgaaa gccttaaagg 2040
gctccgggag ggccctttgt gcggggggga gcggctcggg gggtgcgtgc gtgtgtgtgt 2100
gcgtggggag cgccgcgtgc ggcccgcgct gcccggcggc tgtgagcgct gcgggcgcgg 2160
cgcggggctt tgtgcgctcc gcgtgtgcgc gaggggagcg cggccggggg cggtgccccg 2220
cggtgcgggg gggctgcgag gggaacaaag gctgcgtgcg gggtgtgtgc gtgggggggt 2280
gagcaggggg tgtgggcgcg gcggtcgggc tgtaaccccc ccctgcaccc ccctccccga 2340
gttgctgagc acggcccggc ttcgggtgcg gggctccgtg cggggcgtgg cgcggggctc 2400
gccgtgccgg gcggggggtg gcggcaggtg ggggtgccgg gcggggcggg gccgcctcgg 2460
gccggggagg gctcggggga ggggcgcggc ggccccggag cgccggcggc tgtcgaggcg 2520
cggcgagccg cagccattgc cttttatggt aatcgtgcga gagggcgcag ggacttcctt 2580
tgtcccaaat ctggcggagc cgaaatctgg gaggcgccgc cgcaccccct ctagcgggcg 2640
cgggcgaagc ggtgcggcgc cggcaggaag gaaatgggcg gggagggcct tcgtgcgtcg 2700
ccgcgccgcc gtccccttct ccatctccag cctcggggct gccgcagggg gacggctgcc 2760
ttcggggggg acggggcagg gcggggttcg gcttctggcg tgtgaccggc ggctctagag 2820
cctctgctaa ccatgttcat gccttcttct ttttcctaca gctcctgggc aacgtgctgg 2880
ttattgtgct gtctcatcat tttggcaaag aattgattaa ttcgagcgaa cgcgtataac 2940
ttcgtatagc atacattata cgaagttatc tcgagtcgga tttgatctga tcaagagaca 3000
ggatgaggat cgtttcgcat gattgaacaa gatggattgc acgcaggttc tccggccgct 3060
tgggtggaga ggctattcgg ctatgactgg gcacaacaga caatcggctg ctctgatgcc 3120
gccgtgttcc ggctgtcagc gcaggggcgc ccggttcttt ttgtcaagac cgacctgtcc 3180
ggtgccctga atgaactgca ggacgaggca gcgcggctat cgtggctggc cacgacgggc 3240
gttccttgcg cagctgtgct cgacgttgtc actgaagcgg gaagggactg gctgctattg 3300
ggcgaagtgc cggggcagga tctcctgtca tctcaccttg ctcctgccga gaaagtatcc 3360
atcatggctg atgcaatgcg gcggctgcat acgcttgatc cggctacctg cccattcgac 3420
caccaagcga aacatcgcat cgagcgagca cgtactcgga tggaagccgg tcttgtcgat 3480
caggatgatc tggacgaaga gcatcagggg ctcgcgccag ccgaactgtt cgccaggctc 3540
aaggcgcgca tgcccgacgg cgaggatctc gtcgtgaccc atggcgatgc ctgcttgccg 3600
aatatcatgg tggaaaatgg ccgcttttct ggattcatcg actgtggccg gctgggtgtg 3660
gcggaccgct atcaggacat agcgttggct acccgtgata ttgctgaaga gcttggcggc 3720
gaatgggctg accgcttcct cgtgctttac ggtatcgccg ctcccgattc gcagcgcatc 3780
gccttctatc gccttcttga cgagttcttc tgagcgggac tctggggttc gaaatgaccg 3840
accaagcgac gcccaacctg ccatcacgag atttcgattc caccgccgcc ttctatgaaa 3900
ggttgggctt cggaatcgtt ttccgggacg ccggctggat gatcctccag cgcggggatc 3960
tcatgctgga gttcttcgcc caccccatcg ataacttgtt tattgcagct tataatggtt 4020
acaaataaag caatagcatc acaaatttca caaataaagc atttttttca ctgcattcta 4080
gttgtggttt gtccaaactc atcaatgtat cttatcatgt ctggatcaat ccgaacgcgt 4140
ataacttcgt atagcataca ttatacgaag ttatctcgag tcgctcggta cgatttaaat 4200
tgaattctgc agtcgacggt accgcgggcc cgggatccac cggaattcat ggacggtttc 4260
gccggcagtc tcgatgatag tatttctgct gcaagtactt ctgatgttca agatcgcctg 4320
tcagctcttg agtcacgagt tcagcaacaa gaagatgaaa tcactgtgct aaaggcggct 4380
ttggctgatg ttttgaggcg tcttgcaatc tctgaagatc atgtggcctc agtgaaaaaa 4440
tcagtctcaa gtaaaggcca accaagccct cgagcagtta ttcccatgtc ctgtataacc 4500
aatggaagtg gtgcaaacag aaaaccaagt cataccagtg ctgtctcaat tgcaggaaaa 4560
gaaactcttt catctgctgc taaaagtggt acagaaaaaa agaaagaaaa accacaagga 4620
cagagagaaa aaaaagagga atctcattct aatgatcaaa gtccacaaat tcgagcatca 4680
ccttctcccc agccctcttc acaacctctc caaatacaca gacaaactcc agaaagcaag 4740
aatgctactc ccaccaaaag cataaaacga ccatcaccag ctgaaaagtc acataattct 4800
tgggaaaatt cagatgatag ccgtaataaa ttgtcgaaaa taccttcaac acccaaatta 4860
ataccaaaag ttaccaaaac tgcagacaag cataaagatg tcatcatcaa ccaagaagga 4920
gaatatatta aaatgtttat gcgcggtcgg ccaattacca tgttcattcc ttccgatgtt 4980
gacaactatg atgacatcag aacggaactg cctcctgaga agctcaaact ggagtgggca 5040
tatggttatc gaggaaagga ctgtagagct aatgtttacc ttcttccgac cggggaaata 5100
gtttatttca ttgcatcagt agtagtacta tttaattatg aggagagaac tcagcgacac 5160
tacctgggcc atacagactg tgtgaaatgc cttgctatac atcctgacaa aattaggatt 5220
gcaactggac agatagctgg cgtggataaa gatggaaggc ctctacaacc ccacgtcaga 5280
gtgtgggatt ctgttactct atccacactg cagattattg gacttggcac ttttgagcgt 5340
ggagtaggat gcctggattt ttcaaaagca gattcaggtg ttcatttatg tgttattgat 5400
gactccaatg agcatatgct tactgtatgg gactggcaga agaaagcaaa aggagcagaa 5460
ataaagacaa caaatgaagt tgttttggct gtggagtttc acccaacaga tgcaaatacc 5520
ataattacat gcggtaaatc tcatattttc ttctggacct ggagcggcaa ttcactaaca 5580
agaaaacagg gaatttttgg gaaatatgaa aagccaaaat ttgtgcagtg tttagcattc 5640
ttggggaatg gagatgttct tactggagac tcaggtggag tcatgcttat atggagcaaa 5700
actactgtag agcccacacc tgggaaagga cctaaagtgt accgccggaa gcaccaggag 5760
ctgcaagcca tgcagatgga gctgcagagc cctgagtaca agctgagcaa gctccgcacc 5820
tcgaccatca tgaccgacta caaccccaac tactgctttg ctggcaagac ctcctccatc 5880
agtgacctga aggaggtgcc gcggaaaaac atcaccctca ttcggggtct gggccatgga 5940
gcctttgggg aggtgtatga aggccaggtg tccggaatgc ccaacgaccc aagccccctg 6000
caagtggctg tgaagacgct gcctgaagtg tgctctgaac aggacgaact ggatttcctc 6060
atggaagccc tgatcatcag caaattcaac caccagaaca ttgttcgctg cattggggtg 6120
agcctgcaat ccctgccccg gttcatcctg ctggagctca tggcgggggg agacctcaag 6180
tccttcctcc gagagacccg ccctcgcccg agccagccct cctccctggc catgctggac 6240
cttctgcacg tggctcggga cattgcctgt ggctgtcagt atttggagga aaaccacttc 6300
atccaccgag acattgctgc cagaaactgc ctcttgacct gtccaggccc tggaagagtg 6360
gccaagattg gagacttcgg gatggcccga gacatctaca gggcgagcta ctatagaaag 6420
ggaggctgtg ccatgctgcc agttaagtgg atgcccccag aggccttcat ggaaggaata 6480
ttcacttcta aaacagacac atggtccttt ggagtgctgc tatgggaaat cttttctctt 6540
ggatatatgc cataccccag caaaagcaac caggaagttc tggagtttgt caccagtgga 6600
ggccggatgg acccacccaa gaactgccct gggcctgtat accggataat gactcagtgc 6660
tggcaacatc agcctgaaga caggcccaac tttgccatca ttttggagag gattgaatac 6720
tgcacccagg acccggatgt aatcaacacc gctttgccga tagaatatgg tccacttgtg 6780
gaagaggaag agaaagtgcc tgtgaggccc aaggaccctg agggggttcc tcctctcctg 6840
gtctctcaac aggcaaaacg ggaggaggag cgcagcccag ctgccccacc acctctgcct 6900
accacctcct ctggcaaggc tgcaaagaaa cccacagctg cagaggtctc tgttcgagtc 6960
cctagagggc cggccgtgga agggggacac gtgaatatgg cattctctca gtccaaccct 7020
ccttcggagt tgcacagggt ccacggatcc agaaacaagc ccaccagctt gtggaaccca 7080
acgtacggct cctggtttac agagaaaccc accaaaaaga ataatcctat agcaaagaag 7140
gagccacacg agaggggtaa cctggggctg gagggaagct gtactgtccc acctaacgtt 7200
gcaactggga gacttccggg ggcctcactg ctcctagagc cctcttcgct gactgccaat 7260
atgaaggagg tacctctgtt caggctacgt cacttccctt gtgggaatgt caattacggc 7320
taccagcaac agggcttgcc cttagaagcc gctactgccc ctggagctgg tcattacgag 7380
gataccattc tgaaaagcaa gaatagcatg aaccagcctg ggccctgaag cggccgcata 7440
ctagtaactc ctcaggtgca ggctgcctat cagaaggtgg tggctggtgt ggccaatgcc 7500
ctggctcaca aataccactg agatcttttt ccctctgcca aaaattatgg ggacatcatg 7560
aagccccttg agcatctgac ttctggctaa taaaggaaat ttattttcat tgcaatagtg 7620
tgttggaatt ttttgtgtct ctcactcgga aggacatatg ggagggcaaa tcatttaaaa 7680
catcagaatg agtatttggt ttagagtttg gcaacatatg cccatatgct ggctgccatg 7740
aacaaaggtt ggctataaag aggtcatcag tatatgaaac agccccctgc tgtccattcc 7800
ttattccata gaaaagcctt gacttgaggt tagatttttt ttatattttg ttttgtgtta 7860
tttttttctt taacatccct aaaattttcc ttacatgttt tactagccag atttttcctc 7920
ctctcctgac tactcccagt catagctgtc cctcttctct tatgaagatc cctcgacggc 7980
gcgcctggtc taaatgtgat tttgccaagc ttcttcagga cctataattt tgcttgactt 8040
gtagccaaac acaagtaaaa tgattaagca acaaatgtat ttgtgaagct tggtttttag 8100
gttgttgtgt tgtgtgtgct tgtgctctat aataatacta tccaggggct ggagaggtgg 8160
ctcggagttc aagagcacag actgctcttc cagaagtcct gagttcaatt cccagcaacc 8220
acatggtggc tcacaaccat ctgtaatggg atctgatgcc ctcttctggt gtgtctgaag 8280
accacaagtg tattcacatt aaataaataa atcctccttc ttcttctttt tttttttttt 8340
aaagagaata ctgtctccag tagaatttac tgaagtaatg aaatactttg tgtttgttcc 8400
aatatggtag ccaataatca aattactctt taagcactgg aaatgttacc aaggaactaa 8460
tttttatttg aagtgtaact gtggacagag gagccataac tgcagacttg tgggatacag 8520
aagaccaatg cagactttaa tgtcttttct cttacactaa gcaataaaga aataaaaatt 8580
gaacttctag tatcctattt gtttaaactg ctagctttac ttaacttttg tgcttcatct 8640
atacaaagct gaaagctaag tctgcagcca ttactaaaca tgaaagcaag taatgataat 8700
tttggatttc aaaaatgtag ggccagagtt tagccagcca gtggtggtgc ttgcctttat 8760
gcctttaatc ccagcactct ggaggcagag acaggcagat ctctgagttt gagcccagcc 8820
tggtctacac atcaagttct atctaggata gccaggaata cacacagaaa ccctgttggg 8880
gaggggggct ctgagatttc ataaaattat aattgaagca ttccctaatg agccactatg 8940
gatgtggcta aatccgtcta cctttctgat gagatttggg tattattttt tctgtctctg 9000
ctgttggttg ggtcttttga cactgtgggc tttctttaaa gcctccttcc tgccatgtgg 9060
tctcttgttt gctactaact tcccatggct taaatggcat ggctttttgc cttctaaggg 9120
cagctgctga gatttgcagc ctgatttcca gggtggggtt gggaaatctt tcaaacacta 9180
aaattgtcct ttaatttttt ttttaaaaaa tgggttatat aataaacctc ataaaatagt 9240
tatgaggagt gaggtggact aatattaaat gagtccctcc cctataaaag agctattaag 9300
gctttttgtc ttatacttaa cttttttttt aaatgtggta tctttagaac caagggtctt 9360
agagttttag tatacagaaa ctgttgcatc gcttaatcag attttctagt tt 9412
<210> 12
<211> 23
<212> RNA
<213>Artificial sequence (Artificial Sequence)
<400> 12
ggcauucuac acguuauugc ugg 23
<210> 14
<211> 22
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 14
ggacagatag ctggcgtgga ta 22
<210> 14
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 14
tccggacacc tggccttcat 20
<210> 15
<211> 750
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 15
ggacagatag ctggcgtgga taaagatgga aggcctctac aaccccacgt cagagtgtgg 60
gattctgtta ctctatccac actgcagatt attggacttg gcacttttga gcgtggagta 120
ggatgcctgg atttttcaaa agcagattca ggtgttcatt tatgtgttat tgatgactcc 180
aatgagcata tgcttactgt atgggactgg cagaagaaag caaaaggagc agaaataaag 240
acaacaaatg aagttgtttt ggctgtggag tttcacccaa cagatgcaaa taccataatt 300
acatgcggta aatctcatat tttcttctgg acctggagcg gcaattcact aacaagaaaa 360
cagggaattt ttgggaaata tgaaaagcca aaatttgtgc agtgtttagc attcttgggg 420
aatggagatg ttcttactgg agactcaggt ggagtcatgc ttatatggag caaaactact 480
gtagagccca cacctgggaa aggacctaaa gtgtaccgcc ggaagcacca ggagctgcaa 540
gccatgcaga tggagctgca gagccctgag tacaagctga gcaagctccg cacctcgacc 600
atcatgaccg actacaaccc caactactgc tttgctggca agacctcctc catcagtgac 660
ctgaaggagg tgccgcggaa aaacatcacc ctcattcggg gtctgggcca tggagccttt 720
ggggaggtgt atgaaggcca ggtgtccgga 750
<210> 16
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 16
cccaaagtcg ctctgagttg 20
<210> 17
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 17
ggcgggccat ttaccgtaag 20
<210> 18
<211> 1402
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 18
ggcgggccat ttaccgtaag ttatgtaacg cggaactcca tatatgggct atgaactaat 60
gaccccgtaa ttgattacta ttaataacta gcttaaataa cgtgtagaat gccatgagtc 120
aagccagtcc aagagaaagc actgcttaaa tagaaaaaat acaagctcac aagaccttag 180
gtcaggaaag acaacaaaca cctgaacttt gcattccaaa aggaaccacc ttttacagat 240
gtgtacaatg acaaaatttt agtaagcagt aatcaatacc atgtggctca ataatgaaat 300
atacctttta atgtcttaaa atatcagcct ggcaatatgt aagatacatc aggtaatatt 360
gggggaggag acatccacct ggaaaccatt aatggttaat agctcagttt ataaatggag 420
aaaaaggaga gaggcattca tgggagtgga aagttaagct ttaggttgga ttctcaatac 480
atctattgtt gtaaaactcc ctggactgag aataggccca aatgtggaac accacctgac 540
gggagaggtg atagacactg aaaattaagg atcaaggcaa aggatcaaca aaaagtgtac 600
taaggagtta taaaagaact gcagtgttga ggccccagct acagcctcga tttgtggtgt 660
atgtaactaa tctgtctggt ttcatgagtc atcagacttc taagatcagg aaagggaaaa 720
tgccaatgct ctgtctaggg gttggataag ccagtataat aaatgaaaat ggggctaaaa 780
tgagtgttct aaaatacctt ttgataaggc tgcagaagga gcgggagaaa tggatatgaa 840
gtactgggct ctttaaaaat gattaaaatt ctgcttacat agtctaactc gcgacactgt 900
aatttcatac tgtagtaagg atctcaagca ggagagtata aaactcgggt gagcatgtct 960
ttaatctacc tcgatggaaa atactccgag gcggatcaca agcaataata acctgtagtt 1020
ttgctgcata aaaccccaga tgactaccta tcctcccatt ttccttattt gcccctatta 1080
aaaaacttcc cgacaaaacc gaaaatctgt gggaagtctt gtccctccaa ttttacacct 1140
gttcaattcc cctgcaggac aacgcccaca caccaggtta gcctttaagc ctgcccagaa 1200
gactcccgcc catcttctag aaagactgga gttgcagatc acgagggaag agggggaagg 1260
gattctccca ggcccagggc ggtcctcaga agccaggagg cagcagagaa ctcccagaaa 1320
ggtattgcaa cactcccctc ccccctccgg agaagggtgc ggccttctcc ccgcctactc 1380
cactgcagct cccttactga ta 1402
<210> 19
<211> 28
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 19
ccatagaaaa gccttgactt gaggttag 28
<210> 20
<211> 25
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 20
gactttggct gtgaagaatt tggat 25
<210> 21
<211> 1633
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 21
gactttggct gtgaagaatt tggattctct ggatttgaaa ctagaaaatc tgattaagcg 60
atgcaacagt ttctgtatac taaaactcta agacccttgg ttctaaagat accacattta 120
aaaaaaaagt taagtataag acaaaaagcc ttaatagctc ttttataggg gagggactca 180
tttaatatta gtccacctca ctcctcataa ctattttatg aggtttatta tataacccat 240
tttttaaaaa aaaaattaaa ggacaatttt agtgtttgaa agatttccca accccaccct 300
ggaaatcagg ctgcaaatct cagcagctgc ccttagaagg caaaaagcca tgccatttaa 360
gccatgggaa gttagtagca aacaagagac cacatggcag gaaggaggct ttaaagaaag 420
cccacagtgt caaaagaccc aaccaacagc agagacagaa aaaataatac ccaaatctca 480
tcagaaaggt agacggattt agccacatcc atagtggctc attagggaat gcttcaatta 540
taattttatg aaatctcaga gcccccctcc ccaacagggt ttctgtgtgt attcctggct 600
atcctagata gaacttgatg tgtagaccag gctgggctca aactcagaga tctgcctgtc 660
tctgcctcca gagtgctggg attaaaggca taaaggcaag caccaccact ggctggctaa 720
actctggccc tacatttttg aaatccaaaa ttatcattac ttgctttcat gtttagtaat 780
ggctgcagac ttagctttca gctttgtata gatgaagcac aaaagttaag taaagctagc 840
agtttaaaca aataggatac tagaagttca atttttattt ctttattgct tagtgtaaga 900
gaaaagacat taaagtctgc attggtcttc tgtatcccac aagtctgcag ttatggctcc 960
tctgtccaca gttacacttc aaataaaaat tagttccttg gtaacatttc cagtgcttaa 1020
agagtaattt gattattggc taccatattg gaacaaacac aaagtatttc attacttcag 1080
taaattctac tggagacagt attctcttta aaaaaaaaaa aaagaagaag aaggaggatt 1140
tatttattta atgtgaatac acttgtggtc ttcagacaca ccagaagagg gcatcagatc 1200
ccattacaga tggttgtgag ccaccatgtg gttgctggga attgaactca ggacttctgg 1260
aagagcagtc tgtgctcttg aactccgagc cacctctcca gcccctggat agtattatta 1320
tagagcacaa gcacacacaa cacaacaacc taaaaaccaa gcttcacaaa tacatttgtt 1380
gcttaatcat tttacttgtg tttggctaca agtcaagcaa aattataggt cctgaagaag 1440
cttggcaaaa tcacatttag accagctcga gggatcttca taagagaaga gggacagcta 1500
tgactgggag tagtcaggag aggaggaaaa atctggctag taaaacatgt aaggaaaatt 1560
ttagggatgt taaagaaaaa aataacacaa aacaaaatat aaaaaaaatc taacctcaag 1620
tcaaggcttt tct 1633
Claims (5)
- A kind of 1. method for evaluating the lung cancer therapy effect that medicine drives to EML4-ALK L1196M oncogenes, it is characterised in that Comprise the following steps:(1) using PCR method amplification EML4-ALK L1196M genetic fragments and at its 5 ' end and 3 ' ends respectively plus EcoRI and NotI restriction enzyme sites, resulting fragment is connected on pClatent plasmids, obtains pClatent-EML4-ALK L1196M Plasmid;By the use of two sections of site of PCR method amplification mouse rosa 26 sequence as homology arm, pass through EcoRV and PacI, EcoRV respectively It is inserted into AscI on pClatent-EML4-ALK L1196M plasmids, so as to obtain mRosa-lsl-EML4-ALK L1196M Plasmid;The carrier segments on plasmid are cut away with EcoRV enzymes, obtain 5 ' mROSA-CAG-lox-stop-lox-EML4-ALK L1196M-3 ' mROSA genetic fragments;The sequence such as SEQ.ID.NO.1 institutes of the EML4-ALK L1196M genetic fragments plus restriction enzyme site described in step (1) Show;Two sections of the mouse rosa 26 site of step (1) sequence is respectively as shown in SEQ.ID.NO.9 and SEQ.ID.NO.10;5 '-mROSA-CAG-lox-stop-lox-EML4-ALK L1196M-3 ' mROSA genetic fragments described in step (1) its Sequence is as shown in SEQ.ID.NO.11;(2) by the mROSA- of transgenic fragment 5 ' of Cas9mRNA fragments, gRNA fragments and inducible expression EML4-ALK L1196M CAG-lox-stop-lox-EML4-ALK L1196M-3 ' mROSA are mixed, and mixture is expelled into mouse by microinjection In embryo, cas9 cuts ROSA26 sites under gRNA guiding, is inserted the genetic fragment of inducible expression by homologous recombination Enter genome;GRNA described in step (2), its sequence is as shown in SEQ.ID.NO.12;(3) transgenic embryo transfer that step (2) obtains is entered into replace-conceive mouse uterus, raises and treat that mouse is born, three pairs of design is drawn Thing enters performing PCR identification to 5 ' insertion points, 3 ' insertion points and EML4-ALK L1196M genes respectively, screens total positives Transgenic mice;(4) virus containing CRE recombinant protein enzyme genes is instilled mouse by the Mouse feeder of transgenic positive to growing up from nasal cavity In lung, so that by the EML4-ALK L1196M oncogene activations in pulmonary epithelial cells, mouse obtains adenocarcinoma of lung after 20 days;Pass through CT Detection and pathological section confirm the presence of cancerous lung tissue;(5) mouse is administered, administration terminates, CT detection lung cancer sizes, compared with the size before treatment;(6) after treatment end, mouse is put to death, prepares the pathological section of mouse lung tissue, reads the lung cancer pathology on pathological section Change;Again with CT associations, the ability that drug therapy EML4-ALK L1196M drive lung cancer is judged.
- 2. according to the method for claim 1, it is characterised in that:In mixture described in step (2), Cas9mRNA fragments Concentration is 80ng/ μ L;The concentration of gRNA fragments is 30ng/ μ L;The mROSA-CAG-lox-stop-lox- of transgenic fragment 5 ' EML4-ALK L1196M-3 ' mROSA concentration is 8ng/ μ L.
- 3. according to the method for claim 1, it is characterised in that:Injection described in step (2), injection volume 15pL.
- 4. according to the method for claim 1, it is characterised in that:Transgenic embryo transfer is entered into replace-conceive described in step (3) Mouse uterus, it is after the replace-conceive mouse anesthesia by false pregnancy, from belly opening, exposes fallopian tubal mouth, transgenic embryo transfer is entered into generation Behind pregnant mouse uterus, skin is closed with wound clips.
- 5. according to the method for claim 1, it is characterised in that:Adult described in step (4) is 6-8 week old.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201710903091.3A CN107828823A (en) | 2017-09-29 | 2017-09-29 | A kind of method of evaluation EML4 ALK inhibitor to lung cancer therapy effect |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201710903091.3A CN107828823A (en) | 2017-09-29 | 2017-09-29 | A kind of method of evaluation EML4 ALK inhibitor to lung cancer therapy effect |
Publications (1)
Publication Number | Publication Date |
---|---|
CN107828823A true CN107828823A (en) | 2018-03-23 |
Family
ID=61644126
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201710903091.3A Pending CN107828823A (en) | 2017-09-29 | 2017-09-29 | A kind of method of evaluation EML4 ALK inhibitor to lung cancer therapy effect |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN107828823A (en) |
Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2011060328A1 (en) * | 2009-11-13 | 2011-05-19 | Infinity Pharmaceuticals, Inc. | Compositions, kits, and methods for identification, assessment, prevention, and therapy of cancer |
WO2012006589A2 (en) * | 2010-07-08 | 2012-01-12 | Infinity Pharmaceuticals, Inc. | Methods and compositions for identification, assessment and treatment of cancers associated with hedgehog signaling |
CN103937877A (en) * | 2010-02-04 | 2014-07-23 | 自治医科大学 | Identification, Assessment, And Therapy Of Cancers With Innate Or Acquired Resistance To Alk Inhibitors |
-
2017
- 2017-09-29 CN CN201710903091.3A patent/CN107828823A/en active Pending
Patent Citations (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2011060328A1 (en) * | 2009-11-13 | 2011-05-19 | Infinity Pharmaceuticals, Inc. | Compositions, kits, and methods for identification, assessment, prevention, and therapy of cancer |
CN102713606A (en) * | 2009-11-13 | 2012-10-03 | 无限制药股份有限公司 | Compositions, kits, and methods for identification, assessment, prevention, and therapy of cancer |
CN103937877A (en) * | 2010-02-04 | 2014-07-23 | 自治医科大学 | Identification, Assessment, And Therapy Of Cancers With Innate Or Acquired Resistance To Alk Inhibitors |
WO2012006589A2 (en) * | 2010-07-08 | 2012-01-12 | Infinity Pharmaceuticals, Inc. | Methods and compositions for identification, assessment and treatment of cancers associated with hedgehog signaling |
Non-Patent Citations (3)
Title |
---|
CHOI,Y.L.,ET AL: "EML4-ALK Mutations in Lung Cancer That Confer Resistance to ALK Inhibitors", 《THE EEW ENGLAND JOURNAL OF MEDICINE》 * |
PYO,K.H., ET AL: "Establishment of a Conditional Transgenic Mouse Model Recapitulating EML4-ALK–Positive Human Non–Small Cell Lung Cancer", 《JOURNAL OF THORACIC ONCOLOGY》 * |
黄诚 等: "RAS 突变在EML4⁃ALK 阳性肺癌联合治疗中的作用", 《循证医学》 * |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN107119021A (en) | PD 1 knocks out the preparation of CD19CAR T cells | |
CN112921054B (en) | Lentiviral vector for treating beta-thalassemia and preparation method and application thereof | |
CN104593413A (en) | Method for synthesizing secreted human serum albumin employing bombyx mori posterior silk gland | |
US20030053988A1 (en) | Inducible alphaviral gene expression system | |
CN108864310A (en) | A kind of building and its application of the CAR-T cell for targeting mesothelin and carrying PD-Ll blocking agent | |
CN111235118B (en) | Human type 3 adenovirus replication-defective recombinant virus, construction method and application | |
CN107384920B (en) | Base editing system based on streptococcus pyogenes and application of base editing system in gene editing | |
US20040197855A1 (en) | Test system for determining gene toxicities | |
CN107828823A (en) | A kind of method of evaluation EML4 ALK inhibitor to lung cancer therapy effect | |
CN112980799B (en) | Method for constructing KLF12 high-expression mouse and application of method in construction of folate-independent neural tube defect mouse model | |
CN107267538B (en) | A kind of construction method of plant plastid expression vector and application | |
US6503712B1 (en) | Methods and compositions for preparing a genomic library for knockout targeting vectors | |
CN111041027B (en) | Construction method and application of Atg12 gene knockout cell line | |
CN114540355A (en) | HHEX cartilage tissue specificity knockout mouse animal model and construction method thereof | |
CN113755442B (en) | Cell strain for measuring pharmaceutical activity and preparation method and application thereof | |
CN112159819B (en) | Method for constructing domestic silkworm strain of yellow croaker growth hormone bioreactor | |
CN110452893B (en) | Construction and application of high-fidelity CRISPR/AsCpf1 mutant | |
CN107233574B (en) | Use of CREBZF in treatment, prevention and diagnosis of metabolic diseases | |
KR102624832B1 (en) | Production of transgenic dogs overexpressing muscle-specific peroxisome proliferator-activated receptor delta (PPARδ). | |
CN106591369A (en) | Method for targeted editing of buffalo 18S rDNA gene by virtue of adenovirus system | |
CN109777829A (en) | A kind of construction method of the sgRNA expression component of gene editing U6 promoter driving | |
CN110331170A (en) | The gene expression element and its construction method of a kind of dual gRNA and application | |
CN110272917A (en) | A set of fast and accurately three plasmid oncolytic adenovirus recombination packaging system Ad5MixPlus and its application | |
CN110055280A (en) | A kind of cell line and its construction method and application of stable expression mCherry-tau | |
CN102649961B (en) | Aptamer sequence of hepatitis B virus (HBV) core antigen and application of nucleic aptamer sequence |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PB01 | Publication | ||
PB01 | Publication | ||
SE01 | Entry into force of request for substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
RJ01 | Rejection of invention patent application after publication | ||
RJ01 | Rejection of invention patent application after publication |
Application publication date: 20180323 |