CN107828823A - A kind of method of evaluation EML4 ALK inhibitor to lung cancer therapy effect - Google Patents

Abstract

The invention discloses a kind of method for evaluating the lung cancer therapy effect that medicine drives to EML4 ALK L1196M oncogenes, this method is to build the mROSA genetic fragments of 5 ' mROSA CAG lox stop lox EML4 ALK L1196M 3 ' in vitro, then by the genetic fragment and cas9 enzymes and gRNA co-injections into the embryo of mouse, the mouse containing homologous recombination gene is identified after mouse birth, treat that mouse is developed to adult, activate EML4 ALK L1196M oncogenes, the primary tumor of lung cancer will be induced, then to mouse drug treatment, therapeutic effect is evaluated.The evaluation method of the present invention can truly simulate the clinical process of lung cancer, and performance of the medicine in lung cancer clinical can be predicted exactly using the mouse model of the present invention：The acute toxicity of accurate evaluation medicine, chronic toxicity, pharmacokinetics, the therapeutic effect to lung cancer.

Description

A kind of method of evaluation EML4-ALK inhibitor to lung cancer therapy effect

Technical field

The invention belongs to biomedicine field, and in particular to one kind evaluation medicine drives to EML4-ALK L1196M oncogenes The method of dynamic lung cancer therapy effect.

Background technology

Lung cancer is the incidence of disease and fatal rate highest cancer in global range.Lung cancer is divided into ED-SCLC and non-small cell Lung cancer.Non-small cell lung cancer is divided into gland cancer, squamous carcinoma and large cell carcinoma by histological type again.Being of conventional treatments of lung cancer Treat, but it is limited the effect of chemotherapy, and have larger side effect.

In recent years, targeted therapies illustrate good clinical manifestation in lung cancer therapy.The theory of targeted therapy Basis is：The existence of lung carcinoma cell depends on a specific protein constantly perform function, rather than cancerous lung tissue cell then to disobey Rely；With the inhibitor for treating patient of the albumen, the death of lung carcinoma cell can be caused, and other cells are then unaffected.Therefore, target There is the characteristics of high efficiency, low side effect to treatment.

EML4-ALK fusion oncogenes are positive in about 5% lung cancer in China patient.Clinically use EML4-ALK suppression Preparation can effectively treat the lung cancer of the gene masculine (as gram azoles replaces Buddhist nun).But the lung cancer of these patients is after of short duration regression It can recur again.One major reason of recurrence is that EML4-ALK fusions are mutated in itself, causes medicine to press down again EML4-ALK processed Kinase activity.L1196M is mutation of the clinically common anti-gram azoles for the EML4-ALK of Buddhist nun's medicine.Exploitation The EML4-ALK of anti-L1196M mutation medicine is a focus of current research field, also has some medicines doing clinical examination Test or granted applied to clinic.

At present, two classes can be probably divided into by evaluating the method for the EML4-ALK of L1196M mutation inhibitor for treating lung cancer： Cell model and Transplanted tumor model.Now with some lung carcinoma cells or the laborious transferring cell formed, its survival depends on EML4- The lasting function of ALK L1196M mutant.The function of the cancer protein is closed with inhibitor will cause Apoptosis.Measure is withered Die the ability that seriousness can reflect the inhibitor for treating lung cancer.It is this that drug therapy EML4-ALK is determined directly on cell The method of L1196M effects, there is the shortcomings that its is intrinsic：Performance of the medicine on live body can not be reflected, such as acute toxicity is chronic Toxicity, pharmacokinetics etc..

Another method is that above-mentioned cell is transplanted on the mouse of immune deficiency, after mouse grows transplantable tumor, medication Thing treats mouse, measures the Volume Changes of tumour to infer the therapeutic effect of medicine.The shortcomings that model is：The transplantable tumor of inoculation The microenvironment of real simulation lung cancer generation is unable to, while immune system plays an important role in tumor therapeutic procedure.Therefore, The probability for having comparison high to evaluate the ability of drug therapy lung cancer with the transplantable tumor of immune deficiency is judged by accident：I.e. medicine is being transplanted On knurl model effectively, do not imitate clinically.

The content of the invention

The defects of in order to overcome prior art, it is an object of the invention to provide one kind evaluation medicine to EML4-ALK The method of the lung cancer therapy effect of L1196M oncogenes driving, the key of this method is to build 5 ' mROSA-CAG-lox- in vitro Stop-lox-EML4-ALK L1196M-3 ' mROSA genetic fragments, it is then that the genetic fragment and cas9 enzymes and sgRNA is common It is expelled in the embryo of mouse, identifies the mouse containing homologous recombination gene after mouse birth, treat that mouse is developed to adult, activate EML4-ALK L1196M oncogenes, the primary tumor of lung cancer will be induced, then to mouse drug treatment, evaluate therapeutic effect.This The evaluation method of invention can simulation tumor microenvironment in patient body to greatest extent, be a kind of more science and objective appraisal side Method.

The purpose of the present invention is achieved through the following technical solutions：

A kind of method for evaluating the lung cancer therapy effect that medicine drives to EML4-ALK L1196M oncogenes, including it is following Step：

(1) added respectively using PCR method amplification EML4-ALK L1196M genetic fragments and at its 5 ' end and 3 ' ends EcoRI and NotI restriction enzyme sites, resulting fragment is connected on pClatent plasmids, obtains pClatent-EML4-ALK L1196M plasmids；Expand mouse rosa 26 two sections of site sequence as homology arm by the use of PCR method, respectively by EcoRV and PacI, EcoRV and AscI is inserted on pClatent-EML4-ALK L1196M plasmids, so as to obtain mRosa-lsl-EML4-ALK L1196M plasmids；The carrier segments (2.7Kb) on plasmid are cut away with EcoRV enzymes, obtain 5 ' mROSA-CAG-lox-stop- Lox-EML4-ALK L1196M-3 ' mROSA genetic fragments (9.5Kb)；

The sequence such as SEQ.ID.NO.1 of the EML4-ALK L1196M genetic fragments plus restriction enzyme site described in step (1) It is shown；

Two sections of the mouse rosa 26 site of step (1) sequence is respectively as shown in SEQ.ID.NO.9 and SEQ.ID.NO.10；

5 '-mROSA-CAG-lox-stop-lox-EML4-ALK L1196M-3 ' mROSA gene pieces described in step (1) Its sequence of section is as shown in SEQ.ID.NO.11；

(2) by the transgenic fragment 5 ' of Cas9mRNA fragments, gRNA fragments and inducible expression EML4-ALK L1196M MROSA-CAG-lox-stop-lox-EML4-ALK L1196M-3 ' mROSA are mixed, and are expelled to mixture by microinjection In the embryo of mouse, cas9 cuts ROSA26 sites under gRNA guiding, by homologous recombination by the gene of inducible expression Fragment inserts genome；

In mixture described in step (2), the preferred 80ng/ μ L of concentration of Cas9mRNA fragments；The concentration of gRNA fragments is excellent Select 30ng/ μ L；The mROSA-CAG-lox-stop-lox-EML4-ALKL1196M-3 ' of transgenic fragment 5 ' mROSA concentration is preferred 8ng/μL；

GRNA described in step (2), its sequence is as shown in SEQ.ID.NO.12；

Injection described in step (2), the preferred 15pL of injection volume；

(3) transgenic embryo transfer that step (2) obtains is entered into replace-conceive mouse uterus, raises and treat that mouse is born, design three Enter performing PCR identification to 5 ' insertion points, 3 ' insertion points and EML4-ALK L1196M genes respectively to primer, screen all sun The transgenic mice of property；

Transgenic embryo transfer is entered to replace-conceive mouse uterus described in step (3), is after the replace-conceive mouse of false pregnancy is anaesthetized, from abdomen Portion's opening, fallopian tubal mouth is exposed, after transgenic embryo transfer is entered into replace-conceive mouse uterus, skin is closed with wound clips；

(4) Mouse feeder of transgenic positive instills the virus containing CRE recombinant protein enzyme genes from nasal cavity to growing up In mouse lung, so that by the EML4-ALK L1196M oncogene activations in pulmonary epithelial cells, mouse obtains adenocarcinoma of lung after 20 days；It is logical Crossing CT detections and pathological section confirms the presence of cancerous lung tissue；

Adult described in step (4) is 6-8 week old；

(5) mouse is administered, administration terminates, CT detection lung cancer sizes, compared with the size before treatment；

(6) after treatment end, mouse is put to death, prepares the pathological section of mouse lung tissue, reads the lung cancer on pathological section Pathological change；Again with CT associations, the ability that drug therapy EML4-ALK L1196M drive lung cancer is judged.

The present invention is had the following advantages relative to prior art and effect：

Farthest the pulmonary carcinosis that EML4-ALK L1196M drive can be treated using the method for the present invention by aids drug People, really simulates generation of the lung cancer from oncogene, pulmonary epithelial cells canceration, the formation of lung cancer, and last mouse dies from lung cancer Clinical process.Performance of the medicine in lung cancer clinical can be predicted exactly using the mouse model of the present invention：Accurately comment The acute toxicity of valency medicine, chronic toxicity, pharmacokinetics, the therapeutic effect to lung cancer.

Brief description of the drawings

Fig. 1 is the electrophoretogram of EML4-ALK L1196M fragment PCR products；Wherein, swimming lane 1 and 2 is PCR primer.

Fig. 2 is EML4-ALK L1196M mouse first to primer PCR product electrophoretogram；Wherein, swimming lane 11 is PCR primer.

Fig. 3 is EML4-ALK L1196M mouse second to primer PCR product electrophoretogram；Wherein, swimming lane 11 is PCR primer.

Fig. 4 is the 3rd pair of primer PCR product electrophoretogram of EML4-ALK L1196M mouse；Wherein, swimming lane 11 is PCR primer.

Fig. 5 is with the pretherapy and post-treatment lung cancer CT testing result figures of PF-06463922；Wherein, the result before A- treatments, B- treatments Result afterwards.

Fig. 6 is with the pretherapy and post-treatment lung cancer CT testing result figures of Ceritinib；Wherein, the result before A- treatments, after B- treatments Result.

Fig. 7 is lung cancer CT testing result figures before and after HKI Solution In The Treatments；Wherein, the result before A- treatments, the knot after B- treatments Fruit.

Fig. 8 is the pathological section figure of mouse lung tissue；Wherein, result before A- treatments, B- is the knot after HKI Solution In The Treatments Fruit, C- treated with PF-06463922 after result, D- treated with Ceritinib after result.

Embodiment

With reference to embodiment and accompanying drawing, the present invention is described in further detail, but embodiments of the present invention are unlimited In this.

Embodiment

A kind of method for evaluating the lung cancer therapy effect that medicine drives to EML4-ALK L1196M oncogenes, including it is following Step：

(1) using PCR method amplification EML4-ALK L1196M genetic fragments (deriving from people, Homosapiens) and at it 5 ' ends and 3 ' ends add EcoRI and NotI restriction enzyme sites respectively, and gained gene fragment order is as shown in SEQ.ID.NO.1, sequence Length 3.2Kb；The electrophoretogram of PCR primer is as shown in Figure 1；

Primer sequence is：

Sense primer：5’-3’cggaattcatggacggtttcgccggcag(SEQ.ID.NO.2)

Anti-sense primer：5’-3’tatgcggccgcttcagggcccaggctggttca(SEQ.ID.NO.3)

By pClatent plasmids, (construction method is shown in document Mikse OR., et.al., The impact of the MYB- NFIB fusion protooncogene in vivo.Oncotarget.2016May 18.doi:10.18632/ Oncotarget.9426 double digestion) is carried out with EcoRI and NotI enzymes, recovery obtains pClatent linearized fragments, and (sequence is such as Shown in SEQ.ID.NO.4)；This fragment is entered with EML4-ALK L1196M genetic fragments (SEQ.ID.NO.1) by T4 ligases The Escherichia coli of row connection transformed competence colibacillus, picking monoclonal, obtain pClatent-EML4-ALK L1196M plasmids.

Design following two pairs of primers：

Primer 1：

Sense primer：5’-3’ccgatatcaggcctgtgcacctcctggcttctgaggacc(SEQ.ID.NO.5)

Anti-sense primer：5’-3’agcttaattaacgtgtagaatgccatga(SEQ.ID.NO.6)

Primer 2：

Sense primer：5’-3’acggcgcgcctggtctaaatgtgattttg(SEQ.ID.NO.7)

Anti-sense primer：5’-3’ccgatatcaggcctgtgcacaaactagaaaatctgattaa(SEQ.ID.NO.8)

With PCR method, using mouse (Mus musculus) B6 genome as two sections of template amplification mouse rosa 26 site Sequence is as homology arm；Two sections of sequences are respectively as shown in SEQ.ID.NO.9 and SEQ.ID.NO.10；

It is inserted into respectively by EcoRV and PacI and EcoRV and AscI on pClatent-EML4-ALKL1196M plasmids, So as to obtain mRosa-lsl-EML4-ALK L1196M plasmids；The carrier segments of 2.7kb on plasmid are cut away by EcoRV enzymes, 5 '-mROSA-CAG-lox-stop-lox-EML4-ALK L1196M-3 ' mROSA genetic fragments can be obtained, and (sequence is such as Shown in SEQ.ID.NO.11)；

(2) by 5 '-mROSA-CAG-lox-stop-lox-EML4-ALK L1196M-3 ' mROSA bases of inducible expression Because fragment and cas9mRNA and gRNA (sequence as shown in SEQ.ID.NO.12, document Chu VT., et.al., BMC Biotechnol.2016Jan 16；16:4.Efficient generation of Rosa26knock-in mice using CRISPR/Cas9in C57BL/6zygotes. are also on the books) mixing, with 8ng/ μ L, 80ng/ μ L and 30ng/ μ L final concentration, Mixture is injected into the embryo of mouse by 15pL by microinjection.Cas9 cuts ROSA26 sites under gRNA guiding, The genetic fragment of inducible expression is inserted by genome by homologous recombination；

(3) after the replace-conceive mouse anesthesia of false pregnancy, from belly opening, fallopian tubal mouth is exposed, transgenic embryo transfer is entered small Behind mouse uterus, skin is closed with wound clips；Treat that mouse is born, three pairs of primers of design are respectively to 5 ' insertion points, 3 ' insertion points Enter performing PCR identification with EML4-ALK L1196M genes, screen the transgenic mice of total positives；

It is as follows for the pair of primers of 5 ' insertion points design, its sequence：

Sense primer：5’-3’ggacagatagctggcgtggata(SEQ.ID.NO.13)

Anti-sense primer：5’-3’tccggacacctggccttcat(SEQ.ID.NO.14)

The sequence of PCR primer is as shown in SEQ.ID.NO.15, sequence length 750bp, and electrophoretogram is as shown in Figure 2；

It is as follows for second pair of primer of 3 ' insertion points design, its sequence：

Sense primer：5’-3’cccaaagtcgctctgagttg(SEQ.ID.NO.16)

Anti-sense primer：5’-3’ggcgggccatttaccgtaag(SEQ.ID.NO.17)

The sequence of PCR primer is as shown in SEQ.ID.NO.18, sequence length 1402bp, and electrophoretogram is as shown in Figure 3；

It is as follows for the 3rd pair of primer of EML4-ALK L1196M genes design, its sequence：

Sense primer：5’-3’:ccatagaaaagccttgacttgaggttag(SEQ.ID.NO.19)

Anti-sense primer：5’-3’gactttggctgtgaagaatttggat(SEQ.ID.NO.20)

The sequence of PCR primer is as shown in SEQ.ID.NO.21, sequence length 1633bp, and electrophoretogram is as shown in Figure 4；

(4) transgenic mice is raised, when mouse is grown to 6 week old, the virus (purchase containing CRE recombinant protein enzyme genes From lucky triumphant gene, AAV-cre) instilled from nasal cavity in mouse lung, so as to by the EML4-ALK L1196M cancer bases in pulmonary epithelial cells Because of activation, mouse obtains adenocarcinoma of lung after 20 days；The presence of cancerous lung tissue is confirmed by CT detections and pathological section；

(5) dissolve PF-06463922 respectively with HKI solution (Tween 80 of 0.5% methylcellulose -0.4%) (Laura replaces Buddhist nun) and Ceritinib (Ceritinib), and respectively with 10mg/kg and 50mg/kg dosage to mouse stomach.Control group is only used Above-mentioned HKI solution gavage.PF-06463922 is taken twice daily, and Ceritinib is administered once a day, continuous 2 week.So Lung cancer size is detected with CT afterwards, compared with the size before treatment；

(6) after treatment end, mouse is put to death, prepares the pathological section of mouse lung tissue, reads the lung cancer on pathological section Pathological change；Again with CT associations, the ability that drug therapy EML4-ALK L1196M drive lung cancer is judged.

Administration group and the treatment results of control group are shown in Table 1：

Table 1

Mouse in embodiment, via intranasal application irrigated CRE adenovirus after 20 days, and mouse starts to breathe, hunchbacked and fried hair Phenomena such as.Detected by CT, it is found that there is shade and shadow in lung, be suspected to be lung cancer (such as Fig. 7 A).Pathological analysis, hair are carried out to the mouse lung There is poorly differentiated adenocarcinoma in existing lung, with the bronchoalveolar cancer of disperse, and atypical hyperplasia (such as Fig. 8 A).Illustrate in pulmonary epithelial cells Expression EML4-ALK L1196M mutation physical efficiency quickly forms tumour.

Gavage (is compareed) as without medicine by the use of HKI solution to tumor-bearing mice to treat, and the development of mice lung cancer is recorded with CT. As a result lung's shade and shadow in the treatment of two weeks is shown in continue to expand (such as Fig. 7 B).After treatment end, to the lung pathologies point of mouse Analysis finds that the nuclear staining of lung carcinoma cell is shallow, and the volume of cell is big, and the core inhomogeneity between different cells is strong, shows at lung cancer In strong active stage (such as Fig. 8 B).As a result the mice lung cancer rapid progress of control group is illustrated.

From two EML4-ALK suppression medicine：PF-06463922 and Ceritinib.After being dissolved with HKI solution, point The two medicines are not treated to mouse stomach, and record the situation of lung cancer by CT afterwards before administration.CT results show PF- Lung's shade and shadow rapid regression (such as Fig. 5 B) of 06463922 treatment group mouse.Prompt lung cancer response treatment.

Pathological analysis is carried out to the lung of mouse, as a result shows that there is the disperse remaining fiberizing zone of large area in tumour lung Domain, the alveolar wall thickening of regional area, regional area still remaining have cancerous lung tissue, and show that lung carcinoma cell volume diminishes, core Dyeing is deep, nucleus homogeneity height (such as Fig. 8 C).Illustrate that lung's major part cancer has disappeared, and rebuild normal lung tissue. Treatment results illustrate that PF-06463922 has strong therapeutic effect to the EML4-ALK L1196M tumours driven.

It is similar with PF-06463922, it is found that Ceritinib has strong treatment EML4-ALK L1196M driving lung cancer Ability (such as Fig. 6 B, Fig. 8 D).

Above-described embodiment is the preferable embodiment of the present invention, but embodiments of the present invention are not by above-described embodiment Limitation, other any Spirit Essences without departing from the present invention with made under principle change, modification, replacement, combine, simplification, Equivalent substitute mode is should be, is included within protection scope of the present invention.

Sequence table

<120>A kind of method of evaluation EML4-ALK inhibitor to lung cancer therapy effect

<160> 21

<170> SIPOSequenceListing 1.0

<210> 1

<211> 3200

<212> DNA

<213>People (Homo sapiens)

<400> 1

cggaattcat ggacggtttc gccggcagtc tcgatgatag tatttctgct gcaagtactt 60

ctgatgttca agatcgcctg tcagctcttg agtcacgagt tcagcaacaa gaagatgaaa 120

tcactgtgct aaaggcggct ttggctgatg ttttgaggcg tcttgcaatc tctgaagatc 180

atgtggcctc agtgaaaaaa tcagtctcaa gtaaaggcca accaagccct cgagcagtta 240

ttcccatgtc ctgtataacc aatggaagtg gtgcaaacag aaaaccaagt cataccagtg 300

ctgtctcaat tgcaggaaaa gaaactcttt catctgctgc taaaagtggt acagaaaaaa 360

agaaagaaaa accacaagga cagagagaaa aaaaagagga atctcattct aatgatcaaa 420

gtccacaaat tcgagcatca ccttctcccc agccctcttc acaacctctc caaatacaca 480

gacaaactcc agaaagcaag aatgctactc ccaccaaaag cataaaacga ccatcaccag 540

ctgaaaagtc acataattct tgggaaaatt cagatgatag ccgtaataaa ttgtcgaaaa 600

taccttcaac acccaaatta ataccaaaag ttaccaaaac tgcagacaag cataaagatg 660

tcatcatcaa ccaagaagga gaatatatta aaatgtttat gcgcggtcgg ccaattacca 720

tgttcattcc ttccgatgtt gacaactatg atgacatcag aacggaactg cctcctgaga 780

agctcaaact ggagtgggca tatggttatc gaggaaagga ctgtagagct aatgtttacc 840

ttcttccgac cggggaaata gtttatttca ttgcatcagt agtagtacta tttaattatg 900

aggagagaac tcagcgacac tacctgggcc atacagactg tgtgaaatgc cttgctatac 960

atcctgacaa aattaggatt gcaactggac agatagctgg cgtggataaa gatggaaggc 1020

ctctacaacc ccacgtcaga gtgtgggatt ctgttactct atccacactg cagattattg 1080

gacttggcac ttttgagcgt ggagtaggat gcctggattt ttcaaaagca gattcaggtg 1140

ttcatttatg tgttattgat gactccaatg agcatatgct tactgtatgg gactggcaga 1200

agaaagcaaa aggagcagaa ataaagacaa caaatgaagt tgttttggct gtggagtttc 1260

acccaacaga tgcaaatacc ataattacat gcggtaaatc tcatattttc ttctggacct 1320

ggagcggcaa ttcactaaca agaaaacagg gaatttttgg gaaatatgaa aagccaaaat 1380

ttgtgcagtg tttagcattc ttggggaatg gagatgttct tactggagac tcaggtggag 1440

tcatgcttat atggagcaaa actactgtag agcccacacc tgggaaagga cctaaagtgt 1500

accgccggaa gcaccaggag ctgcaagcca tgcagatgga gctgcagagc cctgagtaca 1560

agctgagcaa gctccgcacc tcgaccatca tgaccgacta caaccccaac tactgctttg 1620

ctggcaagac ctcctccatc agtgacctga aggaggtgcc gcggaaaaac atcaccctca 1680

ttcggggtct gggccatgga gcctttgggg aggtgtatga aggccaggtg tccggaatgc 1740

ccaacgaccc aagccccctg caagtggctg tgaagacgct gcctgaagtg tgctctgaac 1800

aggacgaact ggatttcctc atggaagccc tgatcatcag caaattcaac caccagaaca 1860

ttgttcgctg cattggggtg agcctgcaat ccctgccccg gttcatcctg ctggagctca 1920

tggcgggggg agacctcaag tccttcctcc gagagacccg ccctcgcccg agccagccct 1980

cctccctggc catgctggac cttctgcacg tggctcggga cattgcctgt ggctgtcagt 2040

atttggagga aaaccacttc atccaccgag acattgctgc cagaaactgc ctcttgacct 2100

gtccaggccc tggaagagtg gccaagattg gagacttcgg gatggcccga gacatctaca 2160

gggcgagcta ctatagaaag ggaggctgtg ccatgctgcc agttaagtgg atgcccccag 2220

aggccttcat ggaaggaata ttcacttcta aaacagacac atggtccttt ggagtgctgc 2280

tatgggaaat cttttctctt ggatatatgc cataccccag caaaagcaac caggaagttc 2340

tggagtttgt caccagtgga ggccggatgg acccacccaa gaactgccct gggcctgtat 2400

accggataat gactcagtgc tggcaacatc agcctgaaga caggcccaac tttgccatca 2460

ttttggagag gattgaatac tgcacccagg acccggatgt aatcaacacc gctttgccga 2520

tagaatatgg tccacttgtg gaagaggaag agaaagtgcc tgtgaggccc aaggaccctg 2580

agggggttcc tcctctcctg gtctctcaac aggcaaaacg ggaggaggag cgcagcccag 2640

ctgccccacc acctctgcct accacctcct ctggcaaggc tgcaaagaaa cccacagctg 2700

cagaggtctc tgttcgagtc cctagagggc cggccgtgga agggggacac gtgaatatgg 2760

cattctctca gtccaaccct ccttcggagt tgcacagggt ccacggatcc agaaacaagc 2820

ccaccagctt gtggaaccca acgtacggct cctggtttac agagaaaccc accaaaaaga 2880

ataatcctat agcaaagaag gagccacacg agaggggtaa cctggggctg gagggaagct 2940

gtactgtccc acctaacgtt gcaactggga gacttccggg ggcctcactg ctcctagagc 3000

cctcttcgct gactgccaat atgaaggagg tacctctgtt caggctacgt cacttccctt 3060

gtgggaatgt caattacggc taccagcaac agggcttgcc cttagaagcc gctactgccc 3120

ctggagctgg tcattacgag gataccattc tgaaaagcaa gaatagcatg aaccagcctg 3180

ggccctgaag cggccgcata 3200

<210> 2

<211> 28

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 2

cggaattcat ggacggtttc gccggcag 28

<210> 3

<211> 32

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 3

tatgcggccg cttcagggcc caggctggtt ca 32

<210> 4

<211> 6458

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 4

gcggccgcat actagtaact cctcaggtgc aggctgccta tcagaaggtg gtggctggtg 60

tggccaatgc cctggctcac aaataccact gagatctttt tccctctgcc aaaaattatg 120

gggacatcat gaagcccctt gagcatctga cttctggcta ataaaggaaa tttattttca 180

ttgcaatagt gtgttggaat tttttgtgtc tctcactcgg aaggacatat gggagggcaa 240

atcatttaaa acatcagaat gagtatttgg tttagagttt ggcaacatat gcccatatgc 300

tggctgccat gaacaaaggt tggctataaa gaggtcatca gtatatgaaa cagccccctg 360

ctgtccattc cttattccat agaaaagcct tgacttgagg ttagattttt tttatatttt 420

gttttgtgtt atttttttct ttaacatccc taaaattttc cttacatgtt ttactagcca 480

gatttttcct cctctcctga ctactcccag tcatagctgt ccctcttctc ttatgaagat 540

ccctcgacgg cgcgcgtgca caggcctgat atcggtacct ccagcttttg ttccctttag 600

tgagggttaa ttgcgcgctt ggcgtaatca tggtcatagc tgtttcctgt gtgaaattgt 660

tatccgctca caattccaca caacatacga gccggaagca taaagtgtaa agcctggggt 720

gcctaatgag tgagctaact cacattaatt gcgttgcgct cactgcccgc tttccagtcg 780

ggaaacctgt cgtgccagct gcattaatga atcggccaac gcgcggggag aggcggtttg 840

cgtattgggc gctcttccgc ttcctcgctc actgactcgc tgcgctcggt cgttcggctg 900

cggcgagcgg tatcagctca ctcaaaggcg gtaatacggt tatccacaga atcaggggat 960

aacgcaggaa agaacatgtg agcaaaaggc cagcaaaagg ccaggaaccg taaaaaggcc 1020

gcgttgctgg cgtttttcca taggctccgc ccccctgacg agcatcacaa aaatcgacgc 1080

tcaagtcaga ggtggcgaaa cccgacagga ctataaagat accaggcgtt tccccctgga 1140

agctccctcg tgcgctctcc tgttccgacc ctgccgctta ccggatacct gtccgccttt 1200

ctcccttcgg gaagcgtggc gctttctcat agctcacgct gtaggtatct cagttcggtg 1260

taggtcgttc gctccaagct gggctgtgtg cacgaacccc ccgttcagcc cgaccgctgc 1320

gccttatccg gtaactatcg tcttgagtcc aacccggtaa gacacgactt atcgccactg 1380

gcagcagcca ctggtaacag gattagcaga gcgaggtatg taggcggtgc tacagagttc 1440

ttgaagtggt ggcctaacta cggctacact agaaggacag tatttggtat ctgcgctctg 1500

ctgaagccag ttaccttcgg aaaaagagtt ggtagctctt gatccggcaa acaaaccacc 1560

gctggtagcg gtggtttttt tgtttgcaag cagcagatta cgcgcagaaa aaaaggatct 1620

caagaagatc ctttgatctt ttctacgggg tctgacgctc agtggaacga aaactcacgt 1680

taagggattt tggtcatgag attatcaaaa aggatcttca cctagatcct tttaaattaa 1740

aaatgaagtt ttaaatcaat ctaaagtata tatgagtaaa cttggtctga cagttaccaa 1800

tgcttaatca gtgaggcacc tatctcagcg atctgtctat ttcgttcatc catagttgcc 1860

tgactccccg tcgtgtagat aactacgata cgggagggct taccatctgg ccccagtgct 1920

gcaatgatac cgcgagaccc acgctcaccg gctccagatt tatcagcaat aaaccagcca 1980

gccggaaggg ccgagcgcag aagtggtcct gcaactttat ccgcctccat ccagtctatt 2040

aattgttgcc gggaagctag agtaagtagt tcgccagtta atagtttgcg caacgttgtt 2100

gccattgcta caggcatcgt ggtgtcacgc tcgtcgtttg gtatggcttc attcagctcc 2160

ggttcccaac gatcaaggcg agttacatga tcccccatgt tgtgcaaaaa agcggttagc 2220

tccttcggtc ctccgatcgt tgtcagaagt aagttggccg cagtgttatc actcatggtt 2280

atggcagcac tgcataattc tcttactgtc atgccatccg taagatgctt ttctgtgact 2340

ggtgagtact caaccaagtc attctgagaa tagtgtatgc ggcgaccgag ttgctcttgc 2400

ccggcgtcaa tacgggataa taccgcgcca catagcagaa ctttaaaagt gctcatcatt 2460

ggaaaacgtt cttcggggcg aaaactctca aggatcttac cgctgttgag atccagttcg 2520

atgtaaccca ctcgtgcacc caactgatct tcagcatctt ttactttcac cagcgtttct 2580

gggtgagcaa aaacaggaag gcaaaatgcc gcaaaaaagg gaataagggc gacacggaaa 2640

tgttgaatac tcatactctt cctttttcaa tattattgaa gcatttatca gggttattgt 2700

ctcatgagcg gatacatatt tgaatgtatt tagaaaaata aacaaatagg ggttccgcgc 2760

acatttcccc gaaaagtgcc acctaaattg taagcgttaa tattttgtta aaattcgcgt 2820

taaatttttg ttaaatcagc tcatttttta accaataggc cgaaatcggc aaaatccctt 2880

ataaatcaaa agaatagacc gagatagggt tgagtgttgt tccagtttgg aacaagagtc 2940

cactattaaa gaacgtggac tccaacgtca aagggcgaaa aaccgtctat cagggcgatg 3000

gcccactacg tgaaccatca ccctaatcaa gttttttggg gtcgaggtgc cgtaaagcac 3060

taaatcggaa ccctaaaggg agcccccgat ttagagcttg acggggaaag ccggcgaacg 3120

tggcgagaaa ggaagggaag aaagcgaaag gagcgggcgc tagggcgctg gcaagtgtag 3180

cggtcacgct gcgcgtaacc accacacccg ccgcgcttaa tgcgccgcta cagggcgcgt 3240

cccattcgcc attcaggctg cgcaactgtt gggaagggcg atcggtgcgg gcctcttcgc 3300

tattacgcca gctggcgaaa gggggatgtg ctgcaaggcg attaagttgg gtaacgccag 3360

ggttttccca gtcacgacgt tgtaaaacga cggccagtga gcgcgcgtaa tacgactcac 3420

tatagggcga attgggtacc gatatcaggc ctgtgcaatt aagctagtta ttaatagtaa 3480

tcaattacgg ggtcattagt tcatagccca tatatggagt tccgcgttac ataacttacg 3540

gtaaatggcc cgcctggctg accgcccaac gacccccgcc cattgacgtc aataatgacg 3600

tatgttccca tagtaacgcc aatagggact ttccattgac gtcaatgggt ggactattta 3660

cggtaaactg cccacttggc agtacatcaa gtgtatcata tgccaagtac gccccctatt 3720

gacgtcaatg acggtaaatg gcccgcctgg cattatgccc agtacatgac cttatgggac 3780

tttcctactt ggcagtacat ctacgtatta gtcatcgcta ttaccatggg tcgaggtgag 3840

ccccacgttc tgcttcactc tccccatctc ccccccctcc ccacccccaa ttttgtattt 3900

atttattttt taattatttt gtgcagcgat gggggcgggg gggggggggg cgcgcgccag 3960

gcggggcggg gcggggcgag gggcggggcg gggcgaggcg gagaggtgcg gcggcagcca 4020

atcagagcgg cgcgctccga aagtttcctt ttatggcgag gcggcggcgg cggcggccct 4080

ataaaaagcg aagcgcgcgg cgggcgggag tcgctgcgtt gccttcgccc cgtgccccgc 4140

tccgcgccgc ctcgcgccgc ccgccccggc tctgactgac cgcgttactc ccacaggtga 4200

gcgggcggga cggcccttct cctccgggct gtaattagcg cttggtttaa tgacggctcg 4260

tttcttttct gtggctgcgt gaaagcctta aagggctccg ggagggccct ttgtgcgggg 4320

gggagcggct cggggggtgc gtgcgtgtgt gtgtgcgtgg ggagcgccgc gtgcggcccg 4380

cgctgcccgg cggctgtgag cgctgcgggc gcggcgcggg gctttgtgcg ctccgcgtgt 4440

gcgcgagggg agcgcggccg ggggcggtgc cccgcggtgc gggggggctg cgaggggaac 4500

aaaggctgcg tgcggggtgt gtgcgtgggg gggtgagcag ggggtgtggg cgcggcggtc 4560

gggctgtaac ccccccctgc acccccctcc ccgagttgct gagcacggcc cggcttcggg 4620

tgcggggctc cgtgcggggc gtggcgcggg gctcgccgtg ccgggcgggg ggtggcggca 4680

ggtgggggtg ccgggcgggg cggggccgcc tcgggccggg gagggctcgg gggaggggcg 4740

cggcggcccc ggagcgccgg cggctgtcga ggcgcggcga gccgcagcca ttgcctttta 4800

tggtaatcgt gcgagagggc gcagggactt cctttgtccc aaatctggcg gagccgaaat 4860

ctgggaggcg ccgccgcacc ccctctagcg ggcgcgggcg aagcggtgcg gcgccggcag 4920

gaaggaaatg ggcggggagg gccttcgtgc gtcgccgcgc cgccgtcccc ttctccatct 4980

ccagcctcgg ggctgccgca gggggacggc tgccttcggg ggggacgggg cagggcgggg 5040

ttcggcttct ggcgtgtgac cggcggctct agagcctctg ctaaccatgt tcatgccttc 5100

ttctttttcc tacagctcct gggcaacgtg ctggttattg tgctgtctca tcattttggc 5160

aaagaattga ttaattcgag cgaacgcgta taacttcgta tagcatacat tatacgaagt 5220

tatctcgagt cggatttgat ctgatcaaga gacaggatga ggatcgtttc gcatgattga 5280

acaagatgga ttgcacgcag gttctccggc cgcttgggtg gagaggctat tcggctatga 5340

ctgggcacaa cagacaatcg gctgctctga tgccgccgtg ttccggctgt cagcgcaggg 5400

gcgcccggtt ctttttgtca agaccgacct gtccggtgcc ctgaatgaac tgcaggacga 5460

ggcagcgcgg ctatcgtggc tggccacgac gggcgttcct tgcgcagctg tgctcgacgt 5520

tgtcactgaa gcgggaaggg actggctgct attgggcgaa gtgccggggc aggatctcct 5580

gtcatctcac cttgctcctg ccgagaaagt atccatcatg gctgatgcaa tgcggcggct 5640

gcatacgctt gatccggcta cctgcccatt cgaccaccaa gcgaaacatc gcatcgagcg 5700

agcacgtact cggatggaag ccggtcttgt cgatcaggat gatctggacg aagagcatca 5760

ggggctcgcg ccagccgaac tgttcgccag gctcaaggcg cgcatgcccg acggcgagga 5820

tctcgtcgtg acccatggcg atgcctgctt gccgaatatc atggtggaaa atggccgctt 5880

ttctggattc atcgactgtg gccggctggg tgtggcggac cgctatcagg acatagcgtt 5940

ggctacccgt gatattgctg aagagcttgg cggcgaatgg gctgaccgct tcctcgtgct 6000

ttacggtatc gccgctcccg attcgcagcg catcgccttc tatcgccttc ttgacgagtt 6060

cttctgagcg ggactctggg gttcgaaatg accgaccaag cgacgcccaa cctgccatca 6120

cgagatttcg attccaccgc cgccttctat gaaaggttgg gcttcggaat cgttttccgg 6180

gacgccggct ggatgatcct ccagcgcggg gatctcatgc tggagttctt cgcccacccc 6240

atcgataact tgtttattgc agcttataat ggttacaaat aaagcaatag catcacaaat 6300

ttcacaaata aagcattttt ttcactgcat tctagttgtg gtttgtccaa actcatcaat 6360

gtatcttatc atgtctggat caatccgaac gcgtataact tcgtatagca tacattatac 6420

gaagttatct cgagtcgctc ggtacgattt aaattgaa 6458

<210> 5

<211> 39

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 5

ccgatatcag gcctgtgcac ctcctggctt ctgaggacc 39

<210> 6

<211> 28

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 6

agcttaatta acgtgtagaa tgccatga 28

<210> 7

<211> 29

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 7

acggcgcgcc tggtctaaat gtgattttg 29

<210> 8

<211> 40

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 8

ccgatatcag gcctgtgcac aaactagaaa atctgattaa 40

<210> 9

<211> 1229

<212> DNA

<213>Mouse (Mus musculus)

<400> 9

cgatatcagg cctgtgcacc tcctggcttc tgaggaccgc cctgggcctg ggagaatccc 60

ttccccctct tccctcgtga tctgcaactc cagtctttct agaagatggg cgggagtctt 120

ctgggcaggc ttaaaggcta acctggtgtg tgggcgttgt cctgcagggg aattgaacag 180

gtgtaaaatt ggagggacaa gacttcccac agattttcgg ttttgtcggg aagtttttta 240

ataggggcaa ataaggaaaa tgggaggata ggtagtcatc tggggtttta tgcagcaaaa 300

ctacaggtta ttattgcttg tgatccgcct cggagtattt tccatcgagg tagattaaag 360

acatgctcac ccgagtttta tactctcctg cttgagatcc ttactacagt atgaaattac 420

agtgtcgcga gttagactat gtaagcagaa ttttaatcat ttttaaagag cccagtactt 480

catatccatt tctcccgctc cttctgcagc cttatcaaaa ggtattttag aacactcatt 540

ttagccccat tttcatttat tatactggct tatccaaccc ctagacagag cattggcatt 600

ttccctttcc tgatcttaga agtctgatga ctcatgaaac cagacagatt agttacatac 660

accacaaatc gaggctgtag ctggggcctc aacactgcag ttcttttata actccttagt 720

acactttttg ttgatccttt gccttgatcc ttaattttca gtgtctatca cctctcccgt 780

caggtggtgt tccacatttg ggcctattct cagtccaggg agttttacaa caatagatgt 840

attgagaatc caacctaaag cttaactttc cactcccatg aatgcctctc tcctttttct 900

ccatttataa actgagctat taaccattaa tggtttccag gtggatgtct cctcccccaa 960

tattacctga tgtatcttac atattgccag gctgatattt taagacatta aaaggtatat 1020

ttcattattg agccacatgg tattgattac tgcttactaa aattttgtca ttgtacacat 1080

ctgtaaaagg tggttccttt tggaatgcaa agttcaggtg tttgttgtct ttcctgacct 1140

aaggtcttgt gagcttgtat tttttctatt taagcagtgc tttctcttgg actggcttga 1200

ctcatggcat tctacacgtt aattaagct 1229

<210> 10

<211> 1458

<212> DNA

<213>Mouse (Mus musculus)

<400> 10

gacggcgcgc ctggtctaaa tgtgattttg ccaagcttct tcaggaccta taattttgct 60

tgacttgtag ccaaacacaa gtaaaatgat taagcaacaa atgtatttgt gaagcttggt 120

ttttaggttg ttgtgttgtg tgtgcttgtg ctctataata atactatcca ggggctggag 180

aggtggctcg gagttcaaga gcacagactg ctcttccaga agtcctgagt tcaattccca 240

gcaaccacat ggtggctcac aaccatctgt aatgggatct gatgccctct tctggtgtgt 300

ctgaagacca caagtgtatt cacattaaat aaataaatcc tccttcttct tctttttttt 360

ttttttaaag agaatactgt ctccagtaga atttactgaa gtaatgaaat actttgtgtt 420

tgttccaata tggtagccaa taatcaaatt actctttaag cactggaaat gttaccaagg 480

aactaatttt tatttgaagt gtaactgtgg acagaggagc cataactgca gacttgtggg 540

atacagaaga ccaatgcaga ctttaatgtc ttttctctta cactaagcaa taaagaaata 600

aaaattgaac ttctagtatc ctatttgttt aaactgctag ctttacttaa cttttgtgct 660

tcatctatac aaagctgaaa gctaagtctg cagccattac taaacatgaa agcaagtaat 720

gataattttg gatttcaaaa atgtagggcc agagtttagc cagccagtgg tggtgcttgc 780

ctttatgcct ttaatcccag cactctggag gcagagacag gcagatctct gagtttgagc 840

ccagcctggt ctacacatca agttctatct aggatagcca ggaatacaca cagaaaccct 900

gttggggagg ggggctctga gatttcataa aattataatt gaagcattcc ctaatgagcc 960

actatggatg tggctaaatc cgtctacctt tctgatgaga tttgggtatt attttttctg 1020

tctctgctgt tggttgggtc ttttgacact gtgggctttc tttaaagcct ccttcctgcc 1080

atgtggtctc ttgtttgcta ctaacttccc atggcttaaa tggcatggct ttttgccttc 1140

taagggcagc tgctgagatt tgcagcctga tttccagggt ggggttggga aatctttcaa 1200

acactaaaat tgtcctttaa tttttttttt aaaaaatggg ttatataata aacctcataa 1260

aatagttatg aggagtgagg tggactaata ttaaatgagt ccctccccta taaaagagct 1320

attaaggctt tttgtcttat acttaacttt ttttttaaat gtggtatctt tagaaccaag 1380

ggtcttagag ttttagtata cagaaactgt tgcatcgctt aatcagattt tctagtttgt 1440

gcacaggcct gatatcgg 1458

<210> 11

<211> 9412

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 11

cctcctggct tctgaggacc gccctgggcc tgggagaatc ccttccccct cttccctcgt 60

gatctgcaac tccagtcttt ctagaagatg ggcgggagtc ttctgggcag gcttaaaggc 120

taacctggtg tgtgggcgtt gtcctgcagg ggaattgaac aggtgtaaaa ttggagggac 180

aagacttccc acagattttc ggttttgtcg ggaagttttt taataggggc aaataaggaa 240

aatgggagga taggtagtca tctggggttt tatgcagcaa aactacaggt tattattgct 300

tgtgatccgc ctcggagtat tttccatcga ggtagattaa agacatgctc acccgagttt 360

tatactctcc tgcttgagat ccttactaca gtatgaaatt acagtgtcgc gagttagact 420

atgtaagcag aattttaatc atttttaaag agcccagtac ttcatatcca tttctcccgc 480

tccttctgca gccttatcaa aaggtatttt agaacactca ttttagcccc attttcattt 540

attatactgg cttatccaac ccctagacag agcattggca ttttcccttt cctgatctta 600

gaagtctgat gactcatgaa accagacaga ttagttacat acaccacaaa tcgaggctgt 660

agctggggcc tcaacactgc agttctttta taactcctta gtacactttt tgttgatcct 720

ttgccttgat ccttaatttt cagtgtctat cacctctccc gtcaggtggt gttccacatt 780

tgggcctatt ctcagtccag ggagttttac aacaatagat gtattgagaa tccaacctaa 840

agcttaactt tccactccca tgaatgcctc tctccttttt ctccatttat aaactgagct 900

attaaccatt aatggtttcc aggtggatgt ctcctccccc aatattacct gatgtatctt 960

acatattgcc aggctgatat tttaagacat taaaaggtat atttcattat tgagccacat 1020

ggtattgatt actgcttact aaaattttgt cattgtacac atctgtaaaa ggtggttcct 1080

tttggaatgc aaagttcagg tgtttgttgt ctttcctgac ctaaggtctt gtgagcttgt 1140

attttttcta tttaagcagt gctttctctt ggactggctt gactcatggc attctacacg 1200

ttaattaagc tagttattaa tagtaatcaa ttacggggtc attagttcat agcccatata 1260

tggagttccg cgttacataa cttacggtaa atggcccgcc tggctgaccg cccaacgacc 1320

cccgcccatt gacgtcaata atgacgtatg ttcccatagt aacgccaata gggactttcc 1380

attgacgtca atgggtggac tatttacggt aaactgccca cttggcagta catcaagtgt 1440

atcatatgcc aagtacgccc cctattgacg tcaatgacgg taaatggccc gcctggcatt 1500

atgcccagta catgacctta tgggactttc ctacttggca gtacatctac gtattagtca 1560

tcgctattac catgggtcga ggtgagcccc acgttctgct tcactctccc catctccccc 1620

ccctccccac ccccaatttt gtatttattt attttttaat tattttgtgc agcgatgggg 1680

gcgggggggg ggggggcgcg cgccaggcgg ggcggggcgg ggcgaggggc ggggcggggc 1740

gaggcggaga ggtgcggcgg cagccaatca gagcggcgcg ctccgaaagt ttccttttat 1800

ggcgaggcgg cggcggcggc ggccctataa aaagcgaagc gcgcggcggg cgggagtcgc 1860

tgcgttgcct tcgccccgtg ccccgctccg cgccgcctcg cgccgcccgc cccggctctg 1920

actgaccgcg ttactcccac aggtgagcgg gcgggacggc ccttctcctc cgggctgtaa 1980

ttagcgcttg gtttaatgac ggctcgtttc ttttctgtgg ctgcgtgaaa gccttaaagg 2040

gctccgggag ggccctttgt gcggggggga gcggctcggg gggtgcgtgc gtgtgtgtgt 2100

gcgtggggag cgccgcgtgc ggcccgcgct gcccggcggc tgtgagcgct gcgggcgcgg 2160

cgcggggctt tgtgcgctcc gcgtgtgcgc gaggggagcg cggccggggg cggtgccccg 2220

cggtgcgggg gggctgcgag gggaacaaag gctgcgtgcg gggtgtgtgc gtgggggggt 2280

gagcaggggg tgtgggcgcg gcggtcgggc tgtaaccccc ccctgcaccc ccctccccga 2340

gttgctgagc acggcccggc ttcgggtgcg gggctccgtg cggggcgtgg cgcggggctc 2400

gccgtgccgg gcggggggtg gcggcaggtg ggggtgccgg gcggggcggg gccgcctcgg 2460

gccggggagg gctcggggga ggggcgcggc ggccccggag cgccggcggc tgtcgaggcg 2520

cggcgagccg cagccattgc cttttatggt aatcgtgcga gagggcgcag ggacttcctt 2580

tgtcccaaat ctggcggagc cgaaatctgg gaggcgccgc cgcaccccct ctagcgggcg 2640

cgggcgaagc ggtgcggcgc cggcaggaag gaaatgggcg gggagggcct tcgtgcgtcg 2700

ccgcgccgcc gtccccttct ccatctccag cctcggggct gccgcagggg gacggctgcc 2760

ttcggggggg acggggcagg gcggggttcg gcttctggcg tgtgaccggc ggctctagag 2820

cctctgctaa ccatgttcat gccttcttct ttttcctaca gctcctgggc aacgtgctgg 2880

ttattgtgct gtctcatcat tttggcaaag aattgattaa ttcgagcgaa cgcgtataac 2940

ttcgtatagc atacattata cgaagttatc tcgagtcgga tttgatctga tcaagagaca 3000

ggatgaggat cgtttcgcat gattgaacaa gatggattgc acgcaggttc tccggccgct 3060

tgggtggaga ggctattcgg ctatgactgg gcacaacaga caatcggctg ctctgatgcc 3120

gccgtgttcc ggctgtcagc gcaggggcgc ccggttcttt ttgtcaagac cgacctgtcc 3180

ggtgccctga atgaactgca ggacgaggca gcgcggctat cgtggctggc cacgacgggc 3240

gttccttgcg cagctgtgct cgacgttgtc actgaagcgg gaagggactg gctgctattg 3300

ggcgaagtgc cggggcagga tctcctgtca tctcaccttg ctcctgccga gaaagtatcc 3360

atcatggctg atgcaatgcg gcggctgcat acgcttgatc cggctacctg cccattcgac 3420

caccaagcga aacatcgcat cgagcgagca cgtactcgga tggaagccgg tcttgtcgat 3480

caggatgatc tggacgaaga gcatcagggg ctcgcgccag ccgaactgtt cgccaggctc 3540

aaggcgcgca tgcccgacgg cgaggatctc gtcgtgaccc atggcgatgc ctgcttgccg 3600

aatatcatgg tggaaaatgg ccgcttttct ggattcatcg actgtggccg gctgggtgtg 3660

gcggaccgct atcaggacat agcgttggct acccgtgata ttgctgaaga gcttggcggc 3720

gaatgggctg accgcttcct cgtgctttac ggtatcgccg ctcccgattc gcagcgcatc 3780

gccttctatc gccttcttga cgagttcttc tgagcgggac tctggggttc gaaatgaccg 3840

accaagcgac gcccaacctg ccatcacgag atttcgattc caccgccgcc ttctatgaaa 3900

ggttgggctt cggaatcgtt ttccgggacg ccggctggat gatcctccag cgcggggatc 3960

tcatgctgga gttcttcgcc caccccatcg ataacttgtt tattgcagct tataatggtt 4020

acaaataaag caatagcatc acaaatttca caaataaagc atttttttca ctgcattcta 4080

gttgtggttt gtccaaactc atcaatgtat cttatcatgt ctggatcaat ccgaacgcgt 4140

ataacttcgt atagcataca ttatacgaag ttatctcgag tcgctcggta cgatttaaat 4200

tgaattctgc agtcgacggt accgcgggcc cgggatccac cggaattcat ggacggtttc 4260

gccggcagtc tcgatgatag tatttctgct gcaagtactt ctgatgttca agatcgcctg 4320

tcagctcttg agtcacgagt tcagcaacaa gaagatgaaa tcactgtgct aaaggcggct 4380

ttggctgatg ttttgaggcg tcttgcaatc tctgaagatc atgtggcctc agtgaaaaaa 4440

tcagtctcaa gtaaaggcca accaagccct cgagcagtta ttcccatgtc ctgtataacc 4500

aatggaagtg gtgcaaacag aaaaccaagt cataccagtg ctgtctcaat tgcaggaaaa 4560

gaaactcttt catctgctgc taaaagtggt acagaaaaaa agaaagaaaa accacaagga 4620

cagagagaaa aaaaagagga atctcattct aatgatcaaa gtccacaaat tcgagcatca 4680

ccttctcccc agccctcttc acaacctctc caaatacaca gacaaactcc agaaagcaag 4740

aatgctactc ccaccaaaag cataaaacga ccatcaccag ctgaaaagtc acataattct 4800

tgggaaaatt cagatgatag ccgtaataaa ttgtcgaaaa taccttcaac acccaaatta 4860

ataccaaaag ttaccaaaac tgcagacaag cataaagatg tcatcatcaa ccaagaagga 4920

gaatatatta aaatgtttat gcgcggtcgg ccaattacca tgttcattcc ttccgatgtt 4980

gacaactatg atgacatcag aacggaactg cctcctgaga agctcaaact ggagtgggca 5040

tatggttatc gaggaaagga ctgtagagct aatgtttacc ttcttccgac cggggaaata 5100

gtttatttca ttgcatcagt agtagtacta tttaattatg aggagagaac tcagcgacac 5160

tacctgggcc atacagactg tgtgaaatgc cttgctatac atcctgacaa aattaggatt 5220

gcaactggac agatagctgg cgtggataaa gatggaaggc ctctacaacc ccacgtcaga 5280

gtgtgggatt ctgttactct atccacactg cagattattg gacttggcac ttttgagcgt 5340

ggagtaggat gcctggattt ttcaaaagca gattcaggtg ttcatttatg tgttattgat 5400

gactccaatg agcatatgct tactgtatgg gactggcaga agaaagcaaa aggagcagaa 5460

ataaagacaa caaatgaagt tgttttggct gtggagtttc acccaacaga tgcaaatacc 5520

ataattacat gcggtaaatc tcatattttc ttctggacct ggagcggcaa ttcactaaca 5580

agaaaacagg gaatttttgg gaaatatgaa aagccaaaat ttgtgcagtg tttagcattc 5640

ttggggaatg gagatgttct tactggagac tcaggtggag tcatgcttat atggagcaaa 5700

actactgtag agcccacacc tgggaaagga cctaaagtgt accgccggaa gcaccaggag 5760

ctgcaagcca tgcagatgga gctgcagagc cctgagtaca agctgagcaa gctccgcacc 5820

tcgaccatca tgaccgacta caaccccaac tactgctttg ctggcaagac ctcctccatc 5880

agtgacctga aggaggtgcc gcggaaaaac atcaccctca ttcggggtct gggccatgga 5940

gcctttgggg aggtgtatga aggccaggtg tccggaatgc ccaacgaccc aagccccctg 6000

caagtggctg tgaagacgct gcctgaagtg tgctctgaac aggacgaact ggatttcctc 6060

atggaagccc tgatcatcag caaattcaac caccagaaca ttgttcgctg cattggggtg 6120

agcctgcaat ccctgccccg gttcatcctg ctggagctca tggcgggggg agacctcaag 6180

tccttcctcc gagagacccg ccctcgcccg agccagccct cctccctggc catgctggac 6240

cttctgcacg tggctcggga cattgcctgt ggctgtcagt atttggagga aaaccacttc 6300

atccaccgag acattgctgc cagaaactgc ctcttgacct gtccaggccc tggaagagtg 6360

gccaagattg gagacttcgg gatggcccga gacatctaca gggcgagcta ctatagaaag 6420

ggaggctgtg ccatgctgcc agttaagtgg atgcccccag aggccttcat ggaaggaata 6480

ttcacttcta aaacagacac atggtccttt ggagtgctgc tatgggaaat cttttctctt 6540

ggatatatgc cataccccag caaaagcaac caggaagttc tggagtttgt caccagtgga 6600

ggccggatgg acccacccaa gaactgccct gggcctgtat accggataat gactcagtgc 6660

tggcaacatc agcctgaaga caggcccaac tttgccatca ttttggagag gattgaatac 6720

tgcacccagg acccggatgt aatcaacacc gctttgccga tagaatatgg tccacttgtg 6780

gaagaggaag agaaagtgcc tgtgaggccc aaggaccctg agggggttcc tcctctcctg 6840

gtctctcaac aggcaaaacg ggaggaggag cgcagcccag ctgccccacc acctctgcct 6900

accacctcct ctggcaaggc tgcaaagaaa cccacagctg cagaggtctc tgttcgagtc 6960

cctagagggc cggccgtgga agggggacac gtgaatatgg cattctctca gtccaaccct 7020

ccttcggagt tgcacagggt ccacggatcc agaaacaagc ccaccagctt gtggaaccca 7080

acgtacggct cctggtttac agagaaaccc accaaaaaga ataatcctat agcaaagaag 7140

gagccacacg agaggggtaa cctggggctg gagggaagct gtactgtccc acctaacgtt 7200

gcaactggga gacttccggg ggcctcactg ctcctagagc cctcttcgct gactgccaat 7260

atgaaggagg tacctctgtt caggctacgt cacttccctt gtgggaatgt caattacggc 7320

taccagcaac agggcttgcc cttagaagcc gctactgccc ctggagctgg tcattacgag 7380

gataccattc tgaaaagcaa gaatagcatg aaccagcctg ggccctgaag cggccgcata 7440

ctagtaactc ctcaggtgca ggctgcctat cagaaggtgg tggctggtgt ggccaatgcc 7500

ctggctcaca aataccactg agatcttttt ccctctgcca aaaattatgg ggacatcatg 7560

aagccccttg agcatctgac ttctggctaa taaaggaaat ttattttcat tgcaatagtg 7620

tgttggaatt ttttgtgtct ctcactcgga aggacatatg ggagggcaaa tcatttaaaa 7680

catcagaatg agtatttggt ttagagtttg gcaacatatg cccatatgct ggctgccatg 7740

aacaaaggtt ggctataaag aggtcatcag tatatgaaac agccccctgc tgtccattcc 7800

ttattccata gaaaagcctt gacttgaggt tagatttttt ttatattttg ttttgtgtta 7860

tttttttctt taacatccct aaaattttcc ttacatgttt tactagccag atttttcctc 7920

ctctcctgac tactcccagt catagctgtc cctcttctct tatgaagatc cctcgacggc 7980

gcgcctggtc taaatgtgat tttgccaagc ttcttcagga cctataattt tgcttgactt 8040

gtagccaaac acaagtaaaa tgattaagca acaaatgtat ttgtgaagct tggtttttag 8100

gttgttgtgt tgtgtgtgct tgtgctctat aataatacta tccaggggct ggagaggtgg 8160

ctcggagttc aagagcacag actgctcttc cagaagtcct gagttcaatt cccagcaacc 8220

acatggtggc tcacaaccat ctgtaatggg atctgatgcc ctcttctggt gtgtctgaag 8280

accacaagtg tattcacatt aaataaataa atcctccttc ttcttctttt tttttttttt 8340

aaagagaata ctgtctccag tagaatttac tgaagtaatg aaatactttg tgtttgttcc 8400

aatatggtag ccaataatca aattactctt taagcactgg aaatgttacc aaggaactaa 8460

tttttatttg aagtgtaact gtggacagag gagccataac tgcagacttg tgggatacag 8520

aagaccaatg cagactttaa tgtcttttct cttacactaa gcaataaaga aataaaaatt 8580

gaacttctag tatcctattt gtttaaactg ctagctttac ttaacttttg tgcttcatct 8640

atacaaagct gaaagctaag tctgcagcca ttactaaaca tgaaagcaag taatgataat 8700

tttggatttc aaaaatgtag ggccagagtt tagccagcca gtggtggtgc ttgcctttat 8760

gcctttaatc ccagcactct ggaggcagag acaggcagat ctctgagttt gagcccagcc 8820

tggtctacac atcaagttct atctaggata gccaggaata cacacagaaa ccctgttggg 8880

gaggggggct ctgagatttc ataaaattat aattgaagca ttccctaatg agccactatg 8940

gatgtggcta aatccgtcta cctttctgat gagatttggg tattattttt tctgtctctg 9000

ctgttggttg ggtcttttga cactgtgggc tttctttaaa gcctccttcc tgccatgtgg 9060

tctcttgttt gctactaact tcccatggct taaatggcat ggctttttgc cttctaaggg 9120

cagctgctga gatttgcagc ctgatttcca gggtggggtt gggaaatctt tcaaacacta 9180

aaattgtcct ttaatttttt ttttaaaaaa tgggttatat aataaacctc ataaaatagt 9240

tatgaggagt gaggtggact aatattaaat gagtccctcc cctataaaag agctattaag 9300

gctttttgtc ttatacttaa cttttttttt aaatgtggta tctttagaac caagggtctt 9360

agagttttag tatacagaaa ctgttgcatc gcttaatcag attttctagt tt 9412

<210> 12

<211> 23

<212> RNA

<213>Artificial sequence (Artificial Sequence)

<400> 12

ggcauucuac acguuauugc ugg 23

<210> 14

<211> 22

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 14

ggacagatag ctggcgtgga ta 22

<210> 14

<211> 20

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 14

tccggacacc tggccttcat 20

<210> 15

<211> 750

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 15

ggacagatag ctggcgtgga taaagatgga aggcctctac aaccccacgt cagagtgtgg 60

gattctgtta ctctatccac actgcagatt attggacttg gcacttttga gcgtggagta 120

ggatgcctgg atttttcaaa agcagattca ggtgttcatt tatgtgttat tgatgactcc 180

aatgagcata tgcttactgt atgggactgg cagaagaaag caaaaggagc agaaataaag 240

acaacaaatg aagttgtttt ggctgtggag tttcacccaa cagatgcaaa taccataatt 300

acatgcggta aatctcatat tttcttctgg acctggagcg gcaattcact aacaagaaaa 360

cagggaattt ttgggaaata tgaaaagcca aaatttgtgc agtgtttagc attcttgggg 420

aatggagatg ttcttactgg agactcaggt ggagtcatgc ttatatggag caaaactact 480

gtagagccca cacctgggaa aggacctaaa gtgtaccgcc ggaagcacca ggagctgcaa 540

gccatgcaga tggagctgca gagccctgag tacaagctga gcaagctccg cacctcgacc 600

atcatgaccg actacaaccc caactactgc tttgctggca agacctcctc catcagtgac 660

ctgaaggagg tgccgcggaa aaacatcacc ctcattcggg gtctgggcca tggagccttt 720

ggggaggtgt atgaaggcca ggtgtccgga 750

<210> 16

<211> 20

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 16

cccaaagtcg ctctgagttg 20

<210> 17

<211> 20

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 17

ggcgggccat ttaccgtaag 20

<210> 18

<211> 1402

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 18

ggcgggccat ttaccgtaag ttatgtaacg cggaactcca tatatgggct atgaactaat 60

gaccccgtaa ttgattacta ttaataacta gcttaaataa cgtgtagaat gccatgagtc 120

aagccagtcc aagagaaagc actgcttaaa tagaaaaaat acaagctcac aagaccttag 180

gtcaggaaag acaacaaaca cctgaacttt gcattccaaa aggaaccacc ttttacagat 240

gtgtacaatg acaaaatttt agtaagcagt aatcaatacc atgtggctca ataatgaaat 300

atacctttta atgtcttaaa atatcagcct ggcaatatgt aagatacatc aggtaatatt 360

gggggaggag acatccacct ggaaaccatt aatggttaat agctcagttt ataaatggag 420

aaaaaggaga gaggcattca tgggagtgga aagttaagct ttaggttgga ttctcaatac 480

atctattgtt gtaaaactcc ctggactgag aataggccca aatgtggaac accacctgac 540

gggagaggtg atagacactg aaaattaagg atcaaggcaa aggatcaaca aaaagtgtac 600

taaggagtta taaaagaact gcagtgttga ggccccagct acagcctcga tttgtggtgt 660

atgtaactaa tctgtctggt ttcatgagtc atcagacttc taagatcagg aaagggaaaa 720

tgccaatgct ctgtctaggg gttggataag ccagtataat aaatgaaaat ggggctaaaa 780

tgagtgttct aaaatacctt ttgataaggc tgcagaagga gcgggagaaa tggatatgaa 840

gtactgggct ctttaaaaat gattaaaatt ctgcttacat agtctaactc gcgacactgt 900

aatttcatac tgtagtaagg atctcaagca ggagagtata aaactcgggt gagcatgtct 960

ttaatctacc tcgatggaaa atactccgag gcggatcaca agcaataata acctgtagtt 1020

ttgctgcata aaaccccaga tgactaccta tcctcccatt ttccttattt gcccctatta 1080

aaaaacttcc cgacaaaacc gaaaatctgt gggaagtctt gtccctccaa ttttacacct 1140

gttcaattcc cctgcaggac aacgcccaca caccaggtta gcctttaagc ctgcccagaa 1200

gactcccgcc catcttctag aaagactgga gttgcagatc acgagggaag agggggaagg 1260

gattctccca ggcccagggc ggtcctcaga agccaggagg cagcagagaa ctcccagaaa 1320

ggtattgcaa cactcccctc ccccctccgg agaagggtgc ggccttctcc ccgcctactc 1380

cactgcagct cccttactga ta 1402

<210> 19

<211> 28

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 19

ccatagaaaa gccttgactt gaggttag 28

<210> 20

<211> 25

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 20

gactttggct gtgaagaatt tggat 25

<210> 21

<211> 1633

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 21

gactttggct gtgaagaatt tggattctct ggatttgaaa ctagaaaatc tgattaagcg 60

atgcaacagt ttctgtatac taaaactcta agacccttgg ttctaaagat accacattta 120

aaaaaaaagt taagtataag acaaaaagcc ttaatagctc ttttataggg gagggactca 180

tttaatatta gtccacctca ctcctcataa ctattttatg aggtttatta tataacccat 240

tttttaaaaa aaaaattaaa ggacaatttt agtgtttgaa agatttccca accccaccct 300

ggaaatcagg ctgcaaatct cagcagctgc ccttagaagg caaaaagcca tgccatttaa 360

gccatgggaa gttagtagca aacaagagac cacatggcag gaaggaggct ttaaagaaag 420

cccacagtgt caaaagaccc aaccaacagc agagacagaa aaaataatac ccaaatctca 480

tcagaaaggt agacggattt agccacatcc atagtggctc attagggaat gcttcaatta 540

taattttatg aaatctcaga gcccccctcc ccaacagggt ttctgtgtgt attcctggct 600

atcctagata gaacttgatg tgtagaccag gctgggctca aactcagaga tctgcctgtc 660

tctgcctcca gagtgctggg attaaaggca taaaggcaag caccaccact ggctggctaa 720

actctggccc tacatttttg aaatccaaaa ttatcattac ttgctttcat gtttagtaat 780

ggctgcagac ttagctttca gctttgtata gatgaagcac aaaagttaag taaagctagc 840

agtttaaaca aataggatac tagaagttca atttttattt ctttattgct tagtgtaaga 900

gaaaagacat taaagtctgc attggtcttc tgtatcccac aagtctgcag ttatggctcc 960

tctgtccaca gttacacttc aaataaaaat tagttccttg gtaacatttc cagtgcttaa 1020

agagtaattt gattattggc taccatattg gaacaaacac aaagtatttc attacttcag 1080

taaattctac tggagacagt attctcttta aaaaaaaaaa aaagaagaag aaggaggatt 1140

tatttattta atgtgaatac acttgtggtc ttcagacaca ccagaagagg gcatcagatc 1200

ccattacaga tggttgtgag ccaccatgtg gttgctggga attgaactca ggacttctgg 1260

aagagcagtc tgtgctcttg aactccgagc cacctctcca gcccctggat agtattatta 1320

tagagcacaa gcacacacaa cacaacaacc taaaaaccaa gcttcacaaa tacatttgtt 1380

gcttaatcat tttacttgtg tttggctaca agtcaagcaa aattataggt cctgaagaag 1440

cttggcaaaa tcacatttag accagctcga gggatcttca taagagaaga gggacagcta 1500

tgactgggag tagtcaggag aggaggaaaa atctggctag taaaacatgt aaggaaaatt 1560

ttagggatgt taaagaaaaa aataacacaa aacaaaatat aaaaaaaatc taacctcaag 1620

tcaaggcttt tct 1633

Claims (5)

1. A kind of 1. method for evaluating the lung cancer therapy effect that medicine drives to EML4-ALK L1196M oncogenes, it is characterised in that Comprise the following steps：

   (1) using PCR method amplification EML4-ALK L1196M genetic fragments and at its 5 ' end and 3 ' ends respectively plus EcoRI and NotI restriction enzyme sites, resulting fragment is connected on pClatent plasmids, obtains pClatent-EML4-ALK L1196M Plasmid；By the use of two sections of site of PCR method amplification mouse rosa 26 sequence as homology arm, pass through EcoRV and PacI, EcoRV respectively It is inserted into AscI on pClatent-EML4-ALK L1196M plasmids, so as to obtain mRosa-lsl-EML4-ALK L1196M Plasmid；The carrier segments on plasmid are cut away with EcoRV enzymes, obtain 5 ' mROSA-CAG-lox-stop-lox-EML4-ALK L1196M-3 ' mROSA genetic fragments；

   The sequence such as SEQ.ID.NO.1 institutes of the EML4-ALK L1196M genetic fragments plus restriction enzyme site described in step (1) Show；

   Two sections of the mouse rosa 26 site of step (1) sequence is respectively as shown in SEQ.ID.NO.9 and SEQ.ID.NO.10；

   5 '-mROSA-CAG-lox-stop-lox-EML4-ALK L1196M-3 ' mROSA genetic fragments described in step (1) its Sequence is as shown in SEQ.ID.NO.11；

   (2) by the mROSA- of transgenic fragment 5 ' of Cas9mRNA fragments, gRNA fragments and inducible expression EML4-ALK L1196M CAG-lox-stop-lox-EML4-ALK L1196M-3 ' mROSA are mixed, and mixture is expelled into mouse by microinjection In embryo, cas9 cuts ROSA26 sites under gRNA guiding, is inserted the genetic fragment of inducible expression by homologous recombination Enter genome；

   GRNA described in step (2), its sequence is as shown in SEQ.ID.NO.12；

   (3) transgenic embryo transfer that step (2) obtains is entered into replace-conceive mouse uterus, raises and treat that mouse is born, three pairs of design is drawn Thing enters performing PCR identification to 5 ' insertion points, 3 ' insertion points and EML4-ALK L1196M genes respectively, screens total positives Transgenic mice；

   (4) virus containing CRE recombinant protein enzyme genes is instilled mouse by the Mouse feeder of transgenic positive to growing up from nasal cavity In lung, so that by the EML4-ALK L1196M oncogene activations in pulmonary epithelial cells, mouse obtains adenocarcinoma of lung after 20 days；Pass through CT Detection and pathological section confirm the presence of cancerous lung tissue；

   (5) mouse is administered, administration terminates, CT detection lung cancer sizes, compared with the size before treatment；

   (6) after treatment end, mouse is put to death, prepares the pathological section of mouse lung tissue, reads the lung cancer pathology on pathological section Change；Again with CT associations, the ability that drug therapy EML4-ALK L1196M drive lung cancer is judged.
2. 2. according to the method for claim 1, it is characterised in that：In mixture described in step (2), Cas9mRNA fragments Concentration is 80ng/ μ L；The concentration of gRNA fragments is 30ng/ μ L；The mROSA-CAG-lox-stop-lox- of transgenic fragment 5 ' EML4-ALK L1196M-3 ' mROSA concentration is 8ng/ μ L.
3. 3. according to the method for claim 1, it is characterised in that：Injection described in step (2), injection volume 15pL.
4. 4. according to the method for claim 1, it is characterised in that：Transgenic embryo transfer is entered into replace-conceive described in step (3) Mouse uterus, it is after the replace-conceive mouse anesthesia by false pregnancy, from belly opening, exposes fallopian tubal mouth, transgenic embryo transfer is entered into generation Behind pregnant mouse uterus, skin is closed with wound clips.
5. 5. according to the method for claim 1, it is characterised in that：Adult described in step (4) is 6-8 week old.