CN107828807A - Aphid resistance of plant implementation method based on the promoters of ubiquitin 1 - Google Patents

Aphid resistance of plant implementation method based on the promoters of ubiquitin 1 Download PDF

Info

Publication number
CN107828807A
CN107828807A CN201711082631.2A CN201711082631A CN107828807A CN 107828807 A CN107828807 A CN 107828807A CN 201711082631 A CN201711082631 A CN 201711082631A CN 107828807 A CN107828807 A CN 107828807A
Authority
CN
China
Prior art keywords
gene
wheat
promoters
ubiquitin
leu
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201711082631.2A
Other languages
Chinese (zh)
Inventor
唐克轩
马嘉伟
付雪晴
张婷婷
赵静雅
谢利辉
黎凌
孙小芬
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Shanghai Jiaotong University
Original Assignee
Shanghai Jiaotong University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shanghai Jiaotong University filed Critical Shanghai Jiaotong University
Priority to CN201711082631.2A priority Critical patent/CN107828807A/en
Publication of CN107828807A publication Critical patent/CN107828807A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/88—Lyases (4.)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
    • C12N15/8279—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance
    • C12N15/8286—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance for insect resistance
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y402/00—Carbon-oxygen lyases (4.2)
    • C12Y402/03—Carbon-oxygen lyases (4.2) acting on phosphates (4.2.3)
    • C12Y402/03047—Beta-farnesene synthase (4.2.3.47)

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Biochemistry (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Cell Biology (AREA)
  • Plant Pathology (AREA)
  • Pest Control & Pesticides (AREA)
  • Insects & Arthropods (AREA)
  • Medicinal Chemistry (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)

Abstract

A kind of aphid resistance of plant implementation method based on the promoters of ubiquitin 1, E β F synzyme (E β farnesenesynthase are cloned into from American mint using genetic engineering means, E β FS) gene (E β F), build the promoters of ubiquitin 1 driving E β F carriers, the gene is transferred to wheat by gene gun conversion method, FPP synthesis [anti-] β farnesenes are catalyzed in wheat, by synthesizing plain [anti-] the β farnesenes of aphid alarm in wheat, reach transgenic wheat release [anti-] β farnesenes, so as to walk quickly and keep away the effect of aphid.

Description

Aphid resistance of plant implementation method based on ubiquitin-1 promoters
Technical field
The present invention relates to a kind of technology of bioengineering field, is specifically that one kind is based on ubiquitin-1 promoters The method for driving the enhancing aphid resistance of plant of E β F genes.
Background technology
Aphid is one of primary pest in agricultural production, and China's wheat mainly plants temperature liter between regional wheat growth stage Height, occur " warm winter ", cause aphid damage rampant, every year the warp in Wheat Production caused by the virus of aphid and its propagation Ji loss is extremely serious.Because current China's Major Wheat Cultivars are not strong to the resistance of aphid, how effectively to prevent eliminating aphis As one of significant problem in Wheat Production.Agricultural chemicals plays an important role in insect pest is resisted, but insect is gradual to agricultural chemicals Develop immunity to drugs, in addition, agricultural chemicals is also easy to pollute environment.Transgenic technology is helping the insect of crops resistance biting mouthparts Aspect has made major contribution.For example, the cotton for turning Bt toxalbumin has high anti-effect for bollworm.Therefore, prevent eliminating aphis It is a very urgent world subject.
[anti-]-β-farnesene (E- β-farnesene) is the sequiterpene being widely present in plant and animal.Numerous studies As a result show, [anti-]-β-farnesene is the main component of Aphid Alarm Pheromone.When aphid is by natural enemy predation or parasitoid When thing is attacked, plant can discharge [anti-]-β-farnesene, the aphid of surrounding is perceived and is fled from rapidly.
The content of the invention
The present invention proposes a kind of aphid resistance of plant implementation method based on ubiquitin-1 promoters, with chemical prevention phase Have than, insect-resistant transgenic plants obtained using genetic engineering means only effective to target pest, and do not have to the non-biology that endangers Influential advantage, pest-resistant material caused by plant expression is present in plant, environment will not be polluted, and cost It is low, beneficial to popularization.
The present invention is achieved by the following technical solutions：
The present invention relates to a kind of gene with aphids resistance function, specially synthase gene E β FS, from American mint Clone obtains in Mentha × piperita, and its nucleotide sequence is as shown in sequence 1.
The present invention relates to a kind of aphid resistance of plant implementation method based on ubiquitin-1 promoters, by thin from green pepper sample Clone obtains E β F synthase gene E β FS in lotus Mentha × piperita, is used by construction of expression vector and by the gene Ballistic methods are imported in wheat, realize the enhancing of wheat resistance to aphids.
Described expression vector, i.e. ubiquitin-1 promoters drive E β F carriers, by by American mint E β FS genes It is connected on plant Overexpression vector, structure obtains the plant Overexpression vector of the FS gene orders of β containing E.
Described ubiquitin-1 promoters are specially：PDE1005 constitutive promoter.
Technique effect
Compared with prior art, the present invention suitable for the plant of the present invention for having no particular limits, as long as it is adapted to Carry out the conversion operation of gene, such as various crops, flower plant or forestry plants.
Brief description of the drawings
Fig. 1 is pDE1005 of the present invention:proUBI:E β FS vector construction schematic diagrames；
Fig. 2 is that embodiment transfer ubiquitin-1 promoters drive E β FS genes T1 to identify schematic diagram for wheat PCR；
In figure：M：DL2000marker；+：pDE1005:proUBI:E β FS plasmids；CK：Wild type Fileder spring wheat； 1-1,1-3,1-5,2-3,2-5,2-6,3-1,3-5,3-6：Turn ubiquitin-1 promoters driving E β FS genes T1 to plant for wheat Strain, abbreviation EB.
Fig. 3 is that embodiment transfer ubiquitin-1 promoters drive E β FS genes T1 to illustrate for wheat Semi quantitative PCR analysis Figure.
Embodiment
The experimental method of unreceipted actual conditions in the following example, generally according to normal condition, such as Sambrook etc. Molecular cloning：Laboratory manual (New York:Coldspringharbor Laboratory Press, 1989) described in Condition, or according to the condition proposed by manufacturer.Used kit is the examination that commercially available or open channel can obtain Agent box.
Embodiment 1
The clone of American mint E β F genes
1. the extraction of American mint genome total serum IgE：American mint leaf tissue is taken, is placed in liquid nitrogen and grinds, adds and contains Have in 1.5mL Eppendorf (EP) centrifuge tube of lysate, fully after vibration, according to TIANGEN biochemical technologies Co., Ltd The specification extracted total RNA of plant total serum IgE kit.Total serum IgE quality is identified with agarose gel electrophoresis, then in spectrophotometer Upper measure rna content.
2. the clone of American mint E β F genes：Using the total serum IgE extracted as template, in PowerScript reverse transcriptase The lower synthesis cDNA of effect；According to the sequences Design gene-specific primer of E β F genes, E β F bases are expanded from total cDNA by PCR Cause, and be sequenced.
By above-mentioned steps, the total length 1650bp, its nucleotide coding sequence such as SEQ of American mint E β F genes are obtained Shown in ID NO.1, and its albumen coded sequence is derived as shown in SEQ ID NO.2, wherein, initiation codon ATG, terminate Codon is TGA.
PCR primer employed in the amplification of table 1
Primer Primer sequence (5 ' → 3 ')
EβF-FP1 ATGGCTACAAACGGCGTCGTAA
EβF-RP1 TCAAAAGACTATGGCATCAATAA
The PCR of table 2 reaction system
Embodiment 2
The structure of the plant Overexpression vector of the F genes of β containing E
E β F Gene Partials sequence is built on plant Overexpression vector (pDE1005) using recombinase, for convenience The structure of expression vector, SpeI restriction enzyme site is introduced in forward primer, SacI restriction enzyme site is introduced in reverse primer, Primer is as shown in table 3, and its promoter is ubiquitin-1 promoters；
The PCR primer of the pDE1005-E β F bodies of table 3 structure
Embodiment 3
Transformation of Wheat Immature Embryos by Biolistic Bombardment obtains Transgenic plant of wheat
1. IMMATURE EMBRYOS CULTURE：Post flowering 14d or so young fringe is chosen, collecting appropriately sized seed, (rataria size is 1.0- 1.5mm), with 70% ethanol surface sterilization 30s, 10% hypochlorite disinfectant 10-12min, sterilized water punching in superclean bench Wash 3 times, gently strip rataria, be seeded in SD2Evoked callus on culture medium.
2. Wheat Transformation Efficiency By Particle Bombardment rataria：Inoculation 8d or so Immature embryo calli is used as the acceptor of foreign gene.Contain The DNA parcel bronze bullet of target gene is converted.By acceptor in hyperosmosis culture medium (SD before biolistic bombardment2+ 0.4mol L-1 sorbierites) on pre-process 4h.Callus after bombardment continues to place 16h on hyperosmosis culture medium, turns Move on to SD214d renewal cultivation is carried out on culture medium, is then transferred on 1/2MS addition herbicide 35mg L-1 culture medium Carry out callus screening and seedling differentiation.The resistant plant of robust growth is transplanted into flowerpot.
3. the PCR detections of transgenic wheat：The PCR primer built using pDE1005-E β F bodies is examined to target gene Survey.As a result show, using designed PCR special primers, specific DNA fragment can be amplified.And with non-transformed Wheat volatiles When DNA is template, any fragment is not amplified.
The present embodiment utilizes Transformation of Wheat Immature Embryos by Biolistic Bombardment by described, obtains the Transgenic plant of wheat detected through PCR.
Embodiment 4
Turn ubiquitin-1 promoters and drive E β FS genes T1 for wheat target gene semi-quantitative analysis
With TIANGEN biochemical technologies Co., Ltd RNA extraction agents box, (RNAplant Plus plants Total RNAs extraction tries Agent) it is total for being extracted in the blade of wheat and non-transgenic wheat (CK) from ubiquitin-1 promoters driving E β FS genes T1 are turned RNA, through UV spectrophotometer measuring RNA concentration, with Takara companies RT reagent Kit RNA reverse transcriptions are cDNA by (Perfect Real Time).
Design sxemiquantitative gene (E β FS-RT-FP：TGGGATACCATTACGAACCTCAG, E β FS-RT-RP： ) and internal reference (ACTIN) (ACTIN-RT-FP GTGAGAGCCAATGTCATCCCAA：CCAACAGAGAGAAAATGACCCAGA, ACTIN-RT-RP：AACCTCCACTGAGAACAACATTACC) primer, synthesized by Shanghai life work.
PCR reaction systems are：The μ L of forward primer (10 μM) 0.5,10 μM of μ L, the 2X Premix of reverse primer (10 μM) 0.5, DNA profiling (sample) (100ng/ μ L) 2 μ L, add ddH2O to 20 μ L.PCR response parameters are：94 DEG C of 10min, 1cycle；94℃ 40s, 55 DEG C of 40s, 72 DEG C of 40s, 28cycles；72 DEG C of 10min, 1cycle；10 DEG C of terminations.PCR primer is coagulated with 1.0% agarose Gel electrophoresis detect, and in UVP gel imaging systems (Transilluminator White/UV, UVP, inc., USA) ultraviolet light Under take pictures.As a result as shown in figure 3, showing to turn E β FS gene tables of the ubiquitin-1 promoters driving E β FS genes T1 for wheat It is significantly improved up to amount.
Embodiment 5
Turn ubiquitin-1 promoters driving E β FS genes T1 and aphis resistance mirror is carried out in illumination cultivation room for wheat It is fixed.
The wheat aphid in same worm age is connected on transfer-gen plant to be measured and the tender leaf of 3 plants of wild-type wheat expansion respectively, often Strain connects 10, after cultivating 10 days, counts Aphed population on blade.As a result shown in table 1, compared with wild type control, turn Ubiquitin-1 promoters driving E β FS DNA triticum plant obtain the aphid resistance significantly improved.
Resistance Identification of the transgenic wheat of table 1 to aphid
As a result show, three turn ubiquitin-1 promoters driving E β FS genes T1 and show for Aphed population on wheat plant Work is less than wild type control.
Above-mentioned specific implementation can by those skilled in the art on the premise of without departing substantially from the principle of the invention and objective with difference Mode local directed complete set is carried out to it, protection scope of the present invention is defined by claims and not by above-mentioned specific implementation institute Limit, each implementation in the range of it is by the constraint of the present invention.
Sequence table
<110>Shanghai Communications University
<120>Aphid resistance of plant implementation method based on ubiquitin-1 promoters
<130> f-a999e
<141> 2017-11-07
<160> 6
<170> SIPOSequenceListing 1.0
<210> 1
<211> 1650
<212> DNA
<213>American mint (Mentha × piperita)
<400> 1
atggctacaa acggcgtcgt aattagttgc ctaagggaag taaggccacc tatgacgaag 60
catgcgcgaa gcatgtggac tgatactttt tctaactttt ctcttgacga taaggaacaa 120
caaaagcact cagaaaccat tgaagcactg aagcaagaag caagaggcat gcttatggct 180
gcaaccacgc ctctccaaca aatgacacta atcgacactc tcgagcgttt gggattggct 240
ttccattttg agacggagat cgaatacaaa atcgaacaaa tcaacgctgc tgcagaagac 300
ggcgactttg atttattcgc tacagctctt cgatttcgtt tgctcagaca gcatcaacgc 360
cacgtttctt gcgatgtttt cgacaagttt gtcgacaaag atggcaagtt tgaagaatcc 420
cttagcaata atgttgaagg cctatttagc ttgtatgaag cagctcatgt tggatttcgc 480
gacgaaagaa tattacaaga ggctgtaaat tttacgaggc atcacttgga agaagcagag 540
ttagatcaat ctccattatt aattaaagag aaagtgaagc gagctttgga gcaccctctt 600
catagggatt tccccattgt ctatgcacgc cttttcatct ccatttacga aaaggatgac 660
tctagagatg aattacttct caaactagcc aaagttaact tcaaattcat gcagaatttg 720
tataagaaag agctctccca actctccagg tggtggaaca catgggatct gaaatcgaaa 780
ttaccatatg caagagatcg agtggtggag gcttacgtat ggggtgtggg ataccattac 840
gaacctcagt actcatatgt tcgaatggga cttgccaaag gcatacaaat tattggaatc 900
atggatgata cttatgataa ttatgctaca ctcaatgaag ctcagctttt tactcaactc 960
ttagacaagt gggatagaga tgaagctgat cgactcccag aatacatgaa aatcgtttat 1020
gaatttattt tgagtacatg tgaagattat gaacgtgatg cagtgaaact tggaaaaagc 1080
tttgcagctc cttatttcaa cgaaaccgtg aaacaacttg ctagggcata caatcaagag 1140
ctgaagtggg ttatggaaag acaattgcct tcattccaag actacataaa aaattcagag 1200
ataactagtt gcatctatat catgtttgct tctactatcc caggcttgaa atctgttacc 1260
caagaaacca ttgattggat gaagagtgaa cccatgctgg cagtatcaac cggtatgatc 1320
ggccgatatt gggatgacat tggctctcac caccgcgaaa gcaaaggagg gcaaatgctg 1380
actgcgttgg attgccacat gaaagaatac ggtttgacaa aggaagagtc gttatctaag 1440
tttgaaggat tggttgagga aacatggaag gatataaaca aggaattcgt agccacaact 1500
tatgtgccta aagaaatcac catcacattc cttaactatg ctcggatgtg cgaggccact 1560
tacaacaaca ataacggaga cggttacaca gatgctaatg ttgccaaggc aaacgttact 1620
gctcttttta ttgatgccat agtcttttga 1650
<210> 2
<211> 585
<212> PRT
<213>American mint (Mentha × piperita)
<400> 2
Met Glu Thr Ala Thr Asn Gly Val Val Ile Ser Cys Leu Arg Glu Val
1 5 10 15
Arg Pro Pro Met Glu Thr Thr Lys His Ala Arg Ser Met Glu Thr Trp
20 25 30
Thr Asp Thr Phe Ser Asn Phe Ser Leu Asp Asp Lys Glu Gln Gln Lys
35 40 45
His Ser Glu Thr Ile Glu Ala Leu Lys Gln Glu Ala Arg Gly Met Glu
50 55 60
Thr Leu Met Glu Thr Ala Ala Thr Thr Pro Leu Gln Gln Met Glu Thr
65 70 75 80
Thr Leu Ile Asp Thr Leu Glu Arg Leu Gly Leu Ala Phe His Phe Glu
85 90 95
Thr Glu Ile Glu Tyr Lys Ile Glu Gln Ile Asn Ala Ala Ala Glu Asp
100 105 110
Gly Asp Phe Asp Leu Phe Ala Thr Ala Leu Arg Phe Arg Leu Leu Arg
115 120 125
Gln His Gln Arg His Val Ser Cys Asp Val Phe Asp Lys Phe Val Asp
130 135 140
Lys Asp Gly Lys Phe Glu Glu Ser Leu Ser Asn Asn Val Glu Gly Leu
145 150 155 160
Phe Ser Leu Tyr Glu Ala Ala His Val Gly Phe Arg Asp Glu Arg Ile
165 170 175
Leu Gln Glu Ala Val Asn Phe Thr Arg His His Leu Glu Glu Ala Glu
180 185 190
Leu Asp Gln Ser Pro Leu Leu Ile Lys Glu Lys Val Lys Arg Ala Leu
195 200 205
Glu His Pro Leu His Arg Asp Phe Pro Ile Val Tyr Ala Arg Leu Phe
210 215 220
Ile Ser Ile Tyr Glu Lys Asp Asp Ser Arg Asp Glu Leu Leu Leu Lys
225 230 235 240
Leu Ala Lys Val Asn Phe Lys Phe Met Glu Thr Gln Asn Leu Tyr Lys
245 250 255
Lys Glu Leu Ser Gln Leu Ser Arg Trp Trp Asn Thr Trp Asp Leu Lys
260 265 270
Ser Lys Leu Pro Tyr Ala Arg Asp Arg Val Val Glu Ala Tyr Val Trp
275 280 285
Gly Val Gly Tyr His Tyr Glu Pro Gln Tyr Ser Tyr Val Arg Met Glu
290 295 300
Thr Gly Leu Ala Lys Gly Ile Gln Ile Ile Gly Ile Met Glu Thr Asp
305 310 315 320
Asp Thr Tyr Asp Asn Tyr Ala Thr Leu Asn Glu Ala Gln Leu Phe Thr
325 330 335
Gln Leu Leu Asp Lys Trp Asp Arg Asp Glu Ala Asp Arg Leu Pro Glu
340 345 350
Tyr Met Glu Thr Lys Ile Val Tyr Glu Phe Ile Leu Ser Thr Cys Glu
355 360 365
Asp Tyr Glu Arg Asp Ala Val Lys Leu Gly Lys Ser Phe Ala Ala Pro
370 375 380
Tyr Phe Asn Glu Thr Val Lys Gln Leu Ala Arg Ala Tyr Asn Gln Glu
385 390 395 400
Leu Lys Trp Val Met Glu Thr Glu Arg Gln Leu Pro Ser Phe Gln Asp
405 410 415
Tyr Ile Lys Asn Ser Glu Ile Thr Ser Cys Ile Tyr Ile Met Glu Thr
420 425 430
Phe Ala Ser Thr Ile Pro Gly Leu Lys Ser Val Thr Gln Glu Thr Ile
435 440 445
Asp Trp Met Glu Thr Lys Ser Glu Pro Met Glu Thr Leu Ala Val Ser
450 455 460
Thr Gly Met Glu Thr Ile Gly Arg Tyr Trp Asp Asp Ile Gly Ser His
465 470 475 480
His Arg Glu Ser Lys Gly Gly Gln Met Glu Thr Leu Thr Ala Leu Asp
485 490 495
Cys His Met Glu Thr Lys Glu Tyr Gly Leu Thr Lys Glu Glu Ser Leu
500 505 510
Ser Lys Phe Glu Gly Leu Val Glu Glu Thr Trp Lys Asp Ile Asn Lys
515 520 525
Glu Phe Val Ala Thr Thr Tyr Val Pro Lys Glu Ile Thr Ile Thr Phe
530 535 540
Leu Asn Tyr Ala Arg Met Glu Thr Cys Glu Ala Thr Tyr Asn Asn Asn
545 550 555 560
Asn Gly Asp Gly Tyr Thr Asp Ala Asn Val Ala Lys Ala Asn Val Thr
565 570 575
Ala Leu Phe Ile Asp Ala Ile Val Phe
580 585
<210> 3
<211> 22
<212> DNA
<213>Amplimer E β F-FP1 ()
<400> 3
atggctacaa acggcgtcgt aa 22
<210> 4
<211> 23
<212> DNA
<213>Amplimer E β F-RP1 ()
<400> 4
tcaaaagact atggcatcaa taa 23
<210> 5
<211> 43
<212> DNA
<213>Expression vector establishment primer SpelI-E β FS-In-FP ()
<400> 5
agattttcaa tcgatactag tatggctaca aacggcgtcg taa 43
<210> 6
<211> 44
<212> DNA
<213>Expression vector establishment primer E β FS-SacI-In-RP ()
<400> 6
cgatcgggga aattcgagct ctcaaaagac tatggcatca ataa 44

Claims (5)

1. a kind of gene with aphids resistance function, it is characterised in that be specially synthase gene E β FS, from American mint Clone obtains in Mentha × piperita.
2. a kind of aphid resistance of plant implementation method based on ubiquitin-1 promoters, it is characterised in that by from American mint Clone obtains E β F synthase gene E β FS in Mentha × piperita, and base is used by construction of expression vector and by the gene Because rifle method is imported in wheat, the enhancing of wheat resistance to aphids is realized.
3. according to the method for claim 2, it is characterized in that, described expression vector is corn ubiquitin-1 promoters E β F carriers are driven, by the way that American mint E β FS genes are connected on plant Overexpression vector, structure obtains the FS gene sequences of β containing E The plant Overexpression vector of row.
4. according to the method for claim 2, it is characterized in that, described ballistic methods refer to：Used with Immature embryo calli The acceptor of foreign gene is done, the DNA parcel bronze bullet containing target gene is converted, then passed through on culture medium Renewal cultivation and screening obtain.
5. the method according to claim 11, it is characterized in that, in described ballistic methods, by acceptor before biolistic bombardment In hyperosmosis SD2Pre-processed on the culture medium of+0.4mol L-1 sorbierites；Callus after bombardment is in hyperosmosis culture Continue to place 16h on base, be transferred to SD214d renewal cultivation is carried out on culture medium, is then transferred into 1/2MS addition herbicides Callus screening and seedling differentiation are carried out on 35mgL-1 culture medium.
CN201711082631.2A 2017-11-07 2017-11-07 Aphid resistance of plant implementation method based on the promoters of ubiquitin 1 Pending CN107828807A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201711082631.2A CN107828807A (en) 2017-11-07 2017-11-07 Aphid resistance of plant implementation method based on the promoters of ubiquitin 1

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201711082631.2A CN107828807A (en) 2017-11-07 2017-11-07 Aphid resistance of plant implementation method based on the promoters of ubiquitin 1

Publications (1)

Publication Number Publication Date
CN107828807A true CN107828807A (en) 2018-03-23

Family

ID=61653759

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201711082631.2A Pending CN107828807A (en) 2017-11-07 2017-11-07 Aphid resistance of plant implementation method based on the promoters of ubiquitin 1

Country Status (1)

Country Link
CN (1) CN107828807A (en)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2008006564A1 (en) * 2006-07-12 2008-01-17 Max-Plack-Gesellschaft Zur Förderung Der Wissenschaften E.V. Polynucleotides encoding caryophyllene synthase and uses thereof
CN102154271A (en) * 2011-01-26 2011-08-17 中国农业科学院作物科学研究所 Method for breeding aphid-resistant transgenic wheat and special vector
CN107760702A (en) * 2017-11-03 2018-03-06 上海交通大学 Aphid resistance of plant implementation method based on 35S promoter

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2008006564A1 (en) * 2006-07-12 2008-01-17 Max-Plack-Gesellschaft Zur Förderung Der Wissenschaften E.V. Polynucleotides encoding caryophyllene synthase and uses thereof
CN102154271A (en) * 2011-01-26 2011-08-17 中国农业科学院作物科学研究所 Method for breeding aphid-resistant transgenic wheat and special vector
CN107760702A (en) * 2017-11-03 2018-03-06 上海交通大学 Aphid resistance of plant implementation method based on 35S promoter

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
TOBY J.A. BRUCE ET AL.: "The first crop plant genetically engineered to release an insect pheromone for defence", 《SCIENTIFIC REPORTS》 *
喻修道: "EβF合成酶基因的克隆及功能分析", 《中国博士学位论文全文数据库农业科技辑》 *
贾殿勇等: "[反]-β-法尼烯合成酶基因在植物抗蚜分子育种中的应用", 《生物工程学报》 *

Similar Documents

Publication Publication Date Title
WO2018113702A1 (en) Plant grain trait-related protein, gene, promoter and snps and haplotypes
CN105254726B (en) ERF class transcription factor relevant to plant stress-resistance and its encoding gene and application
CN104480117B (en) NBS-LRR (nucleotide binding site-leucine-rich repeat) gene in arachis hypogaea.L and application thereof to bacterial wilt resistance of tobaccos
CN102766618B (en) Rice OsICL protein and coding gene thereof, and application of the two
CN111235165B (en) Lily susceptible fungal gene LrWRKY-S1 and application thereof
CN101775398B (en) Stress tolerance genetic engineering application of NAC protein gene DlNAC of chrysanthemum
CN106282201B (en) maize transcription factor ZmbHLH2 and its application
CN1814620A (en) Soybean WRKY transcription factor GmWRKY6 and its coding gene and use
CN105440131A (en) Pteromalus puparumvenom serine protease inhibitor PpSerpin protein and application thereof
CN115305252A (en) Receptor kinase gene OsIFBR1 for regulating and controlling rice resistance
CN100349916C (en) PHD transcription factor of soybean and its coding gene and usage
CN102268081B (en) Rice lateral root control gene OsIAAII and use thereof
CN100513421C (en) Plant inverse-resistant zinc finger protein, coding gene and application thereof
CN100549029C (en) One plant disease resistance-related SGT1 and encoding gene and application
CN1296383C (en) Plant DREB transcription factor and its coding gene and uses
CN105175522B (en) Crowtoe AP2/ERF transcription factors and its encoding gene and application
CN101724030A (en) Plant lead-resistant albumen, coding gene thereof and application thereof
CN107828807A (en) Aphid resistance of plant implementation method based on the promoters of ubiquitin 1
CN114989283A (en) Application of TCP19 protein in regulation and control of rice sheath blight resistance
CN100549028C (en) Plant against disease relevant protein RAR 1 and encoding gene thereof and application
CN1216905C (en) Transcription factor for regulating and controlling dry land cotton anti contrary property and its coded gene and application
CN102796747A (en) Application of Zea mays L. drought-induced protein (ZmDIP1) gene and its encoding protein
CN107760702A (en) Aphid resistance of plant implementation method based on 35S promoter
CN101993479B (en) Plant stress tolerance related transcription factor TaWRKY1 as well as coding gene and application thereof
CN116003563B (en) Application of calmodulin binding protein CaMBP in regulating cold tolerance of plant

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
RJ01 Rejection of invention patent application after publication
RJ01 Rejection of invention patent application after publication

Application publication date: 20180323