CN107760702A - Aphid resistance of plant implementation method based on 35S promoter - Google Patents
Aphid resistance of plant implementation method based on 35S promoter Download PDFInfo
- Publication number
- CN107760702A CN107760702A CN201711068786.0A CN201711068786A CN107760702A CN 107760702 A CN107760702 A CN 107760702A CN 201711068786 A CN201711068786 A CN 201711068786A CN 107760702 A CN107760702 A CN 107760702A
- Authority
- CN
- China
- Prior art keywords
- wheat
- leu
- glu
- plant
- resistance
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/88—Lyases (4.)
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
- A01H4/00—Plant reproduction by tissue culture techniques ; Tissue culture techniques therefor
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
- C12N15/8279—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance
- C12N15/8286—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance for insect resistance
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y402/00—Carbon-oxygen lyases (4.2)
- C12Y402/03—Carbon-oxygen lyases (4.2) acting on phosphates (4.2.3)
- C12Y402/03047—Beta-farnesene synthase (4.2.3.47)
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Molecular Biology (AREA)
- Biomedical Technology (AREA)
- Developmental Biology & Embryology (AREA)
- Cell Biology (AREA)
- Microbiology (AREA)
- Insects & Arthropods (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Medicinal Chemistry (AREA)
- Pest Control & Pesticides (AREA)
- Botany (AREA)
- Environmental Sciences (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
A kind of aphid resistance of plant implementation method based on 35s promoters, E β F synthase gene E β FS are obtained by being cloned from American mint Mentha × piperita, Agrobacterium is transferred to by construction of expression vector and by the carrier, wheat immature embryo is infected with the Agrobacterium, realize and FPP synthesis [anti-] β farnesenes are catalyzed in wheat, by synthesizing plain [anti-] the β farnesenes of aphid alarm in wheat, reach transgenic wheat release [anti-] β farnesenes, so as to walk quickly and keep away the effect of aphid.
Description
Technical field
The present invention relates to a kind of technology of bioengineering field, specifically a kind of Genes For Plant Tolerance based on 35S promoter
Aphid property implementation method.
Background technology
Aphid is one of primary pest in agricultural production, and China's wheat mainly plants temperature liter between regional wheat growth stage
Height, occur " warm winter ", cause aphid damage rampant, every year the warp in Wheat Production caused by the virus of aphid and its propagation
Ji loss is extremely serious.Because current China's Major Wheat Cultivars are not strong to the resistance of aphid, how effectively to prevent eliminating aphis
As one of significant problem in Wheat Production.Agricultural chemicals plays an important role in insect pest is resisted, but insect is gradual to agricultural chemicals
Develop immunity to drugs, in addition, agricultural chemicals is also easy to pollute environment.Transgenic technology is helping the insect of crops resistance biting mouthparts
Aspect has made major contribution.For example, the cotton for turning Bt toxalbumin has high anti-effect for bollworm.Therefore, prevent eliminating aphis
It is a very urgent world subject.
[anti-]-β-farnesene (E- β-farnesene) is the sequiterpene being widely present in plant and animal.Numerous studies
As a result show, [anti-]-β-farnesene is the main component of Aphid Alarm Pheromone.When aphid is by natural enemy predation or parasitoid
When thing is attacked, plant can discharge [anti-]-β-farnesene, the aphid of surrounding is perceived and is fled from rapidly.
The content of the invention
The present invention proposes a kind of aphid resistance of plant implementation method based on 35S promoter, compared with chemical prevention, utilizes base
Because engineering means obtain insect-resistant transgenic plants have only it is effective to target pest, and on it is non-endanger biology do not have it is influential excellent
Point, pest-resistant material caused by plant expression is present in plant, environment will not be polluted, and cost is low, beneficial to popularization.
The present invention is achieved by the following technical solutions：
The present invention relates to a kind of gene with aphids resistance function, specially synthase gene E β FS, from American mint
Clone obtains in Mentha × piperita, and its amino acid sequence is as shown in Seq ID No.2.
The present invention relates to a kind of aphid resistance of plant implementation method based on 35S promoter, by from American mint Mentha
Clone obtains E β F synthase gene E β FS in × piperita, and Agrobacterium is transferred to by construction of expression vector and by the carrier, with
The Agrobacterium infects wheat immature embryo, realizes the enhancing of wheat resistance to aphids.
Described expression vector is the E β F carriers of 35S promoter driving, by the way that American mint E β FS genes are connected in into transformation
Build and obtain on plant Overexpression vector afterwards.
Described 35S promoter is specially：Constitutive promoter on pCAMBIA1305.1.
Described Agrobacterium is commercially available Agrobacterium tumefaciems (Agrobacterium tumefaciens) bacterial strain EHA105,
From Australian CAMBIA companies, strain number is Gambar 1.
Technique effect
Compared with prior art, the present invention suitable for the plant of the present invention for having no particular limits, as long as it is adapted to
Carry out the conversion operation of gene, such as various crops, flower plant or forestry plants.
Brief description of the drawings
Fig. 1 is pCAMBIA1305 of the present invention:35S:E β FS vector construction schematic diagrames；
In figure：Fig. 1 a are pCAMBIA1305.1, and Fig. 1 b are E β FS genes, and Fig. 1 c are the present invention FS gene orders of β containing E
Plant Overexpression vector；
Fig. 2 is that embodiment transfer 35S promoter drives E β FS genes T1 to identify schematic diagram for wheat PCR；
In figure：M：DL2000marker；+：pCAMBIA1305:35S:E β FS plasmids；CK：Wild type Fielder, 1-1,
1-2,1-4,2-3,2-5,2-6,3-4,3-5,3-8：Turn 35S promoter and drive E β FS genes T1 for wheat plant, abbreviation EE.
Fig. 3 is that embodiment transfer 35S promoter drives E β FS genes T1 for wheat Semi quantitative PCR analysis schematic diagram.
Embodiment
The experimental method of unreceipted actual conditions in the following example, generally according to normal condition, such as Sambrook etc.
Molecular cloning：Laboratory manual (New York:Coldspringharbor Laboratory Press, 1989) described in
Condition, or according to the condition proposed by manufacturer.Used kit is the examination that commercially available or open channel can obtain
Agent box.
Embodiment 1
The clone of American mint E β F genes
1. the extraction of American mint genome total serum IgE：American mint leaf tissue is taken, is placed in liquid nitrogen and grinds, adds and contains
Have in 1.5mL Eppendorf (EP) centrifuge tube of lysate, fully after vibration, taken out according to the specification of TIANGEN kits
Carry total serum IgE.Total serum IgE quality is identified with agarose gel electrophoresis, rna content is then determined on spectrophotometer.
2. the clone of American mint E β F genes：Using the total serum IgE extracted as template, in PowerScript reverse transcriptase
The lower synthesis cDNA of effect；According to the sequences Design gene-specific primer of E β F genes, E β F bases are expanded from total cDNA by PCR
Cause, and be sequenced.
By above-mentioned steps, the total length 1650bp, its nucleotide sequence such as SEQ ID of American mint E β F genes are obtained
Shown in NO.1, and its albumen coded sequence is derived as shown in SEQ ID NO.2, wherein, initiation codon ATG, terminate close
Numeral is TGA.
PCR primer employed in the amplification of table 1
The PCR of table 2 reaction system
| cDNA | 1μL |
| 10×KOD Plus Buffer | 5μL |
| dNTP | 5μL |
| MgSO4 | 2μL |
| EβF-FP1 | 1μL |
| EβF-RP1 | 1μL |
| KOD Plus | 1μL |
| ddH2O | 34μL |
| Cumulative volume | 50μL |
Embodiment 2
The structure of the plant Overexpression vector of the F genes of β containing E：By E β F Gene Partials sequence constructs in improved plant
On Overexpression vector (pCAMBIA1305.1), in order to facilitate the structure of expression vector, NcoI enzyme is introduced in forward primer
Enzyme site, BstEII restriction enzyme site is introduced in reverse primer, and primer is as shown in table 3；
The PCR primer of the pCAMBIA1305.1-E β F vector constructions of table 3
| Primer | Primer sequence (5 ' → 3 ') |
| NcoI-EβF-FP | CATGCCATGGCTACAAACGGCGTCGTAA |
| EβF-BstEII-RP | CCCAGTGGTCAAAAGACTATGGCATCAAT |
Described improved plant Overexpression vector pCAMBIA1305.1, by commercially available pCAMBIA1305 loads
The restriction enzyme site that XhoI is introduced in EPSPS gene forward primers and reverse primer of body, it is excessive to build posttectonic plant
Expression vector pCAMBIA1305.1.
Embodiment 3
Agrobacterium tumefaciens mediated E β F Overexpression vector genetic transformations wheat obtains Transgenic plant of wheat
1. the acquisition of the Agrobacterium tumefaciems engineering bacteria of the plant Overexpression vector of the F genes of β containing E：By β containing E in embodiment 2
F plant Overexpression vector is transferred to Agrobacterium tumefaciems using freeze-thaw method (such as EHA105, there is the biological material of public offering for market
Material, can buy, strain number is Gambar 1 from Australian CAMBIA companies), performing PCR of going forward side by side checking.As a result show, contain
E β F plant Overexpression vector is successfully building up in Agrobacterium tumefaciens strain.
2. Agrobacterium tumefaciens mediated E β F genetic transformation Fielder spring wheat
2.1. the preculture of rataria：Bloom pollination after 13~14d immature seed (1.0~1.2mm of rataria size), use
70% alcohol surface sterilization 1~2min, 15% sodium hypochlorite sterilizing 15min, aseptic water washing 4~5 times.
2.2. the co-cultivation of Agrobacterium and Immature embryo calli：At room temperature, 3500rpm centrifuges 10min and collects Agrobacterium bacterium
Body, supernatant is removed to the greatest extent, with 1/10WCC re-suspension liquids (MS minimal mediums) with 1：2 ratios are resuspended.Wheat immature embryo is transferred to Agrobacterium
30min is infected in bacterium solution, callus is transferred on the aseptic filter paper in sterilizing culture dish, co-cultured under 25 DEG C of dark conditions
2d (rataria).
The Immature embryo calli for co-culturing 2d is transferred to IESX1 culture mediums (MS minimal mediums (vitamin containing MS)+30g
L-1Sucrose+2.0mg L-1dicamba+250mg L-1Cb+5mg L-1PPT, pH 5.8), 25 DEG C of dark culturings 2 weeks, then shift
To IESX2 culture mediums (MS minimal mediums (vitamin containing MS)+30g L-1Sucrose+2.0mg L-1dicamba+250mg L-1Cb
+10mg L-1PPT, pH 5.8), 25 DEG C of dark culturings 2-3 weeks.
2.3. the screening of resistance regeneration plant：Immature embryo calli after screening is transferred to IEFH culture mediums, and (MS is trained substantially
Support base (vitamin containing MS)+20g L-1 sucrose+0.2mg L-1 2,4-D+250mg L-1Cb+5mg L-1PPT, pH=5.8),
25 DEG C, illumination cultivation 3~4 weeks.
Mature embryo callus after screening is transferred to XCFH differential mediums, and (MS minimal mediums (are free of MS vitamins)
+ 20g L-1 sucrose+10.0mg L-1B1 vitamin+1.0mg L-1B3 vitamin+1.0mg L-1B6 vitamin+2.0mg L-1
Glycine+5.0mg L-1 glutamine+0.2mg L-1IAA+250mg L-1Cb+5mg L-1PPT, pH5.8) on, 25 DEG C of light
According to culture 3~4 weeks, break up plant.
The long seedling to 2~3cm is moved into Rooting and hardening-off culture base (1/2MS culture mediums (vitamin containing MS)+20g L-1
Sucrose+250mg L-1Cb+5mg L-1PPT, pH 5.8) on, 25 DEG C, cultivate 3~4 weeks under illumination condition.Transplant robust growth
Resistant plant into flowerpot.
3. the PCR detections of transgenic wheat：Using the PCR primer of pCAMBIA1305.1-E β F bodies structure to target gene
Detected.As a result show, using designed PCR special primers, specific DNA fragment can be amplified.And with non-transformed wheat
When genomic DNA is template, any fragment is not amplified.
Described plant expression vector is converted Agrobacterium tumefaciems by the present embodiment, obtains the F of β containing the E plants for transformed wheat
The Agrobacterium tumefaciens strain of thing Overexpression vector, using constructed Agrobacterium tumefaciens strain transformed wheat rataria, passed through
The Transgenic plant of wheat of PCR detections.
Embodiment 4
Turn 35S promoter and drive E β FS genes T1 for wheat target gene semi-quantitative analysis
With TIANGEN biochemical technologies Co., Ltd RNA extraction agents box, (RNAplant Plus plants Total RNAs extraction tries
Agent) from turn 35S promoter drive E β FS genes T1 for total serum IgE is extracted in the blade of wheat and non-transgenic wheat (CK), through purple
Outer spectrophotometer detects RNA concentration, with Takara companiesRT reagent Kit(Perfect Real
Time it is) cDNA by RNA reverse transcriptions.
Design sxemiquantitative gene (E β FS-RT-FP：TGGGATACCATTACGAACCTCAG, E β FS-RT-RP：
) and internal reference (ACTIN) (ACTIN-RT-FP GTGAGAGCCAATGTCATCCCAA：CCAACAGAGAGAAAATGACCCAGA,
ACTIN-RT-RP：AACCTCCACTGAGAACAACATTACC) primer, synthesized by Shanghai life work.PCR reaction systems are：
The μ L of forward primer (10 μM) 0.5, reverse primer (10 μM) 0.5 10 μM of μ L, 2X Premix, DNA profiling (sample) (100ng/ μ
L) 2 μ L, ddH2O is added to 20 μ L.PCR response parameters are：94 DEG C of 10min, 1cycle；94 DEG C of 40s, 55 DEG C of 40s, 72 DEG C of 40s,
28cycles；72 DEG C of 10min, 1cycle；10 DEG C of terminations.PCR primer is detected with 1.0% agarose gel electrophoresis, and coagulated in UVP
Taken pictures under glue imaging system (Transilluminator White/UV, UVP, inc., USA) ultraviolet light.As a result as shown in figure 3,
Show that turn 35S promoter driving E β FS genes T1 is significantly improved for the E β FS gene expression amounts of wheat.
Embodiment 5
Turn 35S promoter driving E β FS genes T1 and aphis resistance identification is carried out in illumination cultivation room for wheat.
The wheat aphid in same worm age is connected on transfer-gen plant to be measured and the tender leaf of 3 plants of wild-type wheat expansion respectively, often
Strain connects 10, after cultivating 10 days, counts Aphed population on blade.As a result shown in table 1, compared with wild type control, 35S startups are turned
Son driving E β FS DNA triticum plant obtain the aphid resistance significantly improved.
Resistance Identification of the transgenic wheat of table 4 to aphid
As a result show, three turn 35S promoter driving E β FS genes T1 and are substantially less than open country for Aphed population on wheat plant
Raw type control.
Above-mentioned specific implementation can by those skilled in the art on the premise of without departing substantially from the principle of the invention and objective with difference
Mode local directed complete set is carried out to it, protection scope of the present invention is defined by claims and not by above-mentioned specific implementation institute
Limit, each implementation in the range of it is by the constraint of the present invention.
Sequence table
<110>Shanghai Communications University
<120>Aphid resistance of plant implementation method based on 35S promoter
<130> f-a995e
<141> 2017-11-03
<160> 6
<170> SIPOSequenceListing 1.0
<210> 1
<211> 1650
<212> DNA
<213>American mint (Mentha × piperita)
<400> 1
<210> 2
<211> 585
<212> PRT
<213>American mint (Mentha × piperita)
<400> 2
Met Glu Thr Ala Thr Asn Gly Val Val Ile Ser Cys Leu Arg Glu Val
1 5 10 15
Arg Pro Pro Met Glu Thr Thr Lys His Ala Arg Ser Met Glu Thr Trp
20 25 30
Thr Asp Thr Phe Ser Asn Phe Ser Leu Asp Asp Lys Glu Gln Gln Lys
35 40 45
His Ser Glu Thr Ile Glu Ala Leu Lys Gln Glu Ala Arg Gly Met Glu
50 55 60
Thr Leu Met Glu Thr Ala Ala Thr Thr Pro Leu Gln Gln Met Glu Thr
65 70 75 80
Thr Leu Ile Asp Thr Leu Glu Arg Leu Gly Leu Ala Phe His Phe Glu
85 90 95
Thr Glu Ile Glu Tyr Lys Ile Glu Gln Ile Asn Ala Ala Ala Glu Asp
100 105 110
Gly Asp Phe Asp Leu Phe Ala Thr Ala Leu Arg Phe Arg Leu Leu Arg
115 120 125
Gln His Gln Arg His Val Ser Cys Asp Val Phe Asp Lys Phe Val Asp
130 135 140
Lys Asp Gly Lys Phe Glu Glu Ser Leu Ser Asn Asn Val Glu Gly Leu
145 150 155 160
Phe Ser Leu Tyr Glu Ala Ala His Val Gly Phe Arg Asp Glu Arg Ile
165 170 175
Leu Gln Glu Ala Val Asn Phe Thr Arg His His Leu Glu Glu Ala Glu
180 185 190
Leu Asp Gln Ser Pro Leu Leu Ile Lys Glu Lys Val Lys Arg Ala Leu
195 200 205
Glu His Pro Leu His Arg Asp Phe Pro Ile Val Tyr Ala Arg Leu Phe
210 215 220
Ile Ser Ile Tyr Glu Lys Asp Asp Ser Arg Asp Glu Leu Leu Leu Lys
225 230 235 240
Leu Ala Lys Val Asn Phe Lys Phe Met Glu Thr Gln Asn Leu Tyr Lys
245 250 255
Lys Glu Leu Ser Gln Leu Ser Arg Trp Trp Asn Thr Trp Asp Leu Lys
260 265 270
Ser Lys Leu Pro Tyr Ala Arg Asp Arg Val Val Glu Ala Tyr Val Trp
275 280 285
Gly Val Gly Tyr His Tyr Glu Pro Gln Tyr Ser Tyr Val Arg Met Glu
290 295 300
Thr Gly Leu Ala Lys Gly Ile Gln Ile Ile Gly Ile Met Glu Thr Asp
305 310 315 320
Asp Thr Tyr Asp Asn Tyr Ala Thr Leu Asn Glu Ala Gln Leu Phe Thr
325 330 335
Gln Leu Leu Asp Lys Trp Asp Arg Asp Glu Ala Asp Arg Leu Pro Glu
340 345 350
Tyr Met Glu Thr Lys Ile Val Tyr Glu Phe Ile Leu Ser Thr Cys Glu
355 360 365
Asp Tyr Glu Arg Asp Ala Val Lys Leu Gly Lys Ser Phe Ala Ala Pro
370 375 380
Tyr Phe Asn Glu Thr Val Lys Gln Leu Ala Arg Ala Tyr Asn Gln Glu
385 390 395 400
Leu Lys Trp Val Met Glu Thr Glu Arg Gln Leu Pro Ser Phe Gln Asp
405 410 415
Tyr Ile Lys Asn Ser Glu Ile Thr Ser Cys Ile Tyr Ile Met Glu Thr
420 425 430
Phe Ala Ser Thr Ile Pro Gly Leu Lys Ser Val Thr Gln Glu Thr Ile
435 440 445
Asp Trp Met Glu Thr Lys Ser Glu Pro Met Glu Thr Leu Ala Val Ser
450 455 460
Thr Gly Met Glu Thr Ile Gly Arg Tyr Trp Asp Asp Ile Gly Ser His
465 470 475 480
His Arg Glu Ser Lys Gly Gly Gln Met Glu Thr Leu Thr Ala Leu Asp
485 490 495
Cys His Met Glu Thr Lys Glu Tyr Gly Leu Thr Lys Glu Glu Ser Leu
500 505 510
Ser Lys Phe Glu Gly Leu Val Glu Glu Thr Trp Lys Asp Ile Asn Lys
515 520 525
Glu Phe Val Ala Thr Thr Tyr Val Pro Lys Glu Ile Thr Ile Thr Phe
530 535 540
Leu Asn Tyr Ala Arg Met Glu Thr Cys Glu Ala Thr Tyr Asn Asn Asn
545 550 555 560
Asn Gly Asp Gly Tyr Thr Asp Ala Asn Val Ala Lys Ala Asn Val Thr
565 570 575
Ala Leu Phe Ile Asp Ala Ile Val Phe
580 585
<210> 3
<211> 22
<212> DNA
<213>Amplimer E β F-FP1 ()
<400> 3
atggctacaa acggcgtcgt aa 22
<210> 4
<211> 23
<212> DNA
<213>Amplimer E β F-RP1 ()
<400> 4
tcaaaagact atggcatcaa taa 23
<210> 5
<211> 28
<212> DNA
<213>Expression vector establishment primer NcoI-E β F-FP ()
<400> 5
catgccatgg ctacaaacgg cgtcgtaa 28
<210> 6
<211> 29
<212> DNA
<213>Expression vector establishment primer E β F-BstEII-RP ()
<400> 6
cccagtggtc aaaagactat ggcatcaat 29
Claims (5)
1. a kind of gene with aphids resistance function, it is characterised in that be specially synthase gene E β FS, from American mint
Clone obtains in Mentha × piperita, and its amino acid sequence is as shown in Seq ID No.2.
2. a kind of aphid resistance of plant implementation method based on ubiquitin-1 promoters, it is characterised in that by from American mint
Clone obtains E β F synthase gene E β FS in Mentha × piperita, and agriculture is transferred to by construction of expression vector and by the carrier
Bacillus, wheat immature embryo is infected with the Agrobacterium, realizes the enhancing of wheat resistance to aphids.
3. according to the method for claim 2, it is characterized in that, described expression vector is that the E β F of 35S promoter driving are carried
Body, obtained by the way that American mint E β FS genes to be connected in build on improved plant Overexpression vector.
4. according to the method for claim 2, it is characterized in that, described is transferred to, i.e., is transferred to expression vector using freeze-thaw method
Agrobacterium tumefaciems.
5. according to the method for claim 2, it is characterized in that, described infects, i.e., wheat immature embryo is transferred into Agrobacterium bacterium
Culture obtains Immature embryo calli on the culture medium being placed in after being infected in liquid under dark condition, and then is screened through resistance regeneration plant
After obtain wheat resistance seedling.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711068786.0A CN107760702A (en) | 2017-11-03 | 2017-11-03 | Aphid resistance of plant implementation method based on 35S promoter |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711068786.0A CN107760702A (en) | 2017-11-03 | 2017-11-03 | Aphid resistance of plant implementation method based on 35S promoter |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN107760702A true CN107760702A (en) | 2018-03-06 |
Family
ID=61273134
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201711068786.0A Pending CN107760702A (en) | 2017-11-03 | 2017-11-03 | Aphid resistance of plant implementation method based on 35S promoter |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107760702A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107828807A (en) * | 2017-11-07 | 2018-03-23 | 上海交通大学 | Aphid resistance of plant implementation method based on the promoters of ubiquitin 1 |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102154271A (en) * | 2011-01-26 | 2011-08-17 | 中国农业科学院作物科学研究所 | Method for breeding aphid-resistant transgenic wheat and special vector |
-
2017
- 2017-11-03 CN CN201711068786.0A patent/CN107760702A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102154271A (en) * | 2011-01-26 | 2011-08-17 | 中国农业科学院作物科学研究所 | Method for breeding aphid-resistant transgenic wheat and special vector |
Non-Patent Citations (4)
| Title |
|---|
| LIANG GAO等: "Expression of a Peppermint (E)-β-Farnesene Synthase Gene in Rice Has Significant Repelling Effect on Bird Cherry-Oat Aphid (Rhopalosiphum padi)", 《PLANT MOL BIOL REP》 * |
| MICHAEL H. BEALE等: "Aphid alarm pheromone produced by transgenic plants affects aphid and parasitoid behavior", 《PNAS》 * |
| 喻修道: "EβF合成酶基因的克隆及功能分析", 《中国博士学位论文全文数据库农业科技辑》 * |
| 邢小龙等: "［反］-β-法尼烯(EβF)合成酶基因在玉米中的转化与筛选", 《西南农业学报》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107828807A (en) * | 2017-11-07 | 2018-03-23 | 上海交通大学 | Aphid resistance of plant implementation method based on the promoters of ubiquitin 1 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Bordas et al. | Transfer of the yeast salt tolerance gene HAL1 to Cucumis melo L. cultivars and in vitro evaluation of salt tolerance | |
| WO2018113702A1 (en) | Plant grain trait-related protein, gene, promoter and snps and haplotypes | |
| ES2590177T3 (en) | MON87460 corn plant event and compositions and procedures for its detection | |
| EP2179042B1 (en) | Late blight resistance genes and methods | |
| CN102803291B (en) | There is the plant of the Correlated Yield Characters of enhancing and/or the abiotic stress tolerance of enhancing and prepare its method | |
| Chen et al. | Gene transfer via pollen‐tube pathway for anti‐fusarium wilt in watermelon | |
| CN112029795B (en) | Application of MpICE1 transcription factor in improving plant disease resistance | |
| Ravelonandro et al. | The efficiency of RNA interference for conferring stable resistance to Plum pox virus | |
| CN113913457B (en) | Method for inhibiting or killing carpopodium borer and application thereof | |
| CN115305252A (en) | Receptor kinase gene OsIFBR1 for regulating and controlling rice resistance | |
| CN102002101A (en) | Plant root development related protein ZmNR1 and coding gene thereof | |
| CN112813083B (en) | Application of OsCIPK31 gene and coding protein in regulation and control of rice sheath blight disease resistance | |
| US10920236B2 (en) | Use of micropeptides in order to stimulate mycorrhizal symbiosis | |
| CN104404043B (en) | Promoter of gene Me094 related to bacterial-blight resistance of Oryza meyeriana | |
| CN109929019A (en) | A kind of and plant salt tolerance alkali GAP-associated protein GAP GsERF7 and its encoding gene and application | |
| CN109468334A (en) | A kind of tobacco protein kinase gene NtCIPK25-1 and its cloning process and application | |
| CN107760702A (en) | Aphid resistance of plant implementation method based on 35S promoter | |
| CN114134171B (en) | Method for inhibiting or killing Oriental myxomycetes and application thereof | |
| CN101781654B (en) | Novel cotton fungal disease-resistant gene GhMPK7 and application thereof | |
| CN101883572A (en) | Sorghum aluminum tolerance gene, sbmate | |
| CN101255428B (en) | Plant salt resistance related gene and use thereof in plant breeding | |
| TW201410701A (en) | Novel regulator of iron and/or zinc binding, and methods for improving plant resistance to iron deficiency and promoting plant accumulation of iron and/or zinc in edible parts of plants by regulatory expression of the regulator | |
| CN102952821B (en) | Plant expression vector of alfalfa malic acid channel protein gene MsALMT1, and applications thereof | |
| CN105753955A (en) | Soybean bHLH transcription factor and encoding gene and application thereof | |
| CN105400797B (en) | A kind of recombinant dna fragment containing anti insect gene and its application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20180306 |