CN107805670B - Composition, kit and method for identifying raspberry components by real-time fluorescent PCR (polymerase chain reaction) - Google Patents
Composition, kit and method for identifying raspberry components by real-time fluorescent PCR (polymerase chain reaction) Download PDFInfo
- Publication number
- CN107805670B CN107805670B CN201610809885.9A CN201610809885A CN107805670B CN 107805670 B CN107805670 B CN 107805670B CN 201610809885 A CN201610809885 A CN 201610809885A CN 107805670 B CN107805670 B CN 107805670B
- Authority
- CN
- China
- Prior art keywords
- raspberry
- components
- real
- composition
- kit
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/166—Oligonucleotides used as internal standards, controls or normalisation probes
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Immunology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Botany (AREA)
- Mycology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to a real-time fluorescence PCR method of raspberry components. The invention also relates to oligonucleotide primer probe compositions for use in the methods. The invention also relates to a real-time fluorescent PCR kit containing the composition. The composition of the invention is used for real-time fluorescence PCR detection, and can simply, quickly, specifically and sensitively detect raspberry (containing red raspberry, black raspberry and yellow raspberry) source components in foods such as dried fruits, jam, fruit juice (except clear juice) and the like.
Description
Technical Field
The invention belongs to the technical field of biology, and particularly relates to a Taqman real-time fluorescence PCR method for qualitatively detecting raspberry components, an oligonucleotide primer probe composition for the method, and a kit containing the composition.
Background
Raspberries are Rosaceae (Rosaceae), Rosaceae, Rubus (Rubus spp.), and have the name of: raspberry, mountain flint nut, seedling spreading and soaking and the like. The fruit has various colors, such as red, black, purple, yellow and the like. The raspberry fruit is sour, sweet and delicious, is rich in nutrition, contains 17 amino acids and vitamins necessary for a human body, and gallic acid, beta-sitosterol, raspberry acid and the like, has the effects of preventing aging, improving the immunity of the human body and the like, particularly has the highest content of Ve and SOD (superoxide dismutase), and the natural superoxide dismutase and the vitamin E are excellent human body scavenger, can eliminate a large amount of harmful metabolic substances generated by the human body, improve the immunity of the human body, fundamentally improve the internal environment of the human body, and achieve the purposes of beautifying, maintaining beauty and prolonging life. The raspberry can effectively protect the heart and prevent cardiovascular and cerebrovascular diseases such as hypertension, vessel wall atherosclerosis, cerebrovascular sclerosis rupture and the like after being eaten for a long time. The raspberry has wide application, soft and juicy fruits and pleasant color, and is suitable for being eaten fresh or processed into beverages, fruit juice, jam, sugar water cans and the like. Eating the product can relieve summer heat, promote salivation, quench thirst, remove phlegm, relieve hangover, and refresh mind, and can be used as fruit or medicine.
With the popularization of products such as dried raspberry, jam, fruit juice and the like, the adulteration of raspberries is more and more severe due to rich nutritional value and medicinal value, and some illegal manufacturers adopt a fruit juice adulteration means, such as marking the fruit juice content of raspberries, so that some cheap and even fake fruit juices can fill the market, and the health of consumers is seriously harmed due to the blending of saccharin, sugar, pigment, water and the like. It is necessary to develop a simple and fast authentication technology. The research on the conventional methods mainly focuses on the conventional physicochemical technologies such as microscopic identification, chromatography, and spectroscopy, but is greatly influenced by many factors such as variety, production area, harvest season, raw material environment, processing conditions, storage, transportation, and packaging methods. With the rapid development of molecular biology technology, various molecular biology technologies based on DNA judge species components by detecting species specific gene segments, have the advantages of strong specificity, high sensitivity, difficult interference from environmental conditions, stable results and the like, and are more and more widely applied to the identification of small berries such as raspberries and the like.
Disclosure of Invention
The invention aims to simply, quickly, specifically and sensitively detect raspberry components in food and fruit juice (except clear juice), and effectively prevent the way of adding other cheap fruits into raspberry products such as fruit juice, jam and the like.
The inventor designs a real-time fluorescence PCR detection method which can be universally used for internal reference of fruits and vegetables according to internal reference genes NADH of the fruits and vegetables; with the raspberry chloroplast ndhF gene as a target, primers and probes capable of specifically detecting raspberry components are designed; the target sequence is 160 bp, so that the target plant components can be detected from precipitates such as jam, fruit juice and the like.
In one aspect of the invention, oligonucleotide primer upstream NADH-F which is universally used for internal reference of fruit and vegetable components is provided: 5'-GCTGAAGCAGCTACTTTCGAAGTAACA-3' (SEQ ID No. 1), and downstream NADH-R: 5'-AGGAGCCGTGTGAGATGAAAGTCTCA-3' (SEQ ID No. 2). The probe is NADH-P: 5'-TGGAGTGGGAGAGTCAGAGTCGAAAAGAGG-3' (SEQ ID No. 3), a fluorescence quenching group TAMRA is connected to the 3 'end of the probe, and a fluorescence reporter group FAM is connected to the 5' end. The primer can specifically identify the NADH sequence of the fruit and vegetable components, and the length of the amplified fragment is 138 bp. The specific amplification reaction conditions are as follows: 2 min at 50 ℃; pre-denaturation at 95 ℃ for 10 min; 95 ℃ for 15s, 60 ℃ for 1min, 40 cycles.
In one aspect of the invention, specific oligonucleotide primers for specifically detecting Raspberry components are provided, wherein the upstream Raspberry-F: 5'-GTTATTCGTTGGAACCGTAGGAA-3' (SEQ ID No. 4) and the downstream Raspberry-R: 5'-GACTGAAAAAACTGCATTTGTGA-3' (SEQ ID No. 5). The probe is Raspberry-P: 5'-ATTATCCAAATTGTTAACCCCGTCCATAAACCT-3' (SEQ ID No. 6), the 3 'end of the probe is connected with a fluorescence quenching group TAMRA, and the 5' end of the probe is connected with a fluorescence reporter group FAM. The primer can specifically recognize the ndhF sequence of the raspberry, and the length of the amplified fragment is 160 bp. The specific amplification reaction conditions are as follows: 2 min at 50 ℃; pre-denaturation at 95 ℃ for 10 min; 95 ℃ for 15s, 60 ℃ for 1min, 40 cycles.
In another aspect of the invention, there is provided a composition comprising the above-described oligonucleotide sequence. The composition comprises one or more sets of primer and probe sequences selected from any one of the following (1) to (2):
(1) the oligonucleotide primer pair of the reference gene in the fruit and vegetable is SEQ ID No. 1-SEQ ID No.2 and the sequence of the probe SEQ ID No. 3;
(2) raspberry-specific oligonucleotide primer pair SEQ ID No.4 and SEQ ID No.5 and probe SEQ ID No.6 sequence.
In one embodiment, the real-time fluorescent PCR amplification conditions of the fruit and vegetable reference genes and the raspberries are 95 ℃ and 10 min; the real-time fluorescent PCR method used in the invention is preferably Taqman fluorescent probe method, with the temperature of 95 ℃ for 15s, the temperature of 60 ℃ for 1min and 40 cycles.
In the present invention, the raspberries comprise 4 populations of raspberries including red raspberries, black raspberries, yellow raspberries and purple raspberries.
In another aspect of the invention, the invention provides a universal detection kit for fruit and vegetable components and a real-time fluorescence PCR (polymerase chain reaction) specific detection kit for raspberry components, wherein the kit comprises the oligonucleotide sequence or the composition.
The kit provided by the invention comprises the specific primers for real-time fluorescence PCR detection of fruit and vegetable components and raspberry components and an instruction.
In one embodiment, the raspberry specific primers of the invention are designed based on chloroplast gene matk sequences, respectively. In one embodiment, the kit comprises a raspberry (red raspberry for example) specific amplification target sequence of GTTATTCGTTGGAACCGTAGGAATTCCTTTCTTCAATCAGGAAGGAATAGATTTAGATATATTATCCAAATTGTTAACCCCGTCCATAAACCTTTTACATCAAAATCGAACCCACCCTGTCGATTGGTATGAATTTATCACAAATGCAGTTTTTTCAGTC (SEQ No.7), and in a preferred embodiment, the instructions for use of the kit include descriptions of raspberry specific primers and amplification conditions for detection of raspberry by real-time fluorescent PCR. In a specific embodiment, the kit for detecting raspberry components of the present invention further comprises a control substance. Preferably, the control comprises a positive control and a negative control. In one embodiment, the negative control is sterile double distilled water.
In one embodiment, the absolute sensitivity of the real-time fluorescence PCR detection method for detecting raspberry components is as follows: the minimum content of red raspberry and black raspberry is 0.001ng/μ L, and the minimum content of yellow raspberry is 0.0001ng/μ L.
In one embodiment, the lowest detection limit of the real-time fluorescent PCR detection method is 1% by volume of the red raspberry component, 0.1% by volume of the black raspberry and yellow raspberry components.
In yet another aspect, the invention provides the use of said composition or said kit for identifying raspberry components in raspberry products such as fruit juices (excluding clear juices), jams and the like.
Real-time fluorescence quantitative PCR is that on the basis of a conventional PCR method, a probe or a fluorescent dye which is fluorescently labeled is added, a fluorescent signal emitted by the probe or the dye is enhanced along with the accumulation of a PCR product, a fluorescence monitoring system can receive the fluorescent signal, namely, a fluorescent molecule is formed when each DNA chain is generated, the amplified target gene segment grows exponentially along with the increase of cycle number in the whole PCR reaction process, and the Ct (cycle threshold) value is obtained by detecting the intensity of the fluorescent signal which changes along with the amplification and corresponds to the amplified target gene segment in real time. The Ct value, namely the number of amplification cycles which pass when the fluorescence signal of the amplification product reaches a set threshold value in the PCR amplification process, has a linear relation with the logarithm of the initial copy number of the template, the more the DNA amount of the template is, the less the number of cycles when the fluorescence reaches the threshold value is, namely the smaller the Ct value is, thereby realizing the quantitative and qualitative analysis of the initial template and further detecting the component to be detected.
The real-time fluorescence PCR detection method for identifying the template through the specific hybridization of the primer or the probe and the template has high specificity and low false positive; can adopt complete closed tube detection, does not need PCR post-treatment, avoids cross contamination and false positive, and shortens the reaction time. The fluorescence after PCR amplification is detected, the reaction signal is amplified, and the sensitivity is greatly improved. The method skillfully utilizes the high-efficiency DNA amplification of the PCR technology, the specificity of nucleic acid hybridization and the rapidness and the sensitivity of the fluorescence detection technology, and has the advantages of simple operation, time and labor saving, reliable result, accuracy and sensitivity and the like. The real-time fluorescence PCR detection method has the characteristics of simplicity, rapidness, specificity and sensitivity, and is suitable for qualitative detection of raspberry components in fruit juice (except clear juice), jam and other products in domestic and foreign markets.
Drawings
FIG. 1 is a typical amplification curve of fruits and vegetables when the probe universality of the reference primer in the fruits and vegetables is detected by real-time fluorescence PCR. 1-40 of berries and common fruits and vegetables are respectively: raspberries (northern, brilliant, blue-gold, beloxx), yellow raspberries, red raspberries (victory), black raspberries, cranberries, red bilberries, bingchuan summer black grapes, blackcurrants, cape gooseberries, pomegranates, mock raspberries, strawberries, hawthorns, kiwis, mulberries, cherries, waxberries, carambola, apples, pears, flat peaches, pecans, oranges, apricots, watermelons, papayas, cucumbers, loquats, pineapples, litchis, longans, bananas, tomatoes, wolfberries, mangoes, olives; negative controls 41-48 were: pine, metasequoia, agaric, mushroom, chlorella, colibacillus, yeast and blank.
FIG. 2 is the probe-specific detection results using raspberry primers. In the figure, 1 is red raspberry (victory), 2 is yellow raspberry, 3 is black raspberry, 4-36 are blueberry, cranberry, Indian strawberry, mulberry, kiwi fruit, strawberry, blackcurrant, Binchuan summer black grape, cherry, waxberry, carambola, apple, pear, flat peach, jujube, orange, apricot, watermelon, papaya, mango, cucumber, loquat, pineapple, lychee, longan, tomato, medlar, olive, gingko, banana and blank control in sequence.
FIG. 3 shows probe coverage measurements using raspberry primers. The method covers three populations of red raspberries, black raspberries and yellow raspberries, and comprises 10 varieties, wherein 1 is red raspberries (Australian red, American No. 22, Nova, Mike, early red, Shengli, unknown), 2 is yellow raspberries, and 3 is black raspberries (2 varieties).
FIG. 4 shows the absolute sensitivity of the detection using the raspberry primer probe. A. B respectively represents a typical amplification curve and a standard curve obtained by amplifying the red raspberry/rose grape mixed juice, C, D respectively represents a typical amplification curve and a standard curve obtained by amplifying the black raspberry/summer black grape mixed juice, and E, F respectively represents a typical amplification curve and a standard curve obtained by amplifying the yellow raspberry/watermelon mixed juice. 1-7 represent raspberry DNA concentrations of 100 ng/. mu.L, 10 ng/. mu.L, 1 ng/. mu.L, 0.1 ng/. mu.L, 0.01 ng/. mu.L, 0.001 ng/. mu.L, 0.0001 ng/. mu.L, 3 replicates per dilution, respectively.
FIG. 5 shows the relative sensitivity of the detection using raspberry primer probes. A is a typical amplification curve obtained by amplifying raspberry components of red raspberry/rose grape mixed juice, B is a typical amplification curve obtained by amplifying raspberry components of black raspberry/summer black grape mixed juice, and C is a typical amplification curve obtained by amplifying raspberry components of yellow raspberry/watermelon mixed juice, wherein 1-5 respectively represent juice samples mixed in a volume ratio of 0.1%, 1%, 10%, 50% and 100%.
FIG. 6 shows the results of the low stability test of mock samples processed by amplification with raspberry primer probes. A is a typical amplification curve obtained by amplifying raspberry components of 1% raspberry/rose grape mixed juice, B is a typical amplification curve obtained by amplifying raspberry components of 0.1% black raspberry/summer black grape mixed juice, C is a typical amplification curve obtained by amplifying raspberry components of 0.1% yellow raspberry/watermelon mixed juice, and P1, P2 and P3 respectively represent fresh raspberry, black raspberry and yellow raspberry DNA. 1-3 represent fresh, pasteurized, autoclaved blended juice samples, respectively.
Detailed Description
The present invention will be further described by way of examples, but the present invention is not limited to only the following examples.
Example 1
While particular embodiments of the present invention have been described, those skilled in the art will recognize that many changes and modifications may be made thereto without departing from the scope or spirit of the invention. Accordingly, it is intended to embrace all such changes and modifications that fall within the scope of the appended claims and equivalents thereof.
Claims (6)
1. A composition for detecting raspberry components by real-time fluorescent PCR, the composition comprising a raspberry specific oligonucleotide primer pair 5 'GTTATTCGTTGGAACCGTAGGAA 3' and 5 'GACTGAAAAAACTGCATTTGTGA 3', and a probe 5 'ATTATCCAAATTGTTAACCCCGTCCATAAACCT 3', wherein a fluorescence quencher group TAMRA is connected to the 3 'end of the probe, and a fluorescence reporter group FAM is connected to the 5' end.
2. A method of real-time fluorescent PCR detection of raspberry components, said method comprising using the composition of claim 1.
3. A kit for identifying raspberry components using a real-time fluorescent PCR assay method, the kit comprising the composition of claim 1.
4. Use of the composition of claim 1 in the detection of berry product raspberry components.
5. Use of the method of claim 2 in the detection of raspberry components from a berry product.
6. Use of the kit of claim 3 for the detection of berry product raspberry components.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610809885.9A CN107805670B (en) | 2016-09-07 | 2016-09-07 | Composition, kit and method for identifying raspberry components by real-time fluorescent PCR (polymerase chain reaction) |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610809885.9A CN107805670B (en) | 2016-09-07 | 2016-09-07 | Composition, kit and method for identifying raspberry components by real-time fluorescent PCR (polymerase chain reaction) |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN107805670A CN107805670A (en) | 2018-03-16 |
| CN107805670B true CN107805670B (en) | 2021-08-20 |
Family
ID=61576025
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610809885.9A Active CN107805670B (en) | 2016-09-07 | 2016-09-07 | Composition, kit and method for identifying raspberry components by real-time fluorescent PCR (polymerase chain reaction) |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107805670B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111593134B (en) * | 2019-02-21 | 2022-08-26 | 中国检验检疫科学研究院 | Method, composition and kit for identifying four bee pollen by multiple fluorescence PCR |
| CN110408683B (en) * | 2019-08-16 | 2022-09-09 | 河北农业大学 | Specific DNA segment and primer for cherry species identification |
| CN110734998B (en) * | 2019-11-04 | 2022-04-12 | 中国检验检疫科学研究院 | Primers, method and kit for identifying NFC orange juice and FC orange juice |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106811513B (en) * | 2015-12-01 | 2020-12-01 | 中华人民共和国上海出入境检验检疫局 | Eucalyptus component real-time fluorescence PCR detection method and kit thereof |
-
2016
- 2016-09-07 CN CN201610809885.9A patent/CN107805670B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN107805670A (en) | 2018-03-16 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Moreno et al. | The use of RAPD markers for identification of cultivated grapevine (Vitis vinifera L.) | |
| Ubeda et al. | Employment of different processes for the production of strawberry vinegars: Effects on antioxidant activity, total phenols and monomeric anthocyanins | |
| CN107805670B (en) | Composition, kit and method for identifying raspberry components by real-time fluorescent PCR (polymerase chain reaction) | |
| Yan et al. | UV-C treatment enhances organic acids and GABA accumulation in tomato fruits during storage | |
| Muccillo et al. | Biochemical features of native red wines and genetic diversity of the corresponding grape varieties from Campania region | |
| Fattahi et al. | Assessment of fruit quality and antioxidant activity of three citrus species during ripening | |
| Zhou et al. | Application of omics in food color | |
| Kruczek et al. | Comparison of morphological, antidiabetic and antioxidant properties of goji fruits | |
| US20080124731A1 (en) | Natural Food Tracer | |
| Yang et al. | Identification of small berry species in food and juice using TaqMan-based real-time PCR | |
| Lee et al. | Effect of early seed removal during fermentation on proanthocyanidin extraction in red wine: A commercial production example | |
| Grabek-Lejko et al. | Comparison of antibacterial and antioxidant properties of fruits and leaves of blackberry (Rubus plicatus) and raspberry (Rubus idaeus) | |
| CN107805669B (en) | Composition, kit and method for identifying cranberry components through real-time fluorescence PCR | |
| Hârţa et al. | DNA fingerprinting used for testing some Romanian wine varieties | |
| CN107805671B (en) | Composition, kit and method for identifying blueberry components through real-time fluorescence PCR | |
| Oprica et al. | Differential content of the total polyphenols and flavonoids in three Romanian white grape cultivars | |
| Espiñeira et al. | The use of molecular biology techniques in food traceability | |
| CN113215269B (en) | Detection kit for visual detection of potato rot stem nematodes and application thereof | |
| KR20160071238A (en) | A method for identifying chrysanthemum varieties using microsatellites markers | |
| CN106676164B (en) | Method for detecting pineapple components in sample to be detected | |
| Rizwanullah et al. | Introduction to food authentication based on fingerprinting techniques | |
| Shrestha et al. | Impact of fermentation conditions on the extraction of phenolics and sensory characteristics of Mangosteen wine | |
| Khademi et al. | Comparison of expression levels of some genes involved in anthocyanin biosynthetic pathway in three pomegranate cultivars with different colors | |
| CN102367485A (en) | Primer for carrying out PCR (Polymerase Chain Reaction) detection on reference gene of plant disease and application of primer | |
| CN105567844A (en) | Primer pair and method for identifying hericium erinaceus houjie No.2 or large hericium erinaceus |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |