Disclosure of Invention
The inventors of the present invention have made intensive studies to solve the above-mentioned technical problems, and as a result, found that: by optimizing the construction method of a large-fragment DNA library, a library with a cleavage site (a quality control site for quality control of the library) or a library intermediate product (such as a DNA fragment for sequencing) can be obtained, thereby completing the present invention.
That is, the present invention based on the above knowledge includes:
1. a method for constructing a large DNA fragment library comprises the following steps:
and B: adding joints at two ends of the treated DNA large fragment to obtain the DNA large fragment added with the joints, wherein the joints are provided with biotin labels;
step C: circularizing the adaptor-added large DNA fragment obtained in the step B to obtain a circularized large DNA fragment with a first cleavage site,
wherein the linker is a linker having a cohesive end, or a linker having a second cleavage site,
the linker having cohesive ends is composed of a long chain phosphorylated at the 5 'end and a short chain unphosphorylated at the 5' end,
the linker having a second cleavage site has at least one second cleavage site on at least one strand,
the base sequence of the circularized DNA large fragment excluding the DNA large fragment is a junction region including at least one first cleavage site.
2. The method for constructing a large DNA fragment library according to item 1, wherein when the adaptor is an adaptor having a sticky end, the ligation region comprises a sticky end pairing region formed by complementary pairing of bases of the sticky end, and the DNA sequence of the sticky end pairing region comprises at least one first cleavage site.
3. The method for constructing a large DNA fragment library according to item 1 or 2, wherein when the linker is a linker having a second cleavage site, the first cleavage site is at least one second cleavage site.
4. The method for constructing a DNA large fragment library according to any one of items 1 to 3, wherein when the linker is a linker having a second cleavage site, the step B: the method comprises a step B-1 and a step B-2, and specifically comprises the following steps:
step B-1: adding joints with second cutting sites at two ends of the processed DNA large fragment to obtain the DNA large fragment with the second cutting sites at two ends;
step B-2: treating the large DNA fragment with second cutting sites at two ends by using a cutting reagent to obtain a large DNA fragment with a joint, wherein two ends of the large DNA fragment with the joint are sticky ends;
and C: and (2) circularizing the adaptor-added DNA large fragment to obtain a circularized DNA large fragment with a first cutting site, wherein the connecting region comprises a cohesive end pairing region formed by complementary pairing of the bases of the cohesive end, and the DNA sequence of the cohesive end pairing region comprises at least one first cutting site.
5. The method for constructing a large DNA fragment library according to any one of claims 1 to 4, which comprises the step A performed before the step B: and (3) carrying out end repair on the DNA large fragment, or carrying out end repair and adding A base to obtain the treated DNA large fragment.
6. The method for constructing a large DNA fragment library according to any one of claims 1 to 5, further comprising: step A-0 performed before step A: the DNA fragment which is desired to be sequenced is broken to obtain a large DNA fragment.
7. The method for constructing a large DNA fragment library according to any one of claims 1 to 6, further comprising the following step performed after step C:
step D: linearly digesting the circularized DNA large fragment to obtain a digested circularized DNA large fragment;
step E: breaking the digested large fragment of the circularized DNA to obtain a mixture of a common short DNA fragment and a DNA fragment for sequencing, wherein the DNA fragment for sequencing is provided with a biotin label;
step F: and (3) carrying out fragment capture on the DNA fragment for sequencing, and fishing the DNA fragment for sequencing by adopting a streptavidin solid phase carrier, wherein the DNA fragment for sequencing comprises at least one first cutting site.
Step G: and carrying out PCR amplification on the DNA fragment for sequencing to obtain an amplification product, thereby constructing a DNA large fragment library.
8. The method for constructing a large DNA fragment library according to any one of claims 1 to 7, wherein the step G is a step H to a step J,
step H: carrying out end repair on the DNA fragment for sequencing to obtain a blunt-end DNA fragment;
step I: g, adding a sequencing joint to the blunt-end DNA fragment obtained in the step G to obtain a DNA fragment with the sequencing joint; and
step J: and carrying out PCR amplification on the adaptor-added DNA fragment to obtain an amplification product, thereby constructing a DNA large fragment library.
9. The method for constructing a large DNA fragment library according to item 7 or 8, wherein the amplification product has a first cleavage site.
10. The method for constructing a large DNA fragment library according to any one of claims 1 to 9, wherein said first and/or second cleavage site is a nucleotide sequence of 1 to 20bp, preferably an enzyme cleavage site and/or a nuclease action site, more preferably at least one deoxyuridine.
11. A quality detection method of a DNA large fragment library,
taking the DNA fragment for sequencing or the amplification product obtained by the method for constructing the large DNA fragment library according to any one of items 1 to 10 as a sample to be tested, wherein the sample to be tested comprises a first cleavage site, and performing the following steps:
step K: carrying out agarose gel electrophoresis on a sample to be detected to obtain an electrophoresis strip of the sample to be detected;
step L: cutting a sample to be detected to obtain a quality inspection sample;
step M: carrying out agarose gel electrophoresis on the quality detection sample to obtain a quality detection sample electrophoresis strip;
and step N: and when the position average value of the electrophoresis strip of the quality detection sample is moved to a position which is half +/-10% of the position average value of the electrophoresis strip of the sample to be detected, the sample to be detected is judged to be a qualified library.
12. The method of quality detection according to item 11, wherein the cutting treatment is performed by one or more methods selected from the group consisting of: biological enzyme cleavage, mechanical cleavage and chemical cleavage.
13. A large DNA fragment library constructed by the method for constructing a large DNA fragment library according to any one of claims 1 to 10.
14. The method for constructing a large DNA fragment library according to any one of claims 1 to 13, wherein the size of the large DNA fragment is 1.5k to 30kbp, preferably 2k to 10kbp, and more preferably 3k to 5kbp.
15. A method for sequencing a large DNA fragment library, comprising sequencing the large DNA fragment library of item 13.
16. The sequencing method of claim 15, wherein said sequencing is paired-end sequencing.
17. A kit for constructing a DNA large fragment library, for use in the method for constructing a DNA large fragment library according to any one of items 1 to 10, comprising a linker which is a linker having a sticky end consisting of a long chain phosphorylated at the 5 'end and a short chain unphosphorylated at the 5' end; alternatively, a linker having a second cleavage site, said linker having a second cleavage site with at least one second cleavage site on at least one strand.
18. The kit according to item 17, further comprising a cleavage reagent, said cleavage reagent being a reagent cleaving the first cleavage site and/or a reagent cleaving the second cleavage site, preferably an endonuclease and/or a reagent having a deoxyuridine-removing function.
19. The kit according to any one of claims 17 to 18, further comprising at least one or two or more selected from the group consisting of: reagents for end repair, reagents for linker addition, reagents for circularization of DNA fragments, reagents for linear digestion, reagents for biotin fishing, reagents for amplification of DNA fragments.
20. The kit according to any one of claims 17 to 19, further comprising at least one or more selected from the group consisting of: reagents for DNA disruption, reagents for nucleotide addition, reagents for DNA fragment extension, reagents for nucleic acid purification, reagents for nucleic acid extraction, reagents for protein digestion, reagents for RNA digestion, reagents for DNA digestion.
Compared with the prior art, the invention has the beneficial effects that: the quality control point of the library or the library intermediate product obtained by the library construction method can be cut by adopting a proper cutting method, so that the quality of the large fragment library can be evaluated from the agarose gel electrophoresis image results of fragments before and after cutting, and whether the library is suitable for sequencing or not can be further evaluated. Therefore, libraries with low quality are early warned in advance, and waste of time cost, personnel cost and instrument cost caused by high-throughput sequencing of the libraries of unqualified libraries is avoided.
Detailed Description
Technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art, and in case of conflict, the definitions in this specification shall control.
First, in one aspect, the present invention provides a method for constructing a DNA large fragment library (library construction method of the present invention), comprising:
and B: adding joints at two ends of the treated DNA large fragment to obtain the DNA large fragment with the joints, wherein the joints are labeled by biotin;
step C: circularizing the adaptor-added DNA large fragment obtained in the step B to obtain a circularized DNA large fragment with a first cutting site, wherein the circularized DNA large fragment is marked with biotin
Wherein the linker is a linker having a cohesive end, or a linker having a second cleavage site,
the linker having cohesive ends is composed of a long chain phosphorylated at the 5 'end and a short chain unphosphorylated at the 5' end,
the linker having a second cleavage site has at least one second cleavage site on at least one strand,
the base sequence of the circularized DNA large fragment excluding the DNA large fragment is a junction region including at least one first cleavage site.
The traditional method for constructing the large DNA fragment library cannot generate DNA fragments which can evaluate the construction quality of the library before sequencing. The library construction method of the invention is different from the traditional method in that: introducing the result product of the circularization step (circularized DNA large fragment) into at least one first cleavage site, which can be retained to the DNA fragment for sequencing or the large fragment library obtained after amplification of the DNA fragment for sequencing during the large fragment library construction process. The method comprises the steps of processing a DNA fragment for sequencing containing a first cutting site or a large fragment library obtained by amplifying the DNA fragment for sequencing by a cutting method known by a person skilled in the art, and performing agarose gel electrophoresis on samples before and after processing respectively, so as to judge whether the sample before processing is suitable for further constructing the library or sequencing according to the electrophoresis pattern conditions of the samples before and after processing.
In the step B, the method of adding the linker to both ends of the DNA large fragment is not particularly limited, and may be performed by any method known to those skilled in the art, for example, by using DNA ligase having a blunt end ligation function (e.g., T4DNA ligase, T3DNA ligase).
In the present specification, the linker will typically contain a biotin label. Methods for obtaining DNA fragments (e.g., linkers) bearing a biotin label are known to those skilled in the art and can be performed, for example, by using dNTPs containing biotin and Klenow enzyme as appropriate.
In said step C, there is no particular limitation on the method for circularizing the adaptor-ligated DNA large fragment, and it can be achieved by any method known to those skilled in the art, for example, by using a DNA ligase having a circularization function (e.g., T4DNA ligase).
It should be noted that, in the following description,
in the present specification, the linker having a cohesive end refers to a linker having two strands, one long strand and one short strand, and is composed of a long strand phosphorylated at the 5 'end and a short strand non-phosphorylated at the 5' end. Any known linker having a cohesive end may be used by those skilled in the art, and may be prepared from commercially available products by methods known to those skilled in the art, or may be used as such. The large DNA fragment having a cohesive end and having a ligation ability can be obtained by phosphorylating the 3 'end of the large DNA fragment having a cohesive end linker using DNA3' end phosphorylase.
In the present specification, "first cleavage site" and "second cleavage site" refer to a nucleotide sequence that can be designed to allow sequence selective cleavage of both strands, for example, a recognition site for a restriction enzyme. Sites which allow sequence-selective cleavage of only one strand may also be designed as appropriate. The "nucleotide" refers to a deoxyribonucleotide, but may be a ribonucleotide when appropriate. The length and exact sequence of the first and second cleavage sites are not particularly limited and may be any desired sequence, e.g., designed to be cleaved by an arbitrarily selected enzyme. Preferred first cleavage site and/or second cleavage site are cleavage sites and/or nuclease action sites, more preferably at least one Deoxyuridine (uracil deoxyribonucleotide, deoxyuridine for short dU).
In the present specification, the joining region is a base sequence excluding the DNA large fragment in the circularized DNA large fragment, and is obtained by subjecting the treated DNA large fragment to a circularization reaction, and includes at least one first cleavage site. The processing method of the processed DNA large fragment can be, for example, end repair or adding a linker, and the base sequence of the junction region can be derived from the processed DNA large fragment, for example, a base added by end repair, or a whole or partial linker sequence.
In the present specification, a linker having a second cleavage site refers to a linker having the above-mentioned second cleavage site, which has at least one second cleavage site on at least one strand. Preferably, the second cleavage site is a sticky end generation site. The site for generating a cohesive end can be obtained, for example, by disrupting a specific nucleotide and separating a DNA having a length of 1 to 20bp from the end at the 3' end of the disrupted nucleotide from the double strand at a high temperature; or by cleaving the end of one strand of a double-stranded DNA with a cleaving agent. Preferably the cohesive end generating site is a nucleotide sequence of 1-20bp, more preferably an enzyme cleavage site and/or a nuclease action site, more preferably at least one deoxyuridine. The DNA cleavage, nucleotide removal reaction or end modification to generate cohesive ends may be, for example, removal of dU using UDG enzyme, or 3 'phosphorylation of a linker containing cohesive ends but not phosphorylated at the 3' end of the short chain.
Preferably, when the linker is a linker having cohesive ends, the resulting ligated DNA large fragment is a DNA large fragment having cohesive ends, and the DNA large fragment having cohesive ends is circularized by complementary pairing of bases of the cohesive ends at both ends thereof to form a circularized DNA large fragment. The region where the base of the cohesive end forms through complementary pairing is a cohesive end pairing region which is a part of the joining region, and the first cleavage site is in the cohesive end pairing region at this time.
Preferably, when the linker is a linker having a second cleavage site, the source of the first cleavage site contained in the cyclized DNA large fragment in step C may be the second cleavage site in the linker having the second cleavage site, or the first cleavage site formed by base complementary pairing during the cyclization of the cohesive end generated after the DNA large fragment having the second cleavage site is treated with the cleavage reagent. The number of the first cleavage site or the second cleavage site is not particularly limited and may be one or more, preferably one, and those skilled in the art can prepare the desired number by a known method according to the quality evaluation of the library.
Preferably, when the linker is a linker having a second cleavage site, step B: comprises a step B-1 and a step B-2. Specifically, step B-1: adding joints with second cutting sites at two ends of the processed DNA large fragment to obtain the DNA large fragment with the second cutting sites at two ends; step B-2: and (3) treating the large DNA fragment with the second cutting sites at two ends by using a cutting reagent to obtain a large DNA fragment with a joint, wherein two ends of the large DNA fragment with the joint are sticky ends. And C: and (2) circularizing the adaptor-added DNA large fragment to obtain a circularized DNA large fragment with a first cutting site, wherein the connecting region comprises a cohesive end pairing region formed by complementary pairing of the bases of the cohesive end, and the DNA sequence of the cohesive end pairing region comprises at least one first cutting site.
In the present specification, the DNA large fragment having a cohesive end in step B-2 is obtained by treating the DNA large fragment having the second cleavage site at both ends with a cleavage reagent, and the skilled person can select an appropriate reagent according to the second cleavage site. Preferably, in the library construction method of the present invention, the second cleavage site is an enzyme cleavage site, for example, apal has an enzyme cleavage site of 6bp nucleotide sequence 5'GGGCC ^ C3'.
Preferably, in the library construction method of the present invention, the second cleavage site is at least one deoxyuridine. The amount of deoxyuridine used in the present invention is not particularly limited, and may be an appropriate amount suitable for the formation of sticky ends. The suitable distance of deoxyuridine from the 3 '-end is not particularly limited either, and may be a length such that the short single-stranded fragment remaining from the gap to the 3' -end after removal of deoxyuridine is easily released, and is preferably 1 to 20bp.
The present specification also provides preferred embodiments of the library construction methods of the invention. The library construction method of the present invention further comprises performing step a before step B: and (3) performing end repair on the DNA large fragment, or performing end repair and adding A base to obtain the processed DNA large fragment.
In the present specification, the end repair of a large DNA fragment can be carried out by any method known to those skilled in the art, and for example, can be carried out by using a DNA polymerase having the above-described functions (e.g., T4DNA polymerase). The addition of A bases can be accomplished by any method known to those skilled in the art, for example, by using a DNA polymerase having the function of adding A bases (e.g., klenow fragment lacking 3 'to 5' exonuclease activity).
The present specification further provides preferred embodiments of the library construction methods of the invention. The library construction method of the present invention further comprises, before step a, performing step a-0: the DNA fragment which is desired to be sequenced is broken to obtain a large DNA fragment.
In the present specification, the breaking manner of the DNA fragment is known to those skilled in the art, and the DNA fragment desired to be sequenced can be broken by using ultrasonic breaking method, transposase method, hydraulic shearing method, for example, to obtain the large DNA fragment. The size of the "DNA large fragment" in the present specification is not particularly limited, and may be about 1k to 100kbp, preferably about 1.5k to 30kbp, more preferably about 2k to 20kbp, and even more preferably about 5k to 10kbp, in view of the need for constructing the De Novo sequencing library or any other requirement that requires a large fragment library.
The present specification further provides preferred embodiments of the library construction methods of the invention. The library construction method of the present invention further comprises the following steps performed after step C:
step D: and linearly digesting the circularized DNA large fragment to obtain the digested circularized DNA large fragment.
Step E: breaking the digested large circularized DNA fragment to obtain a mixture of a common short DNA fragment and a sequencing DNA fragment, wherein the sequencing DNA fragment is marked with biotin;
step F: and (3) carrying out fragment capture on the DNA fragment for sequencing, and fishing the DNA fragment for sequencing by adopting a streptavidin solid phase carrier, wherein the DNA fragment for sequencing comprises at least one first cutting site.
Step G: and carrying out PCR amplification on the DNA fragment for sequencing to obtain an amplification product, thereby constructing a DNA large fragment library.
In said step D, linear digestion of the circularized DNA large fragment can be achieved by any linear digestion method known to the person skilled in the art. For example, plasmid safe ATP-Dependent DNase linear DNA digestion system.
In the step E, the DNA fragment is broken in a manner known to those skilled in the art, and the circularized DNA large fragment is broken to obtain a DNA fragment for sequencing. The "DNA fragment for sequencing" in the present invention is not particularly limited, but is preferably a DNA fragment of about 10 to 1000bp, more preferably about 20 to 800bp, still more preferably about 30 to 750bp, still more preferably about 40 to 700bp, yet more preferably about 50 to 650bp, still more preferably about 100 to 600bp, yet more preferably about 150 to 550bp, and still more preferably about 300 to 400bp, from the viewpoint of the acceptability of a sequencer.
In step F, the DNA fragments for sequencing are captured by capturing the DNA fragments for sequencing labeled with biotin, usually using a streptavidin solid support. The streptavidin-coated solid support can be, for example, streptavidin-coated magnetic beads. The DNA fragment for sequencing comprises at least one first cutting site, and the DNA fragment for sequencing with the first cutting site can be used for evaluating the quality of the DNA large fragment library. And (F) constructing a DNA library for sequencing from the DNA fragment for sequencing with the biotin label obtained in the step F, wherein the DNA library for sequencing can be constructed by a DNA fragment library construction method such as a standard Illumina DNA fragment library construction method, a PCR free method, a one-step method, and the like. Various methods for constructing DNA libraries for sequencing are known to those skilled in the art and can be performed by those skilled in the art following routine procedures. For example, standard Illumina DNA fragment library construction methods typically include the steps of end repair, end-to-end a, adapter ligation, amplification, purification of amplification products, etc., and can be performed according to the methods recommended by Illumina corporation.
In said step G, PCR (polymerase chain reaction) amplification is well known to the person skilled in the art, which is generally achieved by a certain PCR reaction procedure (temperature cycling). The PCR reaction procedure generally includes the steps of denaturation, annealing, extension, and the like. There is no particular limitation on the amplification method as long as an amplification product can be obtained in a sufficient amount (e.g., 1ng to 1000. Mu.g) for constructing a DNA library for sequencing. The specific conditions for the amplification method can be appropriately selected as needed by those skilled in the art.
Preferably, step G in the library construction method of the present invention is a step H to a step J,
step H: carrying out end repair on the DNA fragment for sequencing to obtain a blunt-end DNA fragment;
step I: adding a joint to the blunt-end DNA fragment obtained in the step G to obtain a joint-added DNA fragment; and
step J: and carrying out PCR amplification on the joint DNA fragment to obtain an amplification product, thereby constructing a DNA large fragment library.
Preferably, the amplification product obtained in step G or step J has a first cleavage site. Amplification products with a first cleavage site can be used to assess the quality of large DNA fragment libraries.
The above steps H, I and J can be performed by a conventional method in the art.
Preferably, steps for purification of DNA fragments may be added between the various steps of the library construction method of the invention, such as between step A and step B, between step B and step C (including between step B-1 and step B-2, between step B-2 and step C), between step C and step D, between step D and step E, between step E and step F, between step F and step G, between step F and step H, between step H and step I, between step I and step J, and/or after step J. This purification step can be carried out by methods conventional in the art, for example by using purified magnetic beads.
In another aspect, the present invention provides a method for detecting the quality of a DNA large fragment library (the quality detection method of the present invention), in which a sequencing DNA fragment or an amplification product obtained by, for example, the library construction method of the present invention is used as a sample to be tested, the sample to be tested including a first cleavage site, and the following steps are performed:
step K: carrying out agarose gel electrophoresis on a sample to be detected to obtain an electrophoresis strip of the sample to be detected;
step L: cutting a sample to be detected to obtain a quality inspection sample;
step M: carrying out agarose gel electrophoresis on the quality detection sample to obtain a quality detection sample electrophoresis strip; and step N: and when the average value of the positions of the electrophoresis strips of the quality detection sample is moved to a half +/-10% position of the average value of the electrophoresis strips of the sample to be detected, judging the sample to be detected as a qualified library.
In the step K and step M, the conditions of agarose gel electrophoresis are not particularly limited, and the conditions of the agarose gel electrophoresis are generally used, for example, agarose gel with a concentration of 0.5-2% for quality inspection, TAE and TBE buffer, a voltage of 20V/cm or less, a temperature of 30 ℃ or less, and the like.
And in the step L, cutting the sample to be detected. Any suitable method of cleavage treatment, such as enzymatic, chemical or optical, may be used for cleavage. Suitable methods for cleavage treatment include, for example, restriction enzyme digestion (e.g., digestion by restriction enzyme Hind III), in which case the first cleavage site is a restriction site for an enzyme suitable for directing cleavage of one or both strands of the double-stranded DNA fragment (e.g., A ^ AGCTT).
In one aspect, the invention provides a large fragment DNA library (a library of the invention) that can be constructed, for example, using the library construction methods of the invention.
In addition, in one aspect, the present invention provides a method for sequencing a large DNA fragment library (the sequencing method of the present invention), which is performed by sequencing with the library of the present invention as an object. The sequencing method of the present invention can be carried out by a method conventional in the art. Preferably, the sequencing method of the invention may employ double-ended sequencing, for example double-ended sequencing using the Illumina platform (e.g. HiSeq2500 or NextSeq 500). However, in the case where the DNA fragment to be sequenced can be sequenced by one-time sequencing, the sequencing may be single-ended sequencing.
The library construction method of the present invention can be carried out using, for example, a kit, and therefore, in another aspect, the present invention provides a kit for constructing a large fragment library of DNA (the kit of the present invention), which can be used for carrying out the library construction method of the present invention, comprising a linker having a cohesive end, or a linker having a second cleavage site. The linker with cohesive ends consists of a long chain phosphorylated at the 5 'end and a short chain unphosphorylated at the 5' end, and the linker with the second cleavage site has at least one second cleavage site on at least one of the chains.
The cleavage agent is an agent that cleaves the first cleavage site and/or an agent that cleaves the second cleavage site.
Preferably, the linker having a cohesive end is a DNA fragment produced by a isocaudarner.
Preferably, the linker having the second cleavage site may be, for example, at least one or two or more selected from the group consisting of: a Loxp linker (linker with Loxp site (sequence)), containing a restriction endonuclease site, a double-stranded linker containing one deoxyuridine.
Preferably, the kit of the invention further comprises a cleavage reagent, said cleavage reagent being a reagent that cleaves the first cleavage site and/or a reagent that cleaves the second cleavage site. Preferably an endonuclease and/or an agent having a deoxyuridine cleaving function.
Preferably, the cleavage agent is selected from at least one or two or more of the following groups: exonuclease I-VIII, T5 exonuclease, S1 nuclease, mungbean nuclease, micrococcal nuclease, BAL-31 nuclease, recJf exonuclease, deoxyribonuclease I, type I restriction enzyme, type II restriction enzyme, type III restriction enzyme, hindIII restriction enzyme, bgl II restriction enzyme, and USER enzyme.
Preferably, the library construction kit of the present invention further comprises at least one or more than two selected from the following group of reagents: a reagent for end repair, a reagent for linker addition, a reagent for circularization of a DNA fragment, a reagent for biotin fishing, and a reagent for amplification of a DNA fragment. The above reagent can be used any reagent known to those skilled in the art, for example, T4DNA polymerase, klenow fragment, klenow buffer, DNA ligase, taq enzyme, dNTP, T4 polynucleotide kinase, and T4 polynucleotide kinase buffer.
In the library kit of the present invention, each reagent or device is preferably packaged individually, but may be packaged in combination without affecting the practice of the present invention.
Examples
The present invention will be described in further detail with reference to the following drawings and examples. It should be understood that the specific embodiments described herein are merely illustrative of the invention and do not limit the invention.
Example 1 Large fragment DNA library construction
Large fragment processing of DNA samples
1.1 taking 1mL of healthy human whole blood, and extracting according to an operation instruction of a blood genome DNA extraction system (0.1-20 mL) (Tiangen Biochemical technology & lt, beijing & gt, co., ltd.) to obtain a DNA sample. A5 mu g DNA sample is taken, and the large fragment breaking treatment of the DNA sample is carried out by using a Hydroshear Plus DNA fragmenting instrument according to the instruction, wherein the target large fragment is 5kb in length.
2. Tip repair
2.1 prepare the end-repair reaction system in a 1.5mL centrifuge tube:
dNTP Mix (dNTP Mix) (10 mM each) is a premixed solution containing the sodium salts of dATP, dCTP, dGTP and dTTP, each at a concentration of 10mM, and a total concentration of 40mM (pH 7.5).
2.2 in a Thermomixer C constant temperature mixer (EPPENDIFy, hereinafter referred to as thermostat) at 20 ℃ for 30 minutes.
2.3 the recovered DNA was purified with 100. Mu.L of AgencourtAPure XPbeads (BECKMAN COULTER Co., ltd., hereinafter referred to as "purified magnetic beads") and eluted with 35. Mu.L of EB buffer to obtain a sample of the end-repaired DNA.
3 terminal with "A"
3.1 prepare the reaction system plus "A" according to the following table:
3.2 incubate 30 minutes at 37 ℃ in a thermostat.
3.3 the recovered DNA was purified with 100. Mu.L of 1 Xpurified magnetic beads, and the recovered DNA was eluted with 35. Mu.L of EB buffer to obtain a sample of end-repairing DNA.
4 connected by joints
The linker used in this step is a linker with a second cleavage site consisting of SEQ ID NO:1 and SEQ ID NO:2, and (b) the nucleotide sequence shown in the figure. It has a second cleavage site of dU and the linker sequence is shown below:
4.1 prepare the adapter reaction system in a 1.5ml centrifuge tube:
4.2 incubate at 25 ℃ for 15 minutes in a thermostat.
4.3A 0.8% agarose gel was prepared, and the gel was electrophoresed at 100V for 2 hours using 1Kb DNA Ladder from TIANGEN as a molecular weight standard. After the electrophoresis, the gel was taken out and stained in TAE containing EB dye for 20 minutes. And (3) cutting the fragments of about 4.8-5.5kb under ultraviolet irradiation.
4.4 Place the excised gel pieces into a weighed clean 2.0mL centrifuge tube, gel purify with agarose gel recovery kit to recover DNA.
4.5 recovering the large fragment sample of the adaptor-added DNA, and using the sample for the next reaction or storing the sample at-80 ℃.
5. Viscous end-generating reaction
5.1 preparing a viscous end-generating reaction system in a 1.5ml centrifuge tube:
5.2 incubate at 37 ℃ for 30 minutes in a thermostat. Deoxyuridine is digested by USER enzyme, and large fragments of DNA form gaps in the single strand in which the original deoxyuridine is located. Then, the DNA fragments were incubated at 75 ℃ for 15 minutes and immediately placed on ice to cause the remaining short DNA single strand at the 3' -end of the single strand containing deoxyuridine to be detached, thereby forming large DNA fragments having sticky ends.
5.3 DNA fragments were recovered by purification using 1 Xpurified magnetic beads and eluted with 35. Mu.L of EB buffer to give large DNA fragments with sticky ends.
6.DNA cyclization
6.1 prepare cyclization reaction system in 1.5mL centrifuge tube:
6.2 incubate at 16 ℃ for 30 minutes in a thermostat.
7. Digestion of Linear DNA
7.1 adding the following reagents into the reaction system of the step 6.1 after the reaction is finished:
7.2 digestion of linear DNA in a thermostat at 37 ℃ for 30 minutes.
7.3 incubate at 75 ℃ for 10 minutes in a thermostat and place on ice after enzyme deactivation.
7.4 mu.L of EDTA (0.5M) was added to the reaction mixture to sufficiently terminate the digestion, thereby obtaining digested circularized DNA large fragments. The large fragment of circular DNA obtained in this step has a first cleavage site, A ^ AGCTT.
8. Circularized DNA fragmentation
8.1 disruption of the circularized DNA was achieved using the Bioruptor DNA disruptor following the disruption program of the following table to obtain the disrupted DNA.
Interrupting the parameters:
target segment size
|
ON/OFF time (seconds)
|
Number of cycles
|
300-400bp
|
15/30
|
10 |
The specific operation method is described in Bioruptor Standard operation flow
8.2 recovery of the cleaved DNA from purification step 8.1 using 1 Xpurified magnetic beads, dissolved in approximately 50. Mu.L of EB buffer for subsequent reactions or stored at-80 ℃.
9. Purification of Biotin-labeled DNA
9.1 resuspension by shaking
M-280Streptavidin magnetic beads (Streptavidin magnetic beads).
9.2 aspirate 20. Mu.L of resuspended beads into a 1.5mL centrifuge tube, place the tube on a magnetic separation rack for 1 minute, carefully aspirate and discard the supernatant.
9.3 Wash beads with 50. Mu.L of Bead Binding Buffer. Carefully resuspend the pellet, place the centrifuge tube on a magnetic separation rack, wait 1 minute, and discard the supernatant. Repeat step 9.3 once.
9.4 resuspend the beads with 50. Mu.L of bead binding buffer.
9.5 Add 50. Mu.L of the resulting product from step 8.2 and incubate in a thermostat at 20 ℃ for 15 minutes (15 seconds shaking every 2 minutes, 600 rpm).
9.6 Place the centrifuge tube on a magnetic separation rack, wait 1 minute, discard the supernatant, wash the beads three times with 200. Mu.L of Bead Wash Buffer I.
9.7 Place the centrifuge tubes on a magnetic separation rack, wait 1 minute, discard the supernatant and wash the beads twice with 200. Mu.L of EB buffer.
9.8 remove the EB buffer from the last wash and resuspend the beads using 75. Mu.L of EB buffer.
10. Tip repair
10.1 prepare the end-repair reaction system according to the following table:
10.2 incubate at 20 ℃ for 30 minutes in a thermostat (15 seconds shaking every 2 minutes, 600 rpm).
10.3 Place the centrifuge tube on a magnetic separation rack, wait 1 minute, discard the supernatant, wash the beads three times with 200. Mu.L of bead wash buffer.
10.4 Place the centrifuge tubes on a magnetic separation rack, wait 1 minute, discard the supernatant, and wash the beads twice with 200. Mu.L of EB buffer.
10.5 remove the EB buffer from the last wash and resuspend the beads using 32. Mu.L of EB buffer.
11. The end is added with 'A'
11.1 prepare the "A" reaction system according to the following table:
11.2 incubate at 37 ℃ for 30 minutes in a thermostat (15 seconds shaking every 2 minutes, 600 rpm).
11.3 Place the centrifuge tube on a magnetic separation rack, wait 1 minute, discard the supernatant, wash the beads three times with 200. Mu.L of bead wash buffer.
11.4 Place the centrifuge tubes on a magnetic separation rack, wait 1 minute, discard the supernatant and wash the beads twice with 200. Mu.L of EB buffer.
11.5 remove the EB buffer from the last wash and resuspend the magnetic beads using 18. Mu.L of EB buffer.
Ligation of illumina sequencing linker:
12.1 the linker ligation reaction system was prepared according to the following table:
the base sequence of PE Adapters is shown below:
12.2 Place in a thermostat at 20 ℃ for 15 minutes (shaking 15 seconds every 2 minutes, 600 rpm).
12.3 Place the centrifuge tube on a magnetic separation rack, wait 1 minute, discard the supernatant, wash the beads three times with 200. Mu.L of bead wash buffer.
12.4 Place the centrifuge tubes on a magnetic separation rack, wait 1 minute, discard the supernatant, and wash the beads twice with 200. Mu.L of EB buffer.
12.5 remove the EB buffer from the last wash and resuspend the magnetic beads using 21. Mu.L of EB buffer.
13. Library amplification
13.1 prepare the library amplification reaction system according to the following table:
the nucleotide sequences of primer 1 and primer 2 are shown below:
13.2 The PCR reaction was programmed as follows:
13.3 the amplified product is cut by agarose electrophoresis to recover the fragment within the range of 250-500bp, and a large fragment library is obtained and can be used for the following quality evaluation and sequencing.
13.4, performing library quality inspection, wherein the size of the fragment is consistent with that of the cut gel, and the concentration test meets the requirement of on-machine sequencing.
Example 2 quality evaluation of the library obtained in example 1
1.1 digestion of the large fragment library product from example 1 with the restriction enzyme HindIII.
An enzyme digestion reaction system was prepared according to the following table:
1.2 placing in a thermostat and bathing at 37 ℃ for 2 hours. The DNA was recovered by gel purification using agarose gel recovery kit.
1.3 the library products of example 1 and the products of step 1.2 were detected by electrophoresis on a 2% agarose gel, the results of which are shown in FIG. 1.
And (4) judging the standard: when the average value of the electrophoretic bands of the library after enzyme digestion is shifted to about half of the size of the average value of the original library bands and presents a more dispersed state than the library bands, the library construction is successful.
As can be seen from FIG. 1, the mean value of the library fragments is about 400bp, the electrophoretic bands become more dispersed after enzyme digestion, and the mean value of the fragment sizes shifts to about 200bp, so that the library fragments are qualified large-fragment libraries and can be subjected to on-machine sequencing.
Example 3 on-machine sequencing and analysis of sequencing results on the library obtained in example 1
1.1 the qualified large fragment sequencing library obtained in step 13.3 was run on the HiSeq2500 sequencing platform using a paired end sequencing program (PE 150) to obtain the off-line data shown in Table 1.
TABLE 1
As can be seen from table 1: clean reads have a higher proportion in Raw reads, Q30 is higher, and the overall sequencing result is better.
1.2 the 100bp sequence reads were extracted and analyzed, the linker sequence of example 1 was removed by the LOxp linker removal software Deloxer (non-patent document 2), and the Clean reads data were sorted, with the sorting results shown in Table 2.
Table 2:
mate-paired data are the values and ratios of true end-paired fragments in a large fragment library obtained after processing by DeLoxer software, which are valid data that can be used to construct a genome backbone without a reference genome. In this embodiment, the effective data rate is the percentage of comparable pair data (Mate-ordered pair number) to the original data (half of Clean reads number). The effective data rate of the library obtained in example 1 as shown in table 2 was 43%, whereas this rate was only 28.62% in reference 2.
1.3 alignment of the Mate-ordered data from step 1.2 to human reference genome HG19, the distance between each pair of Mate-ordered data corresponds to the size of the original large fragment in a large fragment library (i.e.insert size), and the intensity of the frequency of appearance of Insert sizes is shown in FIG. 2.
As can be seen from FIG. 2, the major peak of the insert fragment of the library constructed in example 1 is 4622bp, which is within 5kb. + -. 5% of the expected library size and substantially identical to the target large fragment length of 5kb. The proportion of the insert in the range of. + -. 20% of the major peak of the insert was 97.52%, i.e., the insert size of the resulting library was mainly distributed around the target large fragment length of 5kb.
While the foregoing specification illustrates and describes the preferred embodiments of the present invention, it is to be understood that the invention is not limited to the precise forms disclosed herein and is not to be interpreted as excluding the existence of additional embodiments that are also intended to be encompassed by the present invention as modified within the spirit and scope of the invention as described herein. And that modifications and variations may be effected by those skilled in the art without departing from the spirit and scope of the invention as defined by the appended claims.
Sequence listing
<110> AnnuoYoda Gene technology (Beijing) Co., ltd
<120> method for constructing DNA large fragment library and application thereof
<130> 1613-3SDCN
<160> 6
<170> PatentIn version 3.3
<210> 1
<211> 19
<212> DNA
<213> Artificial sequence
<400>
CGATCGATGCTAGCAAGCT 19
<210> 2
<211> 20
<212> DNA
<213> Artificial sequence
<400>
AGCdUTGCTAGCATCGATCGT 20
<210> 3
<211> 32
<212> DNA
<213> Artificial sequence
<400>
GATCGGAAGAGCGGTTCAGCAGGAATGCCGAG 32
<210> 4
<211> 32
<212> DNA
<213> Artificial sequence
<400>
ACACTCTTTCCCTACACGACGCTCTTCCGATC 32
<210> 5
<211> 38
<212> DNA
<213> Artificial sequence
<400> primer 1
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCT 38
<210> 6
<211> 38
<212> DNA
<213> Artificial sequence
<400> primer 2
CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTC 38