CN107759700A

CN107759700A - Target transgenic T cells of CD19 antigens and preparation method and application

Info

Publication number: CN107759700A
Application number: CN201710969332.4A
Authority: CN
Inventors: 黄昕华; 于丽丽; 生德伟; 李德柱; 徐峰波
Original assignee: Yinfeng Biological Group Ltd
Current assignee: Yinfeng Biological Group Ltd
Priority date: 2017-10-18
Filing date: 2017-10-18
Publication date: 2018-03-06

Abstract

The invention discloses a kind of transgenic T cells of targeting CD19 antigens, are to be integrated with SEQ ID NO in chromosome:Coding shown in 8 targets the gene of CD19 antigen receptors and has knocked out the initial cell of PD1 genes or/and CTLA4 genes；Or：To be integrated with SEQ ID NO in chromosome:Gene, the SEQ ID NO of coding targeting PSA NCAM acceptors shown in 2:The initial cell of the gene of coding targeting CD19 antigen receptors shown in 8；The initial cell is CD4+T cells or CD8+T cells.Application of the transgenic T cells of the targeting CD19 antigens in the medicine for preparing treatment malignant B cell lymthoma.The present invention is in carT structures, introduce EGFR recognition sequence, EGFR monoclonal antibodies Cetuximab can be used to eliminate carT cells if necessary, and silence has knocked out PD1, CTLA4 gene, its suppression to carT cells is relieved, carT cells is enhanced and overcomes tumor microenvironment to suppress immune cell function.

Description

Target transgenic T cells of CD19 antigens and preparation method and application

Technical field

The present invention relates to transgenic T cells of targeting CD19 antigens and preparation method and application.

Background technology

The Chinese annual morbidity of leukaemia 2003~2007 is every 100,000 people of 5 people, in recent years because industrialization causes to become with environment Change, the incidence of disease gradually rises to every 100,000 people of 8~10 people.Conservative estimation increases 40,000 patients newly every year.CLL is that western countries are most normal The type of leukemia seen, the 1/3 of whole leukaemia examples can be accounted for.Asian countries's incidence is relatively low, and China CLL accounts for leukaemia sum Less than 3%.For more than 90% CLL age of onset more than 50 years old, male's incidence of disease is higher than women, male: female=2: 1.It is non-suddenly 3~6 people of the strange golden every 100,000 people morbidity of lymthoma (NHL) China, fall ill 50,000 people every year in the U.S..

Adult acute's B leukemic lymphoblastoids account for leukaemia 20~30%.The acute B lymph that classic chemotherapy can cure 20% is white The adult patients of blood disease, resistance or the recurrence after chemotherapy several times of 80% adult patients；Classic chemotherapy can cure 80% acute B leaching The child patient of bar leukaemia, resistance or the recurrence after chemotherapy several times of 20% child patient.Patients with recurrent needs classical marrow to move Plant or Umbilical Cord Blood Transplantation, are limited to marrow or Cord blood distribution type.

The acute B lymph that the carT of American-European existing targeting CD19 antigens can be used for the stubbornness of adult or children or recur is white Blood disease (B-ALL), the complete efficiency 80~90% in 6 months；For chronic lymphocytic leukemia, curative effect 50% (25%CR, 25%PR)；NHL (NHL) can also be directed to, curative effect (CR+PR) is between 50~70%.

Later targeting CD19 in 2011 car T technologies, for B-ALL, CLL, NHL tumours, in lymphadeneetomy After treating (lymphodepleting chemotherapy), implement adoptive T cell immunization therapy, can obtain above-mentioned a high proportion of Responsiveness.The as shown by data of clinical test, after car T cells input patient, limited propagation in vivo is to obtain complete response The key of (complete response)；CarT cells are a small amount of in patient's body and long-term existence, are the passes for preventing palindromia Key.During clinical treatment, the CD19 carT cell quantities of input and amplification, and growth factor release storm (CRS) and nerve in vivo Toxicity is closely related；It is also closely related with clinical efficacy.Wherein, the control most of patients of neurotoxicity is reversible that minority is suffered from Person is dead because of encephaledema, and its exact cause is clear without judging so far, numerous data and thinks, and patient tumors are born Lotus, patient's individual physique, how much is input carT cell quantities, clinical application (lymphodepletingchemotherapy), carefully It is all relevant that born of the same parents cultivate details, the CD28 costimulating factors of car molecules etc..

Preclinical as shown by data, CD8+ and CD4+ central memory cell (central memory) T cell or more Naivety (naive) T cell of early stage is to obtain the key of good clinical efficacy.CD4+T cells and CD8+ cells are in exotic invasive Virus and fungi, in-vivo tumour preventing and treating have synergistic enhancing effect.So the method that the present invention is implemented is CD4+T Cultivated respectively after cell and CD8+T cell purifications, then mixing feeds back patient.Patient is before cell is inputted, clinician's root According to individual, it is necessary to inject patient with endoxan or fludarabine, the immunosuppressive factor of body is removed.

The general principle Chimeric antigen receptor T cell (CAR-T cells) of car T technologies is to identify certain tumour antigen Antigen-binding portion and the CD3- ζ chains of antibody or Fc ε RI γ intracellular part be coupled in vitro as a chimeric protein, pass through base Because the method for transduction transfects the T cell of patient, it is set to express Chimeric antigen receptor (CAR).The T cell of patient is by " recodification " Afterwards, the specific CAR-T cells of massive tumor are generated.

First generation CAR by identification tumor surface antigen single-chain antibody (single chain fragment variable, ) and ITAM (immunoreceptor tyrosine-based activation scFv Motifs, ITAM, usually CD3- ζ and Fc ε RI γ) composition.The experiment of early stage demonstrates CAR-T feasibility, but first For CAR of short duration T cell can only be caused to rise in value and relatively low cytokine secretion, it is impossible to provide prolonged T cell amplification letter Number and continue inside GVT.

According to the dual signal theory of T cell activation, the activation of T cell and propagation need costimulatory signal；The second generation, the 3rd Costimulatory molecules signal sequence (costimulatory molecule, CM) is introduced for CAR, it is intended to improves the cell of T cell Cytotoxic activity, proliferative and time-to-live, promote the release of cell factor.Existing 2nd generation carT cell culture technologies both at home and abroad, Similar technology path is substantially followed, i.e., after peripheral blood mononuclear cells are separated, after starting is cultivated 1~2 day, transfection is inverse Retroviral (retroviral), or slow virus (lentiviral), or the gene table that transposons (transponson) is carrier Up to Chimeric antigen receptor (chimeric antigenreceptor, car) molecule, add costimulation factor (growth factor such as IL2, Auxiliary with CD3CD28 antibody, or cell line of antigen presentation etc.) culture 7~30 days after, feed back patient.

The as shown by data of American-European clinical test, existing CD19chimeric antigen receptor T (car T) skill Art, complete cure rate (complete response, CR) is treated in 6 months of B-ALL up to more than 90%.But according to multicenter The clinical experiment report of more company techniques, there is 5 difficult points, and majority does not solve：

1st, patient needs to guard closely over the course for the treatment of, there is serious CRS, and it is several times in normal water to dominate one of reason Flat serum IL 6.American-European clinic has relatively good processing scheme, mainly IL6R monoclonal antibodies or heavy dose of steroid hormone to this.

2nd, 40~55% patient has the reaction of 3~4 grades of neurotoxicity, it is necessary to clinic control.Each company controls There is encephaledema and dead in patient during treatment, and the JCAR015 (CD28 costimulations domain) of Juno companies is dead because of continuous several patients Die and project termination.

3rd, after treating successfully, patient's body long-term lacking bone-marrow-derived lymphocyte, thus must every 2~3 weeks injection primary immune response balls Albumen is to keep that demand is immunized substantially.

4th, after treating 12 months, there is 40% people's recurrence, mainly 2 reasons, a.carT cells can not persistently exhaustion Lose, the scFv of b.carT cells has immunogenicity and lost after patient's immunological rejection.

5th, patient's body remains unchanged long-term existence tumour seed cell, is regrowed after carT cell loss, clinical manifestation For palindromia.

The content of the invention

For above-mentioned prior art, the invention provides a kind of transgenic T cells of targeting CD19 antigens, and its preparation side Method.The present invention introduces EGFR recognition sequence in carT structures, EGFR monoclonal antibodies Cetuximab can be used to eliminate if necessary CarT cells, and PD1, CTLA4 gene have been knocked out, its suppression to carT cells is relieved, carT cells is enhanced and overcomes Tumor microenvironment suppresses immune cell function.

The present invention is achieved by the following technical solutions：

One kind targeting PSA-NCAM (neuronal cell surface antigen) acceptor, its amino acid sequence such as SEQ ID NO:1 institute Show, its structure is：scFv-PSA-NCAM-CD8a-PD1.

A kind of gene for encoding above-mentioned targeting PSA-NCAM acceptors, its nucleotide sequence such as SEQ ID NO:Shown in 2；It is tied Structure is：scFv-PSA-NCAM-CD8a-PD1.

A kind of recombinant slow virus expression vector I, it includes the gene of above-mentioned coding targeting PSA-NCAM acceptors, and target The shRNA of shRNA or/and targeting CTLA4 genes to PD1 genes.The viral coat system of the recombinant expression carrier, for routine Method (2nd generation or the 3rd generation slow virus coat system)；Lentiviral (lentiviral used in the present invention Expression vector) SIN-3LTR carrier, carrier (Dull T et al (1998) A for being delivered from 1998 of female parent third-generation lentivirus vector with a conditional packaging system.JVirol.1998Nov；72(11):8463-71.).

The shRNA of the targeting PD1 genes, including positive-sense strand and antisense strand, the nucleotide sequence such as sequence table of positive-sense strand Shown in SEQ NO.3, the nucleotide sequence of antisense strand is as shown in sequence table SEQ NO.4.

The shRNA of the targeting CTLA4 genes, including positive-sense strand and antisense strand, the nucleotide sequence such as sequence of positive-sense strand Shown in table SEQ NO.5, the nucleotide sequence of antisense strand is as shown in sequence table SEQ NO.6.

A kind of acceptor of targeting CD19 antigens, its amino acid sequence such as SEQ ID NO:Shown in 7, its structure is：anti- CD19 FMC63 scFv-CD27-41BB-CD3zeta。

A kind of gene for encoding above-mentioned targeting CD19 antigen receptors, its nucleotide sequence such as SEQ ID NO:Shown in 8；It is tied Structure is：anti-CD19 FMC63 scFv-CD27-41BB-CD3zeta.

A kind of recombinant slow virus expression vector II, it includes the gene of the above-mentioned targeting CD19 antigen receptors of above-mentioned coding. The construction method of the recombinant expression carrier, it is conventional method.

A kind of transgenic T cells of targeting CD19 antigens, to include above-mentioned recombinant slow virus expression vector I, recombinant lentiviral The initial cell of virus expression carrier II, or gene, the coding of above-mentioned coding targeting PSA-NCAM acceptors are integrated with chromosome The initial cell of the gene of CD19 antigen receptors is targetted, the initial cell is CD4+T cells or CD8+T cells.Its preparation side Method is：Using two-wheeled slow-virus infection CD4+T cells or CD8+T cells, the first round infects recombinant slow virus expression vector I, the Two wheel infection recombinant slow virus expression vectors II；After two-wheeled infection, transgenic T cells (the PD1 bases of targeting CD19 antigens are produced Cause, CTLA4 gene silencings)；Infection method is conventional method.

A kind of transgenic T cells of targeting CD19 antigens, to be including above-mentioned recombinant slow virus expression vector II and strike Except PD1 genes or/and the initial cell of CTLA4 genes, or above-mentioned coding targeting CD19 antigen receptors are integrated with chromosome Gene and knocked out the initial cell of PD1 genes or/and CTLA4 genes, the initial cell is CD4+T cells or CD8+T Cell.Its preparation method comprises the following steps：

(1) the slow-virus infection CD4+T cells of recombinant slow virus expression vector II or CD8+T cells, obtain restructuring T cell；Sense Dyeing method is conventional method；

(2) gRNA, CRISPR-cas9mRNA, HDR are mixed, and electricity turns restructuring T cell (400V, 0.5ms), produces targeting The transgenic T cells of CD19 antigens, its PD1 gene, CTLA4 genes are knocked, and coding targeting CD19 is integrated with chromosome and is resisted The gene of original receptor.The gRNA is the gRNA of targeting PD1 genes or the gRNA for targetting CTLA4 genes, and the HDR is PD1 bases The HDR of the HDR or CTLA4 genes of cause.

The CRISPR-cas9mRNA, obtained by in-vitro transcription spCas9-2.0.SpCas9(BB)-2A-Puro (PX459) V2.0 (abbreviation spCas9-2.0) is existing sequence in the prior art, is issued by Zhang Feng (ZhangFeng), its Nucleotide sequence such as SEQ ID NO：(sequence show corresponding DNA sequence dna) shown in 9；Clone spCas9-2.0 cas9 eggs White mRNA, it is cloned into pUC19 plasmids, by vitro transcriptions and 5 ' cappings, ripe mRNA is formed, for cell Transfection, it is adapted to E.coli expression.

The gRNA of the targeting PD1 genes, its nucleotide sequence such as SEQ ID NO：(sequence show corresponding shown in 10 DNA sequence dna).

The gRNA of the targeting CTLA4 genes, its nucleotide sequence such as SEQ ID NO：(sequence is shown relatively shown in 11 The DNA sequence dna answered).

The HDR of the PD1 genes, its nucleotide sequence such as SEQ ID NO：Shown in 12.

The HDR of the CTLA4 genes, its nucleotide sequence such as SEQ ID NO：Shown in 13.

Application of the transgenic T cells of the targeting CD19 antigens in the medicine for preparing treatment malignant B cell lymthoma.

Technical scheme, 2 the problem of in background technology, the present invention proposes targeting AQP4 or GABA gene tables The albumen reached.The protein expression of AQP4 gene expressions is in renal tubular cell and the astrocyte of central nervous system.GABA Receptor is the specific expressed cell surface receptor of central nervous system.In the scFv sequences of identification AQP4 or GABA albumen The sequence of Inhibitory receptor is coupled afterwards, just forms the car of protectiveness.The problem of in background technology 3, the present invention propose to use EGFR monoclonal antibody Cetuximab and CD20 monoclonal antibodies Rituximab eliminates carT cells.The problem of in background technology 4, the present invention It is proposed that the scFv made of humanization monoclonal antibody reduces immunogenicity.Improve the center note of cell culture protocol enhancing car T cells Recall cell (central memory T) ratio.The problem of in background technology 5, proposition gene editing of the present invention or RNAi method, knockout or silence PD1, CTLA4 gene, release the suppression to carT cells, and enhancing carT cells overcome tumour Microenvironment suppresses immune cell function.

Brief description of the drawings

Fig. 1：The structure sketch of Lentiviral I.

Fig. 2：Anti-PSA-NCAM scFv-CD8a-PD1 structure schematic diagram.

Fig. 3：The short-term growth curve of CD19 carT and anti-CD3/anti-CD28 the magnetic bead cultures of various structures.

Fig. 4：The short-term growth curve that CD19 carT and the K562-CD19 target cell of various structures co-culture.

Fig. 5：Cetuximab induces CD19 carT cytotoxicities (cytotoxicity) figure.

Fig. 6：The growth curve that cord blood T cells are cultivated after PSA-NCAM and CD19 two-wheeleds car virus infection.

Fig. 7：The double targeting carT of CD19carT, PSA-NCAM/CD19 show target cell SH-SY5Y-CD19 fragmentation effect It is intended to.

Fig. 8：Cord blood T cell co-cultures after CD19 car slow-virus transfections with SH-SY5Y, SH-SY5Y-CD19 Growth curve.

Embodiment

With reference to embodiment, the present invention is further illustrated.

Involved instrument, reagent, material etc. in following embodiments, it is existing in the prior art unless otherwise noted Conventional instrument, reagent, material etc., can be obtained by regular commercial sources.Involved experimental method in following embodiments, inspection Survey method etc., it is existing normal experiment method, detection method etc. in the prior art unless otherwise noted.

Embodiment 1 builds Lentiviral

(1) scFv-PSA-NCAM-CD8a-PD1 is built：Structure diagram is as shown in figure 1, car MOLECULE DESIGNs are as shown in Figure 2. The scFv-PSA-NCAM-CD8a-PD1 of structure nucleotide sequence such as SEQ ID NO:Shown in 2.

(2) anti-CD19 FMC63 scFv-CD27-41BB-CD3zeta are built：Construction method is conventional method, nucleosides Acid sequence such as SEQ ID NO:Shown in 8.

(3) Lentiviral I, II is built：293T cells are cultivated with RPMI1640+10% FBS.Treat cell 90% After density, with lipo2000 mixing transfected plasmids, 293T cells are transfected.Transfection method is grasped according to the standard of Invitrogen manufacturers Make, plasmid has：Expression plasmid, pMDLg/pRRE, pRSV-Rev, pMD2.G, the molar ratio for mixing plasmid are 2: 1: 1: 0.5. Slow virus supernatant is harvested after 24-48 hours.Then plus Clontech Lenti-X concentrator, 1500g, 4C after mixing 45min is centrifuged, removes supernatant, obtains slow virus precipitation.

The transfecting T cells of embodiment 2

The peripheral blood of Healthy People or tumor patient extracts 50-100ml, or with Cobra Spectra blood cell separators Mononuclearcell is obtained, after Ficoll is separated, (magnetic bead is purchased from Stem Cell with CD4+ or CD8+ magnetic bead sortings Technologies companies).

Slow-virus infection people's CD4+T or CD8+T cell：Slow-virus infection reference after preparing and concentrating TakaraRetronectin specifications, are briefly described as follows：

The μ g/ml of Retronectin concentration 20~100 are prepared, bed board is 4~20 μ g/cm using density², room temperature 2 hours Afterwards, it is standby to suck supernatant；The above-mentioned μ l/cm of plate 125~250 are added to slow virus², 37C warm bath 4~6 hours；T cell to be infected With density 0.5~2.5 × 10⁴cells/cm²Bed board.T cell changes liquid after infecting 24 hours.

The present invention uses 2 wheel slow-virus infections：1st wheel infection inhibition carT, the 2nd wheel infection CD19 carT.

After two-wheeled infection, reach the suppression that immunologic test point acceptor is overcome with anti-CTLA4 anti-PD1 shRNA； Antigen PSA-NCAM inhibition car molecules are identified, nerve cell can be identified and suppress CD19 carT in central nervous system It is active；Anti-CD19 FMC63 carT carry out killing B lympha tumour cells.

(culture medium prescription after T cell culture 1 day：Lonza X vivo15, adult serum 10%, IL2300-500IU/ Ml,

Penicillin (100units/ml) and streptomycin (100 μ g/ml), with AntiCD3 McAb CD28 magnetic bead (being mixed with car T cells 3: 1), stimulate CD19 carT cell growths.

Embodiment 3 knocks out PD1 genes, CTLA4 genes

Carry out knocking out the experiment of PD1 gene, CTLA4 genes respectively, concrete mode is as follows：gRNA、CRISPR- Cas9mRNA, HDR are mixed, and electricity turns restructuring T cell (T cell only transfected with Lentiviral II) (400V, 0.5ms).

After electricity turns, (used medium is culture cell 3 days：Lonza X vivo15, add adult serum 10%, IL2 300~500IU/ml), genomic DNA is extracted, enters performing PCR amplification, amplified production Agarose glue purifications, carries out TA clones, After purification of individual clone, choose 100 cloning and sequencings and obtain Indel abrupt informations, according to mutation and not mutated amount ratio, gene is compiled Collect efficiency PD1：17%, CTLA4：18.3%.

The CRISPR-cas9mRNA nucleotide sequences such as SEQ ID NO：Shown in 9；

When knocking out PD1 genes, the gRNA, nucleotide sequence such as SEQ ID NO of PD1 genes are targetted：Shown in 10；PD1 genes HDR nucleotide sequences such as SEQ ID NO：Shown in 12；

When knocking out CTLA4 genes, the gRNA, nucleotide sequence such as SEQ ID NO of CTLA4 genes are targetted：Shown in 11； The HDR nucleotide sequences of CTLA4 genes such as SEQ ID NO：Shown in 13.

Amplification gene knocks out position, and nearby the primer is：

Target the primer of PD1 exon2 near zones：

Forward：TTCCTCACCTCTCTCCATCTC；

Reverse：CTCTCTTTGATCTGCGCCTT；Such as SEQ ID NO：14th, shown in 15.

Target the primer of CTLA4 exon2 near zones：

Forward：TGAGTTCACTGAGTTCCCTTTG；

Reverse：GAAATGGCTTTGCTCACCAATTA；Such as SEQ ID NO：16th, shown in 17.

The Performance Testing of embodiment 4carT cells, experimental data series

The slow virus Titer Data of table 1 (qPCR detections)

The slow virus data (as shown in table 1) of some experimentai batches are obtained, experimental procedure is as follows：

1. infection before 6h in 24 porocyte culture plates with 2.5 × 10⁵Individual cells/well is uniformly inoculated with HEK293 cells.

2. slow virus is carried out into gradient dilution, 3 gradients are done altogether, i.e., per hole, (500 μ l train without dual anti-, serum-free DMEM Support base) in add to and be inoculated with 24 orifice plates of cell after mixing containing 10 μ l, 1 μ l, 0.1 μ l viruses, concussion, adding will training before virus Support the culture medium exhaustion in plate.

3. after infecting 18-20h, the culture medium in culture plate is replaced by fresh DMEM complete mediums.

4. collect cell after infection 64-68h and carry out the extraction of genomic DNA.

5. extract genomic DNA (according to AxyGEN genome DNA extracting reagent kit specification).

6. using tested slow virus carrier gradient dilution as standard items, the universal primer on slow virus carrier carries out qPCR to obtain Obtain viral integrase copy number.

7. using Actin plasmids gradient dilution as standard items, Actin primers carry out the genome copy numbers of qPCR detection samples To obtain genome copy numbers.

Fig. 3：(CD19 carT here, refer to by FMC63 containing anti-CD19 the CD19 carT of various structures ScFv-CD27-41BB-CD3zeta Lentiviral transfects what is obtained, does not knock out PD1 genes, CTLA4 genes) and The short-term growth curve of anti-CD3/anti-CD28 magnetic bead cultures.Complete medium is Lonza X vivo15, adult serum 10%, IL2 300-500IU/ml.Each group is：Unloaded GFPcarT controls；CD19car T (no 4-1BB costimulation sequences Row)；CD19 car T (sequence of costimulation containing 4-1BB).

Fig. 4：The short-term growth curve that CD19 carT and the K562-CD19 target cell of various structures co-culture.Culture completely Base is Lonza X vivo15, adult serum 10%, IL2300-500IU/ml.Each group is：GFP vehicle Controls； CD19car T (car acceptors are without 4-1BB costimulations sequence)；CD19 car T (car acceptors costimulation containing 4-1BB sequence).

Fig. 5：Cetuximab induces CD19 carT cytotoxicities (cytotoxicity) figure.Complete medium is Lonza X vivo15, non-heat-inactivated adult serum 10%, IL2 300-500IU/ml.In in vitro culture ware, add in the medium After 1000ng/mlCetuximab, programmed cell death is entered in the CD19 carT cell short time, competent cell quantity declines.It is each Group is：Carrier GFP negative controls；CD19 carT (carT is without 4-1BB)；CD19 carT (carT contains 4-1BB).

Fig. 6：Cord blood T cells, in independent culture growth, can have by PSA-NCAM and CD19 two-wheeleds car virus infection Effect propagation；It is but slow-growing in the presence of SH-SY5Y cells.

Fig. 7：CD19 carT can effectively kill target cell SH-SY5Y-CD19 (cell line SH-SY5Y expression CD19 antigens), The double targeting carT of PSA-NCAM/CD19 can not kill target cell SH-SY5Y-CD19.

Fig. 8：Cord blood T cell passes through CD19 car slow-virus transfections, can identify killing SH-SY5Y-CD19, it is impossible to kill Maternal SH-SY5Y cells, it is demonstrated by selectivity targeting CD19 antigens.

Sequence table

<110>Yinfeng Bioengineering Group Co., Ltd.

<120>Target transgenosis T cells of CD19 antigens and preparation method and application

<141> 2017-10-18

<160> 17

<170> SIPOSequenceListing 1.0

<210> 1

<211> 340

<212> PRT

<213> Artificial Sequence

<400> 1

Asp Val Val Met Thr Gln Thr Pro Leu Ser Leu Pro Val Ser Leu Gly

1 5 10 15

Asp Gln Ala Ser Ile Ser Cys Arg Ser Ser Gln Ser Leu Val His Ser

20 25 30

Asn Gly Asn Thr Tyr Leu Tyr Trp Tyr Leu Gln Lys Pro Gly Gln Ser

35 40 45

Pro Lys Pro Leu Ile Tyr Arg Val Ser Asn Arg Phe Ser Gly Val Pro

50 55 60

Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile

65 70 75 80

Ser Arg Val Glu Ala Glu Asp Leu Gly Val Tyr Phe Cys Phe Gln Gly

85 90 95

Thr His Val Pro Tyr Thr Phe Gly Gly Gly Thr Arg Leu Glu Ile Lys

100 105 110

Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gln

115 120 125

Ile Gln Leu Gln Gln Ser Gly Pro Glu Leu Val Arg Pro Gly Ala Ser

130 135 140

Val Lys Ile Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Asp Tyr Tyr

145 150 155 160

Ile His Trp Val Lys Gln Arg Pro Gly Glu Gly Leu Glu Trp Ile Gly

165 170 175

Trp Ile Tyr Pro Gly Ser Gly Asn Thr Lys Tyr Asn Glu Lys Phe Lys

180 185 190

Gly Lys Ala Thr Leu Thr Val Asp Thr Ser Ser Ser Thr Ala Tyr Met

195 200 205

Gln Leu Ser Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Phe Cys Ala

210 215 220

Arg Gly Gly Lys Phe Ala Met Asp Tyr Trp Gly Gln Gly Thr Ser Val

225 230 235 240

Thr Val Ser Ser Ser Arg Ala Ala Arg Gly Thr Ile Gly Ala Arg Arg

245 250 255

Thr Gly Gln Pro Leu Lys Glu Asp Pro Ser Ala Val Pro Val Phe Ser

260 265 270

Val Asp Tyr Gly Glu Leu Asp Phe Gln Trp Arg Glu Lys Thr Pro Glu

275 280 285

Pro Pro Val Pro Cys Val Pro Glu Gln Thr Glu Tyr Ala Thr Ile Val

290 295 300

Phe Pro Ser Gly Met Gly Thr Ser Ser Pro Ala Arg Arg Gly Ser Ala

305 310 315 320

Asp Gly Pro Arg Ser Ala Gln Pro Leu Arg Pro Glu Asp Gly His Cys

325 330 335

Ser Trp Pro Leu

340

<210> 2

<211> 1020

<212> DNA

<213> Artificial Sequence

<400> 2

gacgttgtga tgacccaaac cccgcttagt ttgcctgtga gtttgggaga ccaagcgagt 60

atcagttgcc ggtcaagcca atctctggtt catagcaacg gaaacactta tttgtactgg 120

tacctgcaga aaccagggca gagcccaaaa cctctgattt accgcgtctc caatagattt 180

agtggggtac ctgaccggtt ttcaggtagt gggtcaggga ctgacttcac gcttaaaatc 240

agccgagtgg aggccgaaga tctgggggtt tacttttgtt tccaagggac acatgttcct 300

tatacattcg ggggcgggac tagacttgag attaaaggcg gtggtggttc agggggagga 360

ggttcaggcg gcgggggttc ccagatacaa cttcagcagt ctggaccaga actcgtgagg 420

cccggggctt ccgtgaaaat atcttgtaaa gcctcaggat acacatttac agattattac 480

attcactggg tgaagcagag gccaggggag ggcctggagt ggatcggatg gatatacccc 540

ggttcaggga acactaagta taacgaaaag ttcaaaggga aagcgacgct caccgtagat 600

acatccagtt ccacagcgta catgcaactg tcatcactta cgtctgaaga ttcagcagtg 660

tatttctgtg ccagaggagg gaaattcgca atggactact gggggcaggg tacaagtgta 720

accgtgtcta gtagtcgggc ggcaagagga accataggag cacgaaggac gggtcagccc 780

ctgaaggagg acccctccgc agttcccgtg ttttccgttg attacggtga attggacttt 840

cagtggcggg aaaagacccc ggagcctcct gttccgtgcg taccagaaca aacagaatac 900

gcgacaattg tgttcccgag cgggatgggc actagctctc cagcaagacg agggagtgcc 960

gatggccccc gctctgcgca gccgctgcgg cccgaggacg gtcattgttc ttggcctctc 1020

<210> 3

<211> 49

<212> DNA

<213> Artificial Sequence

<400> 3

caccggagag cttcgtgcta aactgcgaac atttagcacg aagctctcc 49

<210> 4

<211> 50

<212> DNA

<213> Artificial Sequence

<400> 4

aaaaggagag cttcgtgcta aactgttcgc agtttagcac gaagctctcc 50

<210> 5

<211> 50

<212> DNA

<213> Artificial Sequence

<400> 5

caccgccagc tttgtgtgtg agtatcgaaa tactcacaca caaagctggc 50

<210> 6

<211> 50

<212> DNA

<213> Artificial Sequence

<400> 6

aaaagccagc tttgtgtgtg agtatttcga tactcacaca caaagctggc 50

<210> 7

<211> 883

<212> PRT

<213> Artificial Sequence

<400> 7

Met Leu Leu Leu Val Thr Ser Leu Leu Leu Cys Glu Leu Pro His Pro

1 5 10 15

Ala Phe Leu Leu Ile Pro Glu Glu Val Lys Leu Gln Glu Ser Gly Pro

20 25 30

Gly Leu Val Ala Pro Ser Gln Ser Leu Ser Val Thr Cys Thr Val Ser

35 40 45

Gly Val Ser Leu Pro Asp Tyr Gly Val Ser Trp Ile Arg Gln Pro Pro

50 55 60

Arg Lys Gly Leu Glu Trp Leu Gly Val Ile Trp Gly Ser Glu Thr Thr

65 70 75 80

Tyr Tyr Asn Ser Ala Leu Lys Ser Arg Leu Thr Ile Ile Lys Asp Asn

85 90 95

Ser Lys Ser Gln Val Phe Leu Lys Met Asn Ser Leu Gln Thr Asp Asp

100 105 110

Thr Ala Ile Tyr Tyr Cys Ala Lys His Tyr Tyr Tyr Gly Gly Ser Tyr

115 120 125

Ala Met Asp Tyr Trp Gly Gln Gly Thr Ser Val Thr Val Ser Ser Gly

130 135 140

Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Asp Ile

145 150 155 160

Gln Met Thr Gln Thr Thr Ser Ser Leu Ser Ala Ser Leu Gly Asp Arg

165 170 175

Val Thr Ile Ser Cys Arg Ala Ser Gln Asp Ile Ser Lys Tyr Leu Asn

180 185 190

Trp Tyr Gln Gln Lys Pro Asp Gly Thr Val Lys Leu Leu Ile Tyr His

195 200 205

Thr Ser Arg Leu His Ser Gly Val Pro Ser Arg Phe Ser Gly Ser Gly

210 215 220

Ser Gly Thr Asp Tyr Ser Leu Thr Ile Ser Asn Leu Glu Gln Glu Asp

225 230 235 240

Ile Ala Thr Tyr Phe Cys Gln Gln Gly Asn Thr Leu Pro Tyr Thr Phe

245 250 255

Gly Gly Gly Thr Lys Leu Glu Ile Thr Gly Gly Gly Gly Ser Pro Thr

260 265 270

His Leu Pro Tyr Val Ser Glu Met Leu Glu Ala Arg Thr Ala Gly His

275 280 285

Met Gln Thr Leu Ala Asp Phe Arg Gln Leu Pro Ala Arg Thr Leu Ser

290 295 300

Thr His Trp Pro Pro Gln Arg Ser Leu Gly Ser Ser Asp Phe Ile Arg

305 310 315 320

Ile Leu Val Ile Phe Ser Gly Met Phe Leu Val Phe Thr Leu Ala Gly

325 330 335

Ala Leu Phe Leu His Gln Ser Val Val Lys Arg Gly Arg Lys Lys Leu

340 345 350

Leu Tyr Ile Phe Lys Gln Pro Phe Met Arg Pro Val Gln Thr Thr Gln

355 360 365

Glu Glu Asp Gly Cys Ser Cys Arg Phe Pro Glu Glu Glu Glu Gly Gly

370 375 380

Cys Glu Leu Arg Val Lys Phe Ser Arg Ser Ala Asp Ala Pro Ala Tyr

385 390 395 400

Gln Gln Gly Gln Asn Gln Leu Tyr Asn Glu Leu Asn Leu Gly Arg Arg

405 410 415

Glu Glu Tyr Asp Val Leu Asp Lys Arg Arg Gly Arg Asp Pro Glu Met

420 425 430

Gly Gly Lys Pro Arg Arg Lys Asn Pro Gln Glu Gly Leu Tyr Asn Glu

435 440 445

Leu Gln Lys Asp Lys Met Ala Glu Ala Tyr Ser Glu Ile Gly Met Lys

450 455 460

Gly Glu Arg Arg Arg Gly Lys Gly His Asp Gly Leu Tyr Gln Gly Leu

465 470 475 480

Ser Thr Ala Thr Lys Asp Thr Tyr Asp Ala Leu His Met Gln Ala Leu

485 490 495

Pro Pro Arg Glu Gly Arg Gly Ser Leu Leu Thr Cys Gly Asp Val Glu

500 505 510

Glu Asn Pro Gly Pro Met Ala Cys Gly Ala Asp Ser Tyr Glu Met Glu

515 520 525

Glu Asp Gly Val Arg Lys Cys Lys Lys Cys Glu Gly Pro Cys Arg Lys

530 535 540

Val Cys Asn Gly Ile Gly Ile Gly Glu Phe Lys Asp Ser Leu Ser Ile

545 550 555 560

Asn Ala Thr Asn Ile Lys His Phe Lys Asn Cys Thr Ser Ile Ser Gly

565 570 575

Asp Leu His Ile Leu Pro Val Ala Phe Arg Gly Asp Ser Phe Thr His

580 585 590

Thr Pro Pro Leu Asp Pro Gln Glu Leu Asp Ile Leu Lys Thr Val Lys

595 600 605

Glu Ile Thr Gly Phe Leu Leu Ile Gln Ala Trp Pro Glu Asn Arg Thr

610 615 620

Asp Leu His Ala Phe Glu Asn Leu Glu Ile Ile Arg Gly Arg Thr Lys

625 630 635 640

Gln His Gly Gln Phe Ser Leu Ala Val Val Ser Leu Asn Ile Thr Ser

645 650 655

Leu Gly Leu Arg Ser Leu Lys Glu Ile Ser Asp Gly Asp Val Ile Ile

660 665 670

Ser Gly Asn Lys Asn Leu Cys Tyr Ala Asn Thr Ile Asn Trp Lys Lys

675 680 685

Leu Phe Gly Thr Ser Gly Gln Lys Thr Lys Ile Ile Ser Asn Arg Gly

690 695 700

Glu Asn Ser Cys Lys Ala Thr Gly Gln Val Cys His Ala Leu Cys Ser

705 710 715 720

Pro Glu Gly Cys Trp Gly Pro Glu Pro Arg Asp Cys Val Ser Cys Arg

725 730 735

Asn Val Ser Arg Gly Arg Glu Cys Val Asp Lys Cys Asn Leu Leu Glu

740 745 750

Gly Glu Pro Arg Glu Phe Val Glu Asn Ser Glu Cys Ile Gln Cys His

755 760 765

Pro Glu Cys Leu Pro Gln Ala Met Asn Ile Thr Cys Thr Gly Arg Gly

770 775 780

Pro Asp Asn Cys Ile Gln Cys Ala His Tyr Ile Asp Gly Pro His Cys

785 790 795 800

Val Lys Thr Cys Pro Ala Gly Val Met Gly Glu Asn Asn Thr Leu Val

805 810 815

Trp Lys Tyr Ala Asp Ala Gly His Val Cys His Leu Cys His Pro Asn

820 825 830

Cys Thr Tyr Gly Cys Thr Gly Pro Gly Leu Glu Gly Cys Pro Thr Asn

835 840 845

Gly Pro Lys Ile Pro Ser Ile Ala Thr Gly Met Val Gly Ala Leu Leu

850 855 860

Leu Leu Leu Val Val Ala Leu Gly Ile Gly Leu Phe Met Arg Arg Arg

865 870 875 880

His Ile Val

<210> 8

<211> 2655

<212> DNA

<213> Artificial Sequence

<400> 8

atgctgttgc tcgtgacgtc cctgcttctt tgcgaacttc ctcacccagc cttccttttg 60

atccccgaag aagttaagct tcaagagtcc ggcccagggt tggttgcccc cagccaatca 120

ttgtctgtga catgcacggt ctcaggagtt tccttgccag actatggtgt ctcatggata 180

cgacaacccc cacgcaaagg cctggaatgg ctcggtgtta tctgggggag tgagactact 240

tactacaact ctgccttgaa atcccgcttg actattatca aagataattc taaatcacag 300

gttttcctta agatgaacag tttgcagacc gatgacaccg ccatatatta ctgtgcaaag 360

cattattact acgggggttc atatgctatg gactactggg gacagggtac cagcgtgact 420

gtttctagcg gaggtggagg aagcggcggt gggggtagtg ggggaggtgg gagtgatatt 480

caaatgaccc agaccacatc atcactgagt gcgtccctcg gtgaccgggt taccatcagc 540

tgccgggcat ctcaggacat tagcaaatac ctgaactggt atcaacaaaa gcccgacgga 600

actgtaaaac tcctgattta tcataccagt aggttgcatt ctggcgtgcc ttcacggttt 660

agtgggtcag gctcagggac cgattatagt ctgacaatta gtaacttgga acaggaggac 720

atagcaacct acttttgtca acaagggaat accttgccat atacattcgg cggtgggaca 780

aagcttgaaa tcactggtgg cggtggctcc cctacccacc tcccctacgt ttcagagatg 840

ctggaggcga gaactgcagg tcatatgcag acacttgcag attttcgaca acttcctgcg 900

cggactttgt ccacacactg gcccccacaa cgctctctcg ggtccagtga ctttattcga 960

atactggtca tattttcagg aatgtttctg gtatttacct tggctggagc attgtttctc 1020

catcaatccg tcgttaaaag gggccgcaaa aaattgctct acatattcaa gcaacctttt 1080

atgcgccctg tccagacgac acaagaggaa gacgggtgca gctgcagatt tcccgaagaa 1140

gaggaggggg gttgcgagct ccgagtaaag ttctcaagaa gcgcagatgc tccggcttat 1200

caacaaggtc aaaaccagtt gtacaacgaa ttgaaccttg ggaggcggga ggaatatgat 1260

gttctcgata agcggcgcgg gagagaccca gaaatggggg gaaagccgcg gcgcaagaac 1320

ccacaggaag gcttgtacaa tgaattgcag aaagataaaa tggccgaggc atattccgaa 1380

attgggatga agggtgagcg gcgcaggggg aagggacacg atggattgta tcaagggctc 1440

agcaccgcta caaaagacac ctacgacgcc ctgcatatgc aagcacttcc tcctagagag 1500

ggcagaggca gcctgctgac ctgcggcgac gtggaggaga accccggccc catggcctgt 1560

ggggccgaca gctatgagat ggaggaagac ggcgtccgca agtgtaagaa gtgcgaaggg 1620

ccttgccgca aagtgtgtaa cggaataggt attggtgaat ttaaagactc actctccata 1680

aatgctacga atattaaaca cttcaaaaac tgcacctcca tcagtggcga tctccacatc 1740

ctgccggtgg catttagggg tgactccttc acacatactc ctcctctgga tccacaggaa 1800

ctggatattc tgaaaaccgt aaaggaaatc acagggtttt tgctgattca ggcttggcct 1860

gaaaacagga cggacctcca tgcctttgag aacctagaaa tcatacgcgg caggaccaag 1920

caacatggtc agttttctct tgcagtcgtc agcctgaaca taacatcctt gggattacgc 1980

tccctcaagg agataagtga tggagatgtg ataatttcag gaaacaaaaa tttgtgctat 2040

gcaaatacaa taaactggaa aaaactgttt gggacctccg gtcagaaaac caaaattata 2100

agcaacagag gtgaaaacag ctgcaaggcc acaggccagg tctgccatgc cttgtgctcc 2160

cccgagggct gctggggccc ggagcccagg gactgcgtct cttgccggaa tgtcagccga 2220

ggcagggaat gcgtggacaa gtgcaacctt ctggagggtg agccaaggga gtttgtggag 2280

aactctgagt gcatacagtg ccacccagag tgcctgcctc aggccatgaa catcacctgc 2340

acaggacggg gaccagacaa ctgtatccag tgtgcccact acattgacgg cccccactgc 2400

gtcaagacct gcccggcagg agtcatggga gaaaacaaca ccctggtctg gaagtacgca 2460

gacgccggcc atgtgtgcca cctgtgccat ccaaactgca cctacggatg cactgggcca 2520

ggtcttgaag gctgtccaac gaatgggcct aagatcccgt ccatcgccac tgggatggtg 2580

ggggccctcc tcttgctgct ggtggtggcc ctggggatcg gcctcttcat gcgaaggcgc 2640

cacatcgttt gataa 2655

<210> 9

<211> 4869

<212> DNA

<213> Artificial Sequence

<400> 9

atggcaccca agaaaaagcg taaggtgggg atccacggcg ttccagcggc tgataaaaaa 60

tattctatcg gtctggacat tggaacaaat tctgtcggtt gggcagtaat tacggatgaa 120

tataaagttc ctagcaaaaa gtttaaggta ttaggcaaca ccgatcgtca ctcaatcaag 180

aaaaacctga ttggcgcgtt actgttcgac agtggtgaaa ctgcagaggc cacccgcctt 240

aagcgtactg ctcgccgccg ctatactcgt cgtaagaatc gcatttgcta tcttcaggag 300

atcttctcta acgaaatggc gaaggttgac gattcttttt tccaccgctt agaagaatct 360

ttcctggtcg aggaggacaa gaagcatgaa cgccatccga tcttcggcaa cattgtcgat 420

gaagtcgcat atcacgaaaa gtatccaacc atctaccact tgcgtaagaa actggtcgac 480

tcaactgata aagccgactt gcgccttatc taccttgctc ttgcccatat gattaaattt 540

cgtggtcact ttttaattga aggagacctt aacccggaca attctgacgt tgacaagttg 600

ttcatccagc ttgtgcagac ctataaccaa ttattcgagg aaaacccgat caacgcttcc 660

ggagtggacg cgaaggctat tctttccgct cgtcttagta aatctcgccg cctggagaac 720

ctgattgcac aattgcctgg tgagaagaag aatggccttt tcggcaactt gattgcgtta 780

agcttaggcc tgacaccaaa ttttaagtcc aatttcgatt tggcagaaga cgctaagctg 840

caattaagca aagatactta tgacgatgat ttagataatt tgctggctca gattggcgac 900

cagtacgcgg accttttcct tgcggcgaag aatcttagtg acgctatcct gctttctgat 960

atcctgcgcg ttaatactga gatcacgaag gcgccgctta gtgcaagtat gattaagcgc 1020

tacgacgagc atcatcagga ccttacatta cttaaagcat tggttcgcca acaattaccg 1080

gaaaaataca aagagatctt tttcgatcag tcgaagaacg gttacgcagg atacatcgat 1140

ggcggggcat cccaagagga gttttataaa ttcatcaagc ctattttaga gaaaatggac 1200

ggtactgagg agctgctggt aaaactgaat cgtgaagact tacttcgcaa gcaacgcaca 1260

tttgacaatg gatcgatccc ccaccagatt cacttgggcg aattgcacgc gatccttcgt 1320

cgtcaggagg acttctaccc cttcttaaaa gacaaccgtg agaagattga gaaaattttg 1380

accttccgca ttccctacta tgtcggacct ctggcacgcg gaaactctcg ctttgcttgg 1440

atgacccgca aatcagagga gacgattacc ccatggaact ttgaggaggt tgtcgacaag 1500

ggagcctccg cgcaaagctt tattgagcgt atgactaact tcgataaaaa tcttcccaac 1560

gaaaaggtgt tgcccaagca ttcccttctg tatgaatact tcaccgttta taacgaatta 1620

acgaaggtaa agtacgtaac agaggggatg cgcaaacccg ccttccttag cggtgaacag 1680

aagaaagcca ttgttgacct gttattcaag actaaccgta aagtaacggt aaagcaactt 1740

aaagaggact atttcaagaa aattgagtgc tttgacagcg tggagatttc gggtgtggag 1800

gaccgcttca acgcttcgct tggtacgtat cacgatttgt tgaagattat taaagacaaa 1860

gatttcttag ataatgagga aaatgaggac attttagagg acatcgtctt gacactgacg 1920

ctgttcgagg accgcgagat gatcgaagaa cgtcttaaga cttatgctca cttgtttgat 1980

gataaagtca tgaaacagtt gaagcgtcgc cgctatacgg gctggggtcg cctttcccgt 2040

aaattaatta acgggattcg tgataaacag tctggcaaga caattctgga ttttttgaag 2100

tcggacgggt tcgcgaatcg taattttatg caactgatcc acgacgactc tctgactttc 2160

aaggaagata ttcagaaagc tcaggtgtcg ggccaaggtg acagtttgca cgaacatatt 2220

gctaaccttg ccggttctcc tgctatcaaa aaaggtatcc ttcagacagt caaggtcgtc 2280

gacgaattag taaaggtaat ggggcgccat aaacctgaga acatcgtcat cgagatggca 2340

cgtgagaatc aaaccacaca gaaggggcaa aagaactccc gtgaacgtat gaagcgtatt 2400

gaagagggga ttaaagagtt gggctcccag attcttaaag agcacccggt cgagaatacc 2460

caactgcaaa acgaaaaatt atacctttat tatttgcaga atggacgcga tatgtatgtg 2520

gatcaagagt tagatattaa tcgtctgtca gactacgacg tcgaccacat cgttccgcaa 2580

tcattcttaa aggatgactc tatcgataac aaggtcttga ctcgttctga taagaatcgc 2640

ggaaagtccg acaacgttcc atcagaggag gtcgtcaaga aaatgaagaa ttattggcgt 2700

cagcttttga atgccaaact gattacacaa cgcaaatttg acaaccttac aaaggcggaa 2760

cgtggtggac tttccgaatt ggataaggcg ggctttatta agcgccaact ggttgaaacc 2820

cgccagatca ccaaacatgt ggcccaaatt ttggactccc gtatgaatac caagtacgat 2880

gagaatgata agcttattcg tgaggttaag gtcattactc ttaaatcaaa gttggtcagt 2940

gattttcgca aggactttca gttctacaaa gtccgcgaga tcaataacta ccatcatgcg 3000

cacgacgctt atttaaacgc cgtagtagga acggccctga ttaaaaaata cccaaaactt 3060

gagagcgagt ttgtgtatgg ggactataag gtttacgacg ttcgtaaaat gatcgccaaa 3120

tctgagcaag aaatcggcaa agcaactgcc aaatatttct tttacagtaa catcatgaat 3180

tttttcaaga cagaaatcac attggccaat ggggagattc gtaaacgtcc tttaattgag 3240

accaacggcg agactggcga gattgtatgg gataagggac gtgactttgc gacagtgcgc 3300

aaagtcttat ccatgccaca ggtgaacatc gtgaagaaaa ccgaggtgca aactggtggc 3360

ttctctaagg aatcaatcct gccaaagcgt aatagtgata aacttattgc tcgcaaaaag 3420

gactgggacc cgaaaaagta cggtggattc gactcaccta cagtcgcata ctcggttctt 3480

gtcgtcgcaa aagtcgagaa agggaaatca aaaaagttaa agtcggttaa ggagcttctt 3540

gggatcacaa tcatggagcg ctcaagtttt gagaagaatc ctattgattt tttggaagca 3600

aaagggtata aagaggtaaa aaaggactta atcattaaat tgcccaaata cagtcttttt 3660

gaacttgaaa acgggcgtaa gcgtatgctt gcgagcgcgg gcgagctgca aaagggtaat 3720

gaattagcac tgccatcgaa atacgtcaac ttcttatacc tggcctcaca ttacgagaaa 3780

cttaaaggat ccccggagga taacgaacaa aagcaactgt ttgtagagca gcataagcac 3840

tatctggatg aaattatcga acaaatcagc gagttcagca aacgtgtgat cttggcggac 3900

gctaaccttg acaaggtact gagtgcctat aacaaacatc gtgacaagcc cattcgtgaa 3960

caggccgaaa acattatcca ccttttcact ctgacgaact tgggagcgcc ggccgcattt 4020

aagtactttg acactacgat cgatcgcaag cgctatacat ccactaagga ggtattggac 4080

gcgaccctta tccatcaaag cattacggga ctttacgaga cacgtatcga cctttcacaa 4140

ttaggaggag ataaacgtcc agccgcgacc aaaaaagcag gccaggccaa gaagaaaaag 4200

gaatttgggt ctggagaggg acgtggctcc ttgcttacgt gcggtgatgt cgaggaaaac 4260

ccgggaccta tgaccgaata caagcccacc gtacgcttag ccacccgcga cgacgttcca 4320

cgcgcagtgc gcacgttagc tgcagcattc gcagactatc ccgcaactcg tcacactgtt 4380

gaccccgatc gccatattga gcgtgtaacc gaacttcagg agttattttt gacgcgtgta 4440

ggtttagata ttggaaaggt gtgggtagca gatgatggcg cggcggtggc agtgtggacc 4500

acaccggagt cagtggaggc aggtgccgtg tttgcagaga tcgggcctcg tatggccgaa 4560

ttatccggct cgcgtttagc tgcccaacag caaatggaag gacttttagc cccacaccgt 4620

cctaaggaac cagcctggtt tttagcgact gtgggtgtct cccccgatca ccaaggaaag 4680

gggctgggaa gcgccgttgt tttacccggt gtagaagcgg cagagcgtgc aggagtacct 4740

gcgtttctgg aaacgtcagc tcctcgtaat ttacccttct atgagcgcct tggctttaca 4800

gttacagcag acgtcgaggt tcccgaaggc cctcgcacat ggtgtatgac ccgtaagccc 4860

ggagcttga 4869

<210> 10

<211> 98

<212> DNA

<213> Artificial Sequence

<400> 10

gcggagagct tcgtgctaaa cgttttagag ctagaaatag caagttaaaa taaggctagt 60

ccgttatcaa cttgaaaaag tggcaccgag tcggtgct 98

<210> 11

<211> 98

<212> DNA

<213> Artificial Sequence

<400> 11

ggtgcggcaa cctacatgat ggttttagag ctagaaatag caagttaaaa taaggctagt 60

ccgttatcaa cttgaaaaag tggcaccgag tcggtgct 98

<210> 12

<211> 100

<212> DNA

<213> Artificial Sequence

<400> 12

aacgccacct tcacctgcag cttctccaac acatcggaga gcttcgtgtg ataatggtac 60

cgcatgagcc ccagcaacca gacggacaag ctggccgctt 100

<210> 13

<211> 99

<212> DNA

<213> Artificial Sequence

<400> 13

caggctgaca gccaggtgac tgaagtctgt gcggcaacct acatgtgata aaatgagttg 60

accttcctag atgattccat ctgcacgggc acctccagt 99

<210> 14

<211> 21

<212> DNA

<213> Artificial Sequence

<400> 14

ttcctcacct ctctccatct c 21

<210> 15

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 15

ctctctttga tctgcgcctt 20

<210> 16

<211> 22

<212> DNA

<213> Artificial Sequence

<400> 16

tgagttcact gagttccctt tg 22

<210> 17

<211> 23

<212> DNA

<213> Artificial Sequence

<400> 17

gaaatggctt tgctcaccaa tta 23

Claims

A kind of 1. acceptor of targeting CD19 antigens, it is characterised in that：Its amino acid sequence such as SEQ ID NO:Shown in 7.
A kind of 2. gene for encoding the targeting CD19 antigen receptors described in claim 1, it is characterised in that：Its nucleotide sequence is such as SEQ ID NO:Shown in 8.
A kind of 3. recombinant slow virus expression vector II, it is characterised in that：It includes the coding targeting CD19 described in claim 2 The gene of antigen receptor.
A kind of 4. transgenic T cells of targeting CD19 antigens, it is characterised in that：To include the recombinant lentiviral described in claim 3 Virus expression carrier II and knocked out the initial cell of PD1 genes or/and CTLA4 genes, or integrate and have the right in chromosome It is required that the coding described in 2 targets the gene of CD19 antigen receptors and has knocked out the primary fine of PD1 genes or/and CTLA4 genes Born of the same parents, the initial cell are CD4+T cells or CD8+T cells.
5. the preparation method of the transgenic T cells of the targeting CD19 antigens described in claim 4, it is characterised in that：Including following Step：

(1) the slow-virus infection CD4+T cells of recombinant slow virus expression vector II or CD8+T cells, obtain restructuring T cell；

(2) gRNA, CRISPR-cas9mRNA, HDR are mixed, and electricity turns restructuring T cell, and the transgenosis T for producing targeting CD19 antigens is thin Born of the same parents；The gRNA be targeting PD1 genes gRNA or target CTLA4 genes gRNA, the HDR be PD1 genes HDR or The HDR of CTLA4 genes.
6. preparation method according to claim 5, it is characterised in that：The CRISPR-cas9mRNA, its nucleotide sequence Such as SEQ ID NO：Shown in 9；

The gRNA of the targeting PD1 genes, its nucleotide sequence such as SEQ ID NO：Shown in 10；

The gRNA of the targeting CTLA4 genes, its nucleotide sequence such as SEQ ID NO：Shown in 11；

The HDR of the PD1 genes, its nucleotide sequence such as SEQ ID NO：Shown in 12；

The HDR of the CTLA4 genes, its nucleotide sequence such as SEQ ID NO：Shown in 13.
A kind of 7. transgenic T cells of targeting CD19 antigens, it is characterised in that：To include recombinant slow virus expression vector I, power Profit requires the initial cell of the recombinant slow virus expression vector II described in 3, or coding targeting PSA-NCAM is integrated with chromosome The initial cell of the gene of coding targeting CD19 antigen receptors described in the gene of acceptor, claim 2, the initial cell are CD4+T cells or CD8+T cells；

The gene of the coding targeting PSA-NCAM acceptors, its nucleotide sequence such as SEQ ID NO:Shown in 2；

The recombinant slow virus expression vector I, it includes the gene of coding targeting PSA-NCAM acceptors, and targeting PD1 bases The shRNA of the cause or/and shRNA for targetting CTLA4 genes.
8. the transgenic T cells of targeting CD19 antigens according to claim 7, it is characterised in that：The targeting PD1 genes ShRNA, including positive-sense strand and antisense strand, the nucleotide sequence of positive-sense strand is as shown in sequence table SEQ NO.3, the core of antisense strand Nucleotide sequence is as shown in sequence table SEQ NO.4；

The shRNA of the targeting CTLA4 genes, including positive-sense strand and antisense strand, the nucleotide sequence such as sequence table SEQ of positive-sense strand Shown in NO.5, the nucleotide sequence of antisense strand is as shown in sequence table SEQ NO.6.
9. the preparation method of the transgenic T cells of the targeting CD19 antigens described in claim 7 or 8, it is characterised in that：Use two Take turns slow-virus infection CD4+T cells or CD8+T cells, first round infection recombinant slow virus expression vector I, the second wheel infection restructuring Lentiviral II；After two-wheeled infection, the transgenic T cells of targeting CD19 antigens are produced.
10. the transgenic T cells of the targeting CD19 antigens described in claim 4 or 7 are preparing treatment malignant B cell lymthoma Application in medicine.