CN107722113A

CN107722113A - Latex of panama rubber tree expresses acylCoAbinding protein HbACBP1 and HbACBP2 and application

Info

Publication number: CN107722113A
Application number: CN201710957670.6A
Authority: CN
Inventors: 曾日中; 聂智毅; 王艺航; 黎瑜; 康桂娟; 覃怀德
Original assignee: Rubber Research Institute Chinese Academy Tropical Agricultural Sciences
Current assignee: Rubber Research Institute Chinese Academy Tropical Agricultural Sciences
Priority date: 2017-10-12
Filing date: 2017-10-12
Publication date: 2018-02-23
Anticipated expiration: 2037-10-12
Also published as: CN107722113B

Abstract

The invention discloses a kind of latex of panama rubber tree expression acylCoAbinding protein HbACBP1 and HbACBP2 and application.The amino acid sequence of 2 albumen is respectively as shown in SEQ ID NO.3 and SEQ ID NO.6.The invention also discloses a kind of gene for encoding above-mentioned albumen, its nucleotide sequence is respectively as shown in SEQ ID NO.1 and SEQ ID NO.4.The invention also discloses a kind of application of said gene in elastomer gum milk production is improved.The present invention is stimulated using rubber tapping, ethephon (CEPHA),2-(chloroethyl) phosphonic acid and jasmonic and is remarkably improved the expression of HbACBP1 and HbACBP2 in latex of panama rubber tree, and with latex yield be in notable positive correlation, there is larger economic value and application prospect in rubber tree breed improvement and genetic engineering field.

Description

Latex of panama rubber tree express acylCoAbinding protein HbACBP1 and HbACBP2 and Using

Technical field

The invention belongs to genetic engineering field, specifically, is related to a kind of latex of panama rubber tree expression acyl-CoA combination egg White HbACBP1 and HbACBP2 and application.

Background technology

Lipid material grows and adapted to play a significant role in external environment in plant, and its metabolic process needs acyl The participation of base load body protein, one type acyl carrier protein are acyl-CoA (CoA) associated proteins (Acyl-CoA- Binding Protein, abbreviation ACBP).ACBP family proteins are prevalent in protokaryon and eukaryotic cells, and its is common It is characterized in containing 1 highly conserved acyl-CoA binding structural domain (Acyl-CoA-binding domain, abbreviation ACBD), Also ankyrin repeats and kelch motif with mediating protein interaction etc. is repeated few members in addition to containing ACBD Sequence.According to these design features, ACBP family proteins can be divided into four major classes, they have different domain compositions, Asia Cellular localization and biological function etc..

Plant ACBP albumen is mainly by adjusting the cells such as aliphatic acid, acyl-CoA storehouse, fatty acid beta oxidation and vesicle transport The metabolic activity of interior Various Complex, participate in the physiology courses such as growth and development of plants, stress response and film reparation.At present, from wood Separated in the plants such as potato, castor-oil plant, rape, rice, arabidopsis, willow and apple and identify ACBP, and most important production in the world ACBP genes in glue plant Para rubber tree (Hevea brasiliensis) are not also identified and studied so far.

The content of the invention

In view of this, the invention provides a kind of latex of panama rubber tree expression acylCoAbinding protein HbACBP1 and HbACBP2 and application.

In order to solve the above-mentioned technical problem, the invention discloses a kind of latex of panama rubber tree to express acylCoAbinding protein HbACBP1 and HbACBP2, its amino acid sequence is respectively as shown in SEQ ID NO.3 and SEQ ID NO.6.

Above-mentioned latex of panama rubber tree expression acylCoAbinding protein gene is encoded the invention also discloses a kind of HbACBP1 and HbACBP2.

Further, its nucleotide sequence is respectively as shown in SEQ ID NO.1 and SEQ ID NO.4.

The invention also discloses a kind of recombinant expression carrier containing above-mentioned gene.

The invention also discloses a kind of transgenosis recombinant bacterium containing above-mentioned gene.

The invention also discloses one kind coding latex of panama rubber tree expression acylCoAbinding protein gene HbACBP1 and HbACBP2 cloning process, the primer that the HbACBP1 genes use are as follows：HbACBP1 forward primers： TTCTCGACCAACTTCTAAGT, its nucleotide sequence is as shown in SEQ ID NO.7；Reverse primer： GTTTTATTTCAATAAATAATTGACTAGG, its nucleotide sequence is as shown in SEQ ID NO.8；The HbACBP2 genes are adopted Primer is as follows：HbACBP2 forward primers：CCCCCGAGGCGCAAATCAATC, its nucleotide sequence such as SEQ ID NO.9 It is shown；Reverse primer：GGGAACTTCGGCCTCAATTCG, its nucleotide sequence is as shown in SEQ ID NO.10.

The invention also discloses a kind of application of said gene in elastomer gum milk production is improved.

Compared with prior art, the present invention can be obtained including following technique effect：

1) present invention is found that HbACBP1 and HbACBP1 genes in rubber tree produces cellula adhesiae first.HbACBP1 genes CDNA total lengths be 707bp, CDS sequence 279bp, encode the albumen of 92 amino acid.The cDNA total lengths of HbACBP2 genes are 1215bp, CDS sequence 855bp, encode the albumen of 285 amino acid.

2) present invention is predicted with CDD, PFAM, SMART and Interproscan software analysis, HbACBP1 and HbACBP2 There are ACBD conserved domains, but they have different Subcellular Localization modes, and HbACBP1 is soluble protein, is positioned at In cell liquid, and HbACBP2 has membrane spaning domain, is an embrane-associated protein.

3) present invention is stimulated using rubber tapping, ethephon (CEPHA),2-(chloroethyl) phosphonic acid and jasmonic and is remarkably improved HbACBP1 and HbACBP2 in rubber Expression in gummy breast, and be in notable positive correlation with latex yield, have in rubber tree breed improvement and genetic engineering field There are larger economic value and application prospect.

Certainly, any product for implementing the present invention it is not absolutely required to reach all the above technique effect simultaneously.

Brief description of the drawings

Accompanying drawing described herein is used for providing a further understanding of the present invention, forms the part of the present invention, this hair Bright schematic description and description is used to explain the present invention, does not form inappropriate limitation of the present invention.In the accompanying drawings：

Fig. 1 is latex of panama rubber tree expression HbACBP1 and HbACBP2 of the present invention protein domain schematic diagram；

Fig. 2 is the tissue-specific expression pattern of rubber tree HbACBP genes of the present invention；

Fig. 3 is facilitation of the present invention rubber tapping to latex of panama rubber tree HbACBP1 and HbACBP2 gene expression；

Fig. 4 is ethephon (CEPHA),2-(chloroethyl) phosphonic acid of the present invention (ET) and jasmonic (JA) to latex of panama rubber tree HbACBP1 and HbACBP2 gene table The facilitation reached；

Fig. 5 is latex of panama rubber tree expression HbACBP1 and HbACBP2 of the present invention Subcellular Localization；Wherein, A-D, HbACBP1-GFP fusion protein；E-I, co-transfection of HbACBP2-GFP fusion protein and ER marker；J-M, GFP control.A,F,J,transient expression of GFP；B,G,K, chloroplast autofluerescence；C,H,L,visible light；D,I,M,merged images；E,ER Marker.Scale bar=10 μm.

Embodiment

Describe embodiments of the present invention in detail below in conjunction with embodiment, thereby to the present invention how application technology hand Section can fully understand and implement according to this to solve technical problem and reach the implementation process of technical effect.

The rubber tree duct cell of embodiment 1 expresses the clone of HbACBP1 and HbACBP2 genes

First, rubber tree genome database is searched for for probe using the conservative ACB sequences of arabidopsis ACBP albumen, there are To the rubber tree ACBP genes of 6 domains containing ACB, including HbACBP1 and HbACBP2.Then, according to HbACBP1 and HbACBP2 cDNA sequence design primer, clone HbACBP1 and HbACBP2 total length respectively from the latex of rubber tree CDNA sequence, and carry out cloning weight sequence verification, finally obtain the HbACBP1 and HbACBP2 of latex of panama rubber tree expression total length CDNA sequence.HbACBP1 and HbACBP2 cloning primers and RT-PCR amplification procedures are simply as follows：

(1) cloning primer sequence

HbACBP1 forward primers：TTCTCGACCAACTTCTAAGT, its nucleotide sequence is as shown in SEQ ID NO.7；Instead To primer：GTTTTATTTCAATAAATAATTGACTAGG, its nucleotide sequence is as shown in SEQ ID NO.8；

HbACBP2 forward primers：CCCCCGAGGCGCAAATCAATC, its nucleotide sequence is as shown in SEQ ID NO.9； Reverse primer：GGGAACTTCGGCCTCAATTCG, its nucleotide sequence is as shown in SEQ ID NO.10.

(2) HbACBP1 and HbACBP2 gene clonings and sequence analysis

Latex of panama rubber tree total serum IgE is extracted, is made the reverse transcription of latex total serum IgE into cDNA with kit PrimerScript RT Template, RT-PCR amplifications are carried out with above-mentioned HbACBP1 and HbACBP2 cloning primers respectively, and amplified production is subcloned to survey In sequence carrier, screening positive clone is sequenced, the final full-length cDNA sequence for obtaining HbACBP1 and HbACBP2, respectively such as Shown in SEQ ID NO.1 and SEQ ID NO.4；HbACBP1 and HbACBP2 CDS sequences are respectively such as SEQ ID NO.2 and SEQ Shown in ID NO.5.

Analysis of biological information shows that HbACBP1 and HbACBP2 have 1 ACB conserved domain, in addition, HbACBP2 is also Containing 1 Ankyrin repetitive sequence, their protein domain is as shown in figure 1, the amino of HbACBP1 and HbACBP2 albumen Acid sequence is respectively as shown in SEQ ID NO.3 and SEQ ID NO.6.

The rubber tree duct cell of embodiment 2 expression HbACBP1 and HbACBP2 identification and its function

Using the conservative ACBD sequence searches rubber tree genome database of arabidopsis ACBP albumen, 6 rubber are obtained The ACBP genes of tree, are respectively designated as HbACBP1-HbACBP6.Fluorescence quantitative RT-RCR analysis shows, 6 of rubber tree In ACBP genes, only HbACBP1 and the HbACBP2 expression with higher level in duct cell is latex, and remaining 4 Expression of the ACBP genes in latex is extremely low (Fig. 2), therefore, physiological action is played in rubber tree duct cell ACBP family members are mainly HbACBP1 and HbACBP2.

The fluorescence quantitative RT-RCR experimentation of latex of panama rubber tree HbACBP gene expressions is as follows：Agents useful for same is SYBR Premix Ex Taq ^TMII kits (Takara), PCR instrument be CFX96Real-Time System (Bio-Rad, Hercules,CA,USA).PCR expands the μ L of volume 20, and reaction condition is 95 DEG C of pre-degeneration 30s, and 95 DEG C of denaturation 10s, 58 DEG C are annealed 20s, 72 DEG C of extension 30s, totally 40 circulations.

Rubber tapping, ethephon (CEPHA),2-(chloroethyl) phosphonic acid (ET) and jasmonic (JA) stimulate the table to latex of panama rubber tree HbACBP1 and HbACBP2 gene Up to having significant inducing action (Fig. 3, Fig. 4), this shows that HbACBP1 and HbACBP2 stimulates with rubber tapping, ET and JA and promotes rubber Gummy breast metabolism and the increase of latex yield have close relationship, are played in rubber tree duct cell wounding signal pathway important Effect.

Embodiment 3HbACBP1 and HbACBP2 Subcellular Localization

Respectively by the CDS sequences of HbACBP1 and HbACBP2 genes and green fluorescent protein (green fluorescent Protein, GFP) it is connected, construction of expression vector, and arabidopsis thaliana transformation mesophyll protoplast carries out sub- fine positioning analysis.Such as Shown in Fig. 5, HbACBP1 is 1 soluble protein for being positioned at cell liquid, and HbACBP2 is the film knot being positioned in endoplasmic reticulum Hop protein.

Embodiment 4HbACBP1 and HbACBP2 application example

Under rubber tapping, ET and JA incentive conditions, the induced expression and rubber of latex of panama rubber tree HbACBP1 and HbACBP2 gene Gummy milk production increase shows, HbACBP1 and HbACBP2 play a significant role in latex of panama rubber tree metabolism, is and rubber tree The closely related critical function gene of latex yield.

Some preferred embodiments of invention have shown and described in described above, but as previously described, it should be understood that invention is not Form disclosed herein is confined to, is not to be taken as the exclusion to other embodiment, and available for various other combinations, modification And environment, and can be carried out in the scope of the invention is set forth herein by the technology or knowledge of above-mentioned teaching or association area Change., then all should be in power appended by invention and the change and change that those skilled in the art are carried out do not depart from the spirit and scope of invention In the protection domain that profit requires.

Sequence table

<110>Rubber Institute, Chinese Academy of Agricultural Science

<120>Latex of panama rubber tree expresses acylCoAbinding protein HbACBP1 and HbACBP2 and application

<130> 2017

<160> 10

<170> SIPOSequenceListing 1.0

<210> 1

<211> 707

<212> DNA

<213>Latex of panama rubber tree expression acylCoAbinding protein (Hevea brasiliensis Acyl-CoA-Binding Protein)

<400> 1

ttctcgacca acttctaagt gactaaccaa tcaatacaag ccacgtaaaa tagtacaaag 60

gaataaacct acgaatatct gagtgtttac atactagact tccttcctca ctctgcattg 120

taattaacta ccgctagctt cacgtctctg cattcattcc ttcatcaaat cacagagcaa 180

aatgggtttg aaggaggaat ttgaggagta tgctgagaaa gctaagaccc ttccagaaaa 240

tacaacaaat gagagcaaac ttattttata tgggctttat aagcaagcca ctgttggacc 300

agtgaacacc agccgtcctg gaatgtttaa catgagggac agagcaaagt gggatgcatg 360

gaaggctgtt gaaggcaaat caaaggaaca agcaatgagt gactatatca ctaaggtgaa 420

acagttgcag gaagaagctg ctgctgctgc ttctgcttag tgtcttgacc atgtgtgtgt 480

gcctgtaggt tccttgtgtt caaaataatt taaaaaataa taaattcaat aattatctgg 540

agtggtgtaa tgttgtttct atattttctg aattaaattc agacttgtac taaaatggat 600

tgaaattaat gtcatgatag tttcttaagt gtttgaaatt tgcatagtgc taaccaaaat 660

tccagccatt aactaggatc ctagtcaatt atttattgaa ataaaac 707

<210> 2

<211> 279

<212> DNA

<400> 2

atgggtttga aggaggaatt tgaggagtat gctgagaaag ctaagaccct tccagaaaat 60

acaacaaatg agagcaaact tattttatat gggctttata agcaagccac tgttggacca 120

gtgaacacca gccgtcctgg aatgtttaac atgagggaca gagcaaagtg ggatgcatgg 180

aaggctgttg aaggcaaatc aaaggaacaa gcaatgagtg actatatcac taaggtgaaa 240

cagttgcagg aagaagctgc tgctgctgct tctgcttag 279

<210> 3

<211> 92

<212> PRT

<400> 3

Met Gly Leu Lys Glu Glu Phe Glu Glu Tyr Ala Glu Lys Ala Lys Thr

1 5 10 15

Leu Pro Glu Asn Thr Thr Asn Glu Ser Lys Leu Ile Leu Tyr Gly Leu

20 25 30

Tyr Lys Gln Ala Thr Val Gly Pro Val Asn Thr Ser Arg Pro Gly Met

35 40 45

Phe Asn Met Arg Asp Arg Ala Lys Trp Asp Ala Trp Lys Ala Val Glu

50 55 60

Gly Lys Ser Lys Glu Gln Ala Met Ser Asp Tyr Ile Thr Lys Val Lys

65 70 75 80

Gln Leu Gln Glu Glu Ala Ala Ala Ala Ala Ser Ala

85 90

<210> 4

<211> 1215

<212> DNA

<400> 4

cccccgaggc gcaaatcaat ccccgacttt ggttcccgta gcgaggattt aactgccgct 60

gatttaaccg ccgtccacga cactgattct gtgatggctg agcacggtag cgtgaggaac 120

gagagcatag cgggtagtga tgttggtgat caagatattg atgatgatga tgacgatgat 180

gatgattggg agggcgtcga gagcaccgaa ctggacgaaa cgtttagtgc tgctaccgca 240

tttgtggcgg cggctgcagc ggatcggctt tctcagaagg tgtcgacgga tgtgcagttg 300

cagctttacg gcttgtacaa gattgccacc gaaggacctt gcagtactcc ccctccttcc 360

gccatcaaaa ttagtgctcg tgccaagtgg caagcatggc agaaactcgg tgctatgcct 420

ccagaggatg caatgcaaaa gtacattgat attgttacag aattatatcc ttcttgggct 480

tctggttcag ccatgaaaag gaaaggtgga gatggtgatg cacaaagtat ggatgccaaa 540

gggcccatgg gtccagtttt cagcacttat gtgtatgagg aggaatctgg aaatgaattg 600

aaaatggatg ccattcatgc ctttgccaga gaaggagatt tgaagaattt gctcaaatgt 660

atagagactg gtgtttctgc aaacctgaaa gatagtgagg gtcggacccc attgcactgg 720

gctgtagatc gtggccatct taacgtggtg gaagttcttg ttgaaaggaa ttctgatata 780

aatgcaaagg ataatgaagg ccaaacacct ttgcattatg ctgctgtctg tgagagagaa 840

gccattgcag aatttcttgt taagcaaaat gcagacgcca gtttgaaaga caatgatggc 900

aagtctgctc atgatctttg tgaattagac tggccttgcc tgcgggcata gcaacgtgga 960

catgctgata ttgtgttttg tggtttcttc ggcctagtcc ttgacaaaat ccccacggat 1020

gtatgtatag tatatggcta attatggccc ctccccccac tttttaaact tatatcttaa 1080

tgacaaaatt tgcattggga taaatcacct gtccagttca tatttaaaag actatgtctc 1140

tcatgtgggt tcatgactaa tgttggaaaa ttctagacat ggtttttgcc gaattgattt 1200

gaggccgaag ttccc 1215

<210> 5

<211> 858

<212> DNA

<400> 5

atggctgagc acggtagcgt gaggaacgag agcatagcgg gtagtgatgt tggtgatcaa 60

gatattgatg atgatgatga cgatgatgat gattgggagg gcgtcgagag caccgaactg 120

gacgaaacgt ttagtgctgc taccgcattt gtggcggcgg ctgcagcgga tcggctttct 180

cagaaggtgt cgacggatgt gcagttgcag ctttacggct tgtacaagat tgccaccgaa 240

ggaccttgca gtactccccc tccttccgcc atcaaaatta gtgctcgtgc caagtggcaa 300

gcatggcaga aactcggtgc tatgcctcca gaggatgcaa tgcaaaagta cattgatatt 360

gttacagaat tatatccttc ttgggcttct ggttcagcca tgaaaaggaa aggtggagat 420

ggtgatgcac aaagtatgga tgccaaaggg cccatgggtc cagttttcag cacttatgtg 480

tatgaggagg aatctggaaa tgaattgaaa atggatgcca ttcatgcctt tgccagagaa 540

ggagatttga agaatttgct caaatgtata gagactggtg tttctgcaaa cctgaaagat 600

agtgagggtc ggaccccatt gcactgggct gtagatcgtg gccatcttaa cgtggtggaa 660

gttcttgttg aaaggaattc tgatataaat gcaaaggata atgaaggcca aacacctttg 720

cattatgctg ctgtctgtga gagagaagcc attgcagaat ttcttgttaa gcaaaatgca 780

gacgccagtt tgaaagacaa tgatggcaag tctgctcatg atctttgtga attagactgg 840

ccttgcctgc gggcatag 858

<210> 6

<211> 285

<212> PRT

<400> 6

Met Ala Glu His Gly Ser Val Arg Asn Glu Ser Ile Ala Gly Ser Asp

1 5 10 15

Val Gly Asp Gln Asp Ile Asp Asp Asp Asp Asp Asp Asp Asp Asp Trp

20 25 30

Glu Gly Val Glu Ser Thr Glu Leu Asp Glu Thr Phe Ser Ala Ala Thr

35 40 45

Ala Phe Val Ala Ala Ala Ala Ala Asp Arg Leu Ser Gln Lys Val Ser

50 55 60

Thr Asp Val Gln Leu Gln Leu Tyr Gly Leu Tyr Lys Ile Ala Thr Glu

65 70 75 80

Gly Pro Cys Ser Thr Pro Pro Pro Ser Ala Ile Lys Ile Ser Ala Arg

85 90 95

Ala Lys Trp Gln Ala Trp Gln Lys Leu Gly Ala Met Pro Pro Glu Asp

100 105 110

Ala Met Gln Lys Tyr Ile Asp Ile Val Thr Glu Leu Tyr Pro Ser Trp

115 120 125

Ala Ser Gly Ser Ala Met Lys Arg Lys Gly Gly Asp Gly Asp Ala Gln

130 135 140

Ser Met Asp Ala Lys Gly Pro Met Gly Pro Val Phe Ser Thr Tyr Val

145 150 155 160

Tyr Glu Glu Glu Ser Gly Asn Glu Leu Lys Met Asp Ala Ile His Ala

165 170 175

Phe Ala Arg Glu Gly Asp Leu Lys Asn Leu Leu Lys Cys Ile Glu Thr

180 185 190

Gly Val Ser Ala Asn Leu Lys Asp Ser Glu Gly Arg Thr Pro Leu His

195 200 205

Trp Ala Val Asp Arg Gly His Leu Asn Val Val Glu Val Leu Val Glu

210 215 220

Arg Asn Ser Asp Ile Asn Ala Lys Asp Asn Glu Gly Gln Thr Pro Leu

225 230 235 240

His Tyr Ala Ala Val Cys Glu Arg Glu Ala Ile Ala Glu Phe Leu Val

245 250 255

Lys Gln Asn Ala Asp Ala Ser Leu Lys Asp Asn Asp Gly Lys Ser Ala

260 265 270

His Asp Leu Cys Glu Leu Asp Trp Pro Cys Leu Arg Ala

275 280 285

<210> 7

<211> 20

<212> DNA

<213>Artificial sequence (Artificial sequence)

<400> 7

ttctcgacca acttctaagt 20

<210> 8

<211> 28

<212> DNA

<213>Artificial sequence (Artificial sequence)

<400> 8

gttttatttc aataaataat tgactagg 28

<210> 9

<211> 21

<212> DNA

<213>Artificial sequence (Artificial sequence)

<400> 9

cccccgaggc gcaaatcaat c 21

<210> 10

<211> 21

<212> DNA

<213>Artificial sequence (Artificial sequence)

<400> 10

gggaacttcg gcctcaattc g 21

Claims

1. a kind of latex of panama rubber tree expression acylCoAbinding protein HbACBP1 and HbACBP2, it is characterised in that its amino acid Sequence is respectively as shown in SEQ ID NO.3 and SEQ ID NO.6.

2. encode the base of latex of panama rubber tree expression the acylCoAbinding protein HbACBP1 and HbACBP2 described in claim 1 Cause.

3. gene according to claim 2, it is characterised in that its nucleotide sequence is respectively such as SEQ ID NO.1 and SEQ Shown in ID NO.4.

4. the recombinant expression carrier containing the gene described in Claims 2 or 3.

5. the transgenosis recombinant bacterium containing the gene described in Claims 2 or 3.

6. a kind of cloning process for encoding latex of panama rubber tree expression acylCoAbinding protein gene HbACBP1 and HbACBP2, Characterized in that, the primer that the HbACBP1 genes use is as follows：HbACBP1 forward primers： TTCTCGACCAACTTCTAAGT, its nucleotide sequence is as shown in SEQ ID NO.7；Reverse primer： GTTTTATTTCAATAAATAATTGACTAGG, its nucleotide sequence is as shown in SEQ ID NO.8；The HbACBP2 genes are adopted Primer is as follows：HbACBP2 forward primers：CCCCCGAGGCGCAAATCAATC, its nucleotide sequence such as SEQ ID NO.9 It is shown；Reverse primer：GGGAACTTCGGCCTCAATTCG, its nucleotide sequence is as shown in SEQ ID NO.10.

7. application of the gene in elastomer gum milk production is improved described in Claims 2 or 3.