CN107686516B

CN107686516B - Periplaneta americana antibacterial peptide AMP-PA-10 and preparation method and application thereof

Info

Publication number: CN107686516B
Application number: CN201710544519.XA
Authority: CN
Inventors: 刘越飞; 耿福能; 岳碧松
Original assignee: Sichuan Gooddoctor Panxi Pharmaceutical Co ltd
Current assignee: Sichuan Gooddoctor Panxi Pharmaceutical Co ltd
Priority date: 2017-07-05
Filing date: 2017-07-05
Publication date: 2021-02-19
Anticipated expiration: 2037-07-05
Also published as: CN107686516A

Abstract

The invention provides periplaneta americana antibacterial peptide AMP-PA-10, wherein the amino acid sequence of the antibacterial peptide is SEQ ID No. 1; the nucleotide sequence of the gene for coding the antibacterial peptide AMP-PA-10 is SEQ ID No. 2. The invention also provides a preparation method of the antibacterial peptide, which comprises the following steps: (1) synthesizing an AMP-PA-10 gene of the antibacterial peptide; (2) constructing and identifying an expression vector of the antibacterial peptide AMP-PA-10; (3) constructing an antibacterial peptide AMP-PA-10 prokaryotic expression vector; (4) obtaining the antibacterial peptide AMP-PA-10. The antibacterial peptide AMP-PA-10 has an obvious antibacterial effect, particularly on staphylococcus aureus and salmonella; the antibacterial peptide AMP-PA-10 also has an inhibitory effect on pseudomonas aeruginosa. The antibacterial peptide AMP-PA-10 has high research and development values, and can be particularly applied to the fields of medicines, daily chemicals, foods or health care.

Description

Periplaneta americana antibacterial peptide AMP-PA-10 and preparation method and application thereof

Technical Field

The invention belongs to the field of genetic engineering, and particularly relates to periplaneta americana antibacterial peptide AMP-PA-10 as well as a preparation method and application thereof

Background

Cockroaches are a kind of winged insects with early differentiation, are widely distributed and have various species, about 4000 or more species in the world, but are really closely related to human habitation and are called sanitary insect pests, namely 30 species. Some species carry various pathogens such as pathogenic bacteria, mould, virus, parasitic ovum and protozoan cyst, and the like, and documents report that cockroaches can carry about 40 pathogens, propagate various human diseases through mechanical and biological properties, and form direct or indirect harm to human body health, meanwhile, excrement and sloughed epidermis are one of main indoor inhalation allergens, and allergic diseases such as asthma, allergic rhinitis and the like can be induced. In the past, studies on the use of the sickle have been focused mainly on the control of pests, but these insects have been able to adapt to severe environmental conditions, have a possibility of developing a unique defense system, and produce highly active bioactive substances, and thus have been increasingly recognized and found to have a medicinal value for human use.

Innate immunity is the first line of defense for multicellular organisms against the invasion of bacteria, fungi, viruses, and the like into the body. Multicellular organisms achieve an innate immune response by rapidly synthesizing and secreting antimicrobial peptides to destroy microorganisms. Insect antimicrobial peptides (AMPs) are synthesized primarily in the adipose body and in a variety of epithelial cells. When the insect is stimulated by external microbes, the antibacterial peptide secreted into the haemolymph can be directly diffused to the whole insect organism. The synergistic autophagy reaction and the cascade signal receptor process of the antibacterial peptide jointly protect a host from being invaded by microorganisms. After separation of the 1 st antimicrobial peptide, cecropin, from pupae of Bombyx mori (hylophora cecropia) in 1975, 259 insect AMPs were isolated and functionally annotated sequentially.

The discovery of antibiotics ensures that people are no longer inexperienced in various diseases caused by infection of pathogenic microorganisms, but the long-term use of antibiotics leads to the wide generation of drug resistance of pathogenic microorganisms, and the search of a new generation of antibacterial agent is urgently needed. The antibacterial activity of the antibacterial peptide, the minimal toxicity to the host and the low sensitivity effect make the antibacterial peptide hopefully become a new and safe antibiotic capable of replacing the traditional antibiotics.

Isolation of AMPs from natural sources is costly, resource-limited, and only useful for natural peptides; chemical synthesis can produce natural or modified AMPs, but is costly, and therefore efficient and economical methods of synthesis are needed. The synthesis of AMP in host cells by genetic engineering recombination technology is an economical and effective method at present, is easy for large-scale production, and can be used for modifying and synthesizing AMP gene.

At present, no report of preparing the American cockroach antibacterial peptide by using genetic engineering is found.

Disclosure of Invention

Aiming at the defects of the prior art, the invention connects a target gene with a pYES2-NTA saccharomyces cerevisiae expression vector to obtain a eukaryotic expression vector PYES2-NTA-AMP-PA-10 plasmid, then amplifies the target gene from the constructed eukaryotic expression vector PYES2-NTA-AMP-PA-10 plasmid, performs induced expression of fusion protein by constructing a prokaryotic expression vector after synthesizing the target gene, and finally performs separation and purification of the target protein to obtain the antibacterial peptide AMP-PA-10.

Further, the invention aims to provide the periplaneta americana antibacterial peptide AMP-PA-10.

Further, the invention also aims to provide a gene for coding the antibacterial peptide and a synthetic method thereof.

Furthermore, the invention also provides a prokaryotic expression method of the periplaneta americana antimicrobial peptide AMP-PA-10.

The amino acid sequence of the periplaneta americana antibacterial peptide AMP-PA-10 is SEQ ID No. 1.

The nucleotide sequence of the gene for coding the periplaneta americana antibacterial peptide AMP-PA-10 is SEQ ID No. 2.

The preparation method of the periplaneta americana antibacterial peptide AMP-PA-10 is realized by the following steps:

(1) synthesis of antibacterial peptide AMP-PA-10 gene: synthesizing a target gene AMP-PA-10;

(2) construction and identification of an antibacterial peptide AMP-PA-10 expression vector: transferring a connecting product obtained by connecting the target gene AMP-PA-10 obtained in the step (1) and pET-32a (+) plasmid after double enzyme digestion into DH5 alpha competent cells, sending out a bacteria liquid of positive clone for sequencing through bacteria liquid PCR, and extracting recombinant plasmids from the bacteria liquid with correct sequencing to obtain the recombinant plasmids;

(3) constructing an antibacterial peptide AMP-PA-10 prokaryotic expression vector: transforming the recombinant plasmid obtained in the step (2) into an expression host escherichia coli BL21(DE3) and detecting to obtain a correct prokaryotic expression strain;

(4) obtaining the antibacterial peptide AMP-PA-10: and (4) carrying out induction culture on the strains with correct sequencing in the step (3), and then carrying out thallus crushing, chromatography, dialysis, enzyme digestion, dialysis, separation and purification to obtain the antibacterial peptide AMP-PA-10.

Wherein, the synthesis method of the target gene AMP-PA-10 in the step (1) is realized by the following steps:

preparation of DNA template: constructing a eukaryotic expression vector PYES2-NTA-AMP-PA-10 plasmid as a DNA template;

b. primers P3 and P4 are designed according to the sequence characteristics of the PYES2-NTA-AMP-PA-10 plasmid, an EcoR I enzyme cutting site is added at the 5 'end of AMP-PA-10, an Xho I enzyme cutting site is added at the 3' end, and enzyme cutting protection bases are added at the same time.

c. And (c) carrying out PCR amplification by using the eukaryotic expression vector PYES2-NTA-AMP-PA-10 in the step a as a template according to the upstream primer and the downstream primer designed in the step b, and recovering and purifying a PCR product to obtain the target gene AMP-PA-10.

Further, the sequence of the primer P3 in the step b is 5'CCGGAATTCAATAAGTTTGAATATCGAAC 3'; the sequence of the primer P4 is 5'CCGCTCGAGACTCCTCTCGACTTTTTC 3'。

Further, the bold part in the primer P3 sequence is an EcoR I enzyme cutting site, and the underlined part is an enzyme cutting protection base; the bold part in the sequence of primer P4 is Xho I cleavage site, and the underlined part is the cleavage protection base.

Further, the PCR reaction system in step c is a 25 μ l system, specifically: PYES2-NTA-AMP-PA-10 plasmid and Taq enzyme each 0.5. mu.l, upstream and downstream primers each 1. mu.l, buffer 2.5. mu.l, dNTP 1.5. mu.l, ddH₂O 18μl。

Further, the PCR procedure described in step c is: pre-denaturation at 95 ℃ for 5 min; denaturation at 94 ℃ for 30S; annealing at 62.3 ℃ for 30S; stretching at 72 ℃ for 20S, and circulating for 35 times; final extension at 72 ℃ for 10 min.

Wherein, the inducing culture conditions in the step (4) are as follows: inoculating the strain with correct sequencing into 100ug/ml Amp LB liquid culture medium, culturing at 37 deg.C under 200rpm overnight with shaking for 11h, taking the strain according to the ratio of 1:100, adding into 100ug/ml Amp LB liquid culture medium, culturing at 37 deg.C under 200rpm until OD reaches 0.5-0.6, and adding IPTG to make the induction concentration reach 0.4 mM. The culture was induced at 30 ℃ for 3.5h with shaking at 200 rpm.

Wherein, the separation and purification condition parameters in the step (4) are as follows: dialyzing the enzyme digestion sample into 0.01M PBS, centrifuging at 12000rpm, and loading by using GE S200-24; mixing the following raw materials in a buffer solution: elution was performed with 0.01M PBS, pH7.4, 30mM NaCl, flow rate 0.2 ml/min.

The length of the nucleotide sequence of the antibacterial peptide AMP-PA-10 gene is 132 bp.

The antibacterial peptide AMP-PA-10 has an obvious antibacterial effect, particularly on staphylococcus aureus and salmonella; the antibacterial peptide AMP-PA-10 also has an inhibitory effect on pseudomonas aeruginosa.

The antibacterial peptide AMP-PA-10 has high research and development values, and can be particularly applied to the fields of medicines, daily chemicals, foods or health care.

Drawings

FIG. 1 Total RNA extraction electropherogram

FIG. 2 agarose gel electrophoresis of the eukaryotic expression vector PYES2-NTA-AMP-PA-10 amplification

FIG. 3 agarose gel electrophoresis of the target gene amplification of the antimicrobial peptide AMP-PA-10

FIG. 4 PCR agarose gel electrophoresis of recombinant plasmid transferred into DH5 alpha competent cell

FIG. 5 PCR agarose gel electrophoresis of recombinant plasmid transferred into BL21 E.coli

FIG. 612% SDS-PAGE Induction product validation

FIG. 712% SDS-PAGE cell disruption product validation

FIG. 8Tricine-SDS-PAGE cleavage assay

FIG. 9 AKTA isolation and purification Curve of the protein of interest

Figure 10 Tricine-SDS-PAGE detection of mesh proteins

FIG. 11 results of Staphylococcus aureus bacteriostasis experiments

FIG. 12 results of bacteriostatic experiments on Salmonella

FIG. 13 the result of the bacteriostasis experiment of Pseudomonas aeruginosa

Detailed Description

EXAMPLE 1 preparation of the antimicrobial peptide AMP-PA-10

1. Synthesis of antibacterial peptide AMP-PA-10 gene:

1.1 preparation of DNA template: construction of eukaryotic expression vector PYES2-NTA-AMP-PA-10 plasmid:

a) screening of the periplaneta americana antibacterial peptide: the periplaneta americana transcriptome is sequenced, assembled and annotated to obtain the periplaneta americana transcriptome, and then the periplaneta americana transcriptome is compared with defensin, lysozyme and termicin by a bioinformatics method to screen out potential periplaneta americana antibacterial peptide genes.

b) Extracting and reverse transcription of total RNA of periplaneta americana: total RNA is extracted by adopting a tissue total RNA extraction kit of Chengdu Fuji according to the instruction, 1 mu l of RNA sample is taken for agarose gel electrophoresis detection, and the detection result is shown in figure 1. Then, the first strand cDNA was synthesized by reverse transcription using the kit for reverse transcription of DNA-removed from Takara Shuzo Co.

c) Primer design and Polymerase Chain Reaction (PCR): obtaining gene sequence by transcriptome analysis, designing Primer upstream and downstream primers P1 and P2 by using Primer Premier5 software according to the gene sequence and the characteristics of the multiple cloning site region of pYES2-NTA saccharomyces cerevisiae expression vector, wherein the nucleotide sequence is as follows:

P1：5'ATTTGCGGCCGCGAATAAGTTTGAATATCGAAC3'

P2：5'TGCTCTAGAACTCCTCTCGACTTTTTC3'

wherein, the underlined part in the primer P1 is Not I enzyme cutting site, and the bold part is enzyme cutting protection base; the primer P2 is underlined to form an XbaI cleavage site, and the bold is a cleavage protecting base.

Performing PCR reaction by using the first strand cDNA product, wherein the reaction system is as follows: 25 mu system:

the reaction conditions of the PCR are as follows: pre-denaturation at 95 ℃ for 4min, denaturation at 94 ℃ for 30s, annealing at 62.3 ℃ for 35s, extension at 72 ℃ for 20s, 35 cycles, final extension at 72 ℃ for 10min, and forever at 4 ℃. The PCR product was then subjected to 1% agarose Gel electrophoresis, stained with Gel-green, the Gel excised under UV light, and the DNA fragment recovered using a Gel Extraction Kit, according to the instructions, for subsequent experiments. The electrophoretogram is shown in FIG. 2.

d) Construction of eukaryotic expression vector PYES 2-NTA-AMP-PA-10:

the PCR product and pYES2-NTA plasmid were double digested with restriction enzymes Not I and Xba I, respectively, in a 50. mu.l system as follows:

reacting at 37 deg.C for 1h, inactivating enzyme at 65 deg.C for 20min, and recovering product by sodium acetate precipitation. Purified PCR and plasmid cleavage products using T₄DNA Ligase ligation. The reaction system was as follows (10. mu.l system):

the reaction was carried out at 16 ℃ for 12 hours. Transforming Escherichia coli DH5 alpha competent cells, and screening positive recombinants by bacterial PCR and sequencing to obtain eukaryotic expression vector PYES2-NTA-AMP-PA-10 plasmid.

1.2 Using Primer Premier5 software, upstream and downstream primers P3 and P4 were designed based on the sequence characteristics of the plasmid PYES2-NTA-AMP-PA-10, and EcoR I cleavage site was added to the 5 'end and Xho I cleavage site was added to the 3' end of AMP-PA-10, and cleavage protecting bases were added to both. The nucleotide sequences of the primers P3 and P4 are as follows:

P3：5'CCGGAATTCAATAAGTTTGAATATCGAAC 3'

P4：5'CCGCTCGAGACTCCTCTCGACTTTTTC 3'

wherein, the bold part in the nucleotide sequence of the primer P3 is an EcoR I enzyme cutting site, and the underlined part is an enzyme cutting protection base; the primer P4 has Xho I site in the nucleotide sequence and underlined protecting base.

1.3 carrying out PCR amplification according to the upstream and downstream primers designed in the step (2) by taking the eukaryotic expression vector PYES2-NTA-AMP-PA-10 in the step (1) as a template to obtain a PCR product:

among them, PCR reaction system (25. mu.l): PYES2-NTA-AMP-PA-10 plasmid and Taq enzyme each 0.5. mu.l, upstream and downstream primers each 1. mu.l, buffer 2.5. mu.l, dNTP 1.5. mu.l, ddH₂O 18μl。

Wherein, the PCR program: pre-denaturation at 95 ℃ for 5 min; denaturation at 94 ℃ for 30S; annealing at 62.3 ℃ for 30S; stretching at 72 ℃ for 20S, and circulating for 35 times; final extension at 72 ℃ for 10 min. After the reaction, DNA electrophoresis analysis was performed using 1.0% agarose gel, and the electrophoresis results are shown in FIG. 3; the positive clones were sent to Chengdu Hingxi Biotechnology Limited for sequencing.

1.4 recovery of PCR products: carrying out 1.5% agarose gel electrophoresis on the PCR product, cutting a single band, and recovering by using a gel recovery kit, wherein the steps are briefly as follows:

a. putting the cut glue into a centrifugal tube of 1.5ml for weighing, adding a Binding Buffer (1g is calculated according to 1 ml) with the volume being 3 times that of the glue, carrying out water bath at 60 ℃ for 7min until the glue is completely melted, and carrying out vortex oscillation for 2-3 min;

b. adding isopropanol (the volume is half of that of the Binding Buffer) and mixing uniformly;

c. adding 700 μ l of the mixed solution into a DNA centrifugal column every time, centrifuging at room temperature of 10000xg for 1min, and discarding waste liquid;

d.300. mu.l Binding Buffer is added into a centrifugal column, centrifuged for 1min at room temperature of 10000Xg, and waste liquid is discarded;

e. adding 700 mul spw wash Buffer into a centrifugal column, centrifuging for 1min at room temperature at 10000Xg, and discarding waste liquid; repeating the steps once;

f. centrifuging the empty column at the highest speed for 2min, and opening the cover to stand for 2 min;

g. the DNA spin column was placed in a new 1.5ml centrifuge tube and 50. mu.l ddH was added to the middle membrane of the spin column₂O, standing at room temperature for 1min, and centrifuging at the highest speed for 1 min; repeating the steps once to obtain a recovered product, namely the target gene.

2. Construction and identification of an antibacterial peptide AMP-PA-10 expression vector:

2.1 extraction of pET-32a (+) plasmid

Mu.l of Escherichia coli containing pET-32a (+) plasmid was put into 10ml of 100ug/ml Amp LB liquid medium, and cultured overnight with shaking at 37 ℃ to extract the plasmid pET-32a (+) according to the instructions of the plasmid miniprep kit.

2.2 double digestion of the target Gene with the pET-32a (+) plasmid

The objective gene and the prokaryotic expression plasmid pET-32a (+) were subjected to the following double digestion with EcoR I enzyme and Xho I enzyme, respectively. The PCR program for the enzyme digestion was: 37 ℃ for 1 h.

Double restriction system for the target Gene (50. mu.l total): 43 mul of target gene, 1 mul of EcoR I, 1 mul of Xho I, 5 mul of 10 Xenzyme digestion buffer;

double digestion system for plasmid pET-32a (+) (50. mu.l total): plasmid pET-32a (+) 30. mu.l, EcoR I1. mu.l, Xho I1. mu.l, 10 Xdigestion buffer 5. mu.l, ddH₂O13μl。

2.3 recovery of the digestion product by sodium acetate precipitation

The enzyme-cut target gene and the pET-32a (+) plasmid are respectively recovered according to the following steps:

(1) adding 50 mu l of phenol isoamyl alcohol, and carrying out vortex oscillation for 30 s;

(2) centrifuging at 4 deg.C and 12000rpm for 10min, collecting supernatant, adding 5 μ l 3M sodium acetate and 2.5 times volume of anhydrous ethanol, mixing, and refrigerating in-20 refrigerator for 1 hr;

(3) centrifuging at 4 deg.C and 12000rpm for 10min, and removing supernatant;

(4) washing with 1ml 75% ethanol, centrifuging at 4 deg.C and 12000rpm for 10min, and removing supernatant;

(5) washing with 1ml anhydrous ethanol, centrifuging at 4 deg.C and 12000rpm for 10min, and removing supernatant;

(6) inverting the precipitate on filter paper for 5-10 min;

(7) adding appropriate amount of ddH₂Dissolving the O for 5-10 min, and recovering the enzyme digestion product.

2.4 ligation, transformation and detection of the digested target Gene to pET-32a (+) plasmid

The connection system of the target gene after enzyme digestion and pET-32a (+) plasmid is as follows: 7.5 ul of the target gene after digestion, 1.5 ul of pET-32a (+) plasmid after digestion, and T₄Connecting buffer 1. mu.l, T₄Ligase 0.5. mu.l. Ligation was performed overnight at 16 ℃.

The ligation products were all transferred into DH5 alpha competent cells, ice-cooled for 30min, heat shock at 42 ℃ for 90s, ice-cooled for 2min, transferred into 600. mu.l LB liquid medium, and cultured with shaking at 37 ℃ for 2 h.

Taking 50 mu l of the culture medium, coating the culture medium on 100ug/ml Amp LB solid culture medium, culturing at 37 ℃ for 12h, randomly selecting dozens of single colonies in 600 mu l of LB liquid culture medium, performing shake culture at 37 ℃ for 4h, and sending the positively cloned bacterial liquid to Hitachi Biotechnology Limited company for sequencing by bacterial liquid PCR.

The PCR agarose gel electrophoresis results of the bacterial liquid are shown in FIG. 4: the recombinant plasmid PET-32a (+) -AMP-PA-10 is amplified, and the fragment size is about 880 bp. The sent sequencing result is completely consistent with the sequence of the target gene.

2.5 extraction of the recombinant plasmid PET-32a (+) -AMP-PA-10

The method is the same as 2.1.

3. Construction of antibacterial peptide AMP-PA-10 prokaryotic expression vector

The recombinant plasmid extracted above is transformed into expression host Escherichia coli BL21(DE3), and the specific parameter conditions are shown in 2.4. The positive clone is sent to the Chilo catalpi and Xi biotechnology Limited company for sequencing through bacteria liquid PCR, and the strains which are sequenced successfully are used for induction expression.

The PCR agarose gel electrophoresis result of the bacterial liquid is shown in FIG. 5: the recombinant plasmid PET-32a (+) -AMP-PA-10 is amplified, and the fragment size is about 880 bp. And (3) sending out the bacteria liquid of the positive clone for sequencing, wherein the sequencing result is completely consistent with the target gene sequence, and the success of the construction of the recombinant prokaryotic expression vector is shown.

4. Obtaining of the antimicrobial peptide AMP-PA-10

4.1 inducible expression of fusion proteins

Inoculating the strain into 100ug/ml Amp LB liquid culture medium, shaking and culturing at 37 deg.C and 200rpm overnight for 11h, adding the strain into 100ug/ml Amp LB liquid culture medium at a ratio of 1:100, shaking and culturing at 37 deg.C and 200rpm until OD reaches 0.5-0.6, and adding IPTG to induce final concentration to reach 0.4 mM. The culture was induced at 30 ℃ for 3.5h with shaking at 200 rpm.

4.2 validation of Induction products

The induction product was centrifuged at 10000rpm for 10min, the supernatant was discarded and 20. mu.l ddH was added₂And (4) blowing, uniformly mixing and precipitating, adding 5 mu l of 5 Xloading buffer, uniformly mixing, boiling in boiling water for 10min, centrifuging at 7000rpm for 5min, and detecting by 12% polyacrylamide electrophoresis (SDS-PAGE). (control was obtained by treating uninduced cells in the same manner.)

The 12% polyacrylamide electrophoresis (SDS-PAGE) gel system was as follows:

the mature peptide sequence is known to be approximately 5.33kDa in size and the fusion tag is approximately 19kDa, so the overall length is approximately 24.4 kDa. A thicker band is detected between 20 and 30kDa by 12% polyacrylamide electrophoresis (SDS-PAGE), which indicates successful induction expression. As shown in fig. 6: no.1 and No.2 are pET-32a (+) no-load and non-induced control groups, respectively; 3 and 4 are induced expression of the fusion protein at 30 ℃.

4.3 disruption of the cells and affinity chromatography of the fusion protein

The cells obtained above were resuspended in PBS and sonicated for 30 min. Centrifugation was carried out at 12000rpm for 10min at 4 ℃ and the supernatant and pellet were examined by 12% SDS-PAGE as shown in FIG. 7: the fusion protein (about 24.4kDa) was present mostly in the supernatant of the disrupted bacterial suspension.

Filtering the supernatant with 0.45 μm filter membrane, collecting 1ml Ni-NTA, sequentially adding ddH₂Washing 10ml of O and PBS respectively, then mixing the supernatant and the washed nickel gel on a mixer, carrying out mixing at 4 ℃ for 1h, taking out the mixture after mixing, and washing 20ml of the mixture by 30mM imidazole. The protein was washed with 300mM imidazole and collected, and 1ml was collected in 1 tube.

4.4 dialysis of the fusion protein

Before dialysis, the dialysis tube is rinsed with cold water for 2-3 times. Each dialysate gradient was as follows:

dialyzing at 4 ℃ by using a magnetic stirrer, and replacing the dialyzate every 4-6 hours.

4.5 digestion and dialysis of fusion proteins by enterokinase

The sample obtained in the above step was subjected to the following enzyme digestion. According to the specification, the enzyme digestion system is as follows:

the enzyme was digested in water bath at 25 ℃ for 16 h.

The samples before enzyme digestion and the products after enzyme digestion are detected by Tricine-SDS-PAGE, and the detection result is shown in figure 8: 1 and 2 are respectively before and after enzyme digestion of the fusion protein. After enterokinase action, the cut was complete and a band was present at 14.4kDa, which is the protein of interest.

4.6 isolation and purification of proteins Using AKTA

The samples were dialyzed into 0.01M PBS. The samples were centrifuged at 12000rpm and then loaded with GE S200-24. Mixing the following raw materials in a buffer solution: elution was performed with 0.01M PBS, pH7.4, 30mM NaCl, flow rate 0.2 ml/min. The protein of each peak appeared was collected, examined by Tricine-SDS-PAGE and assayed for activity to identify the protein of interest. The results are shown in FIGS. 9 and 10.

FIG. 9 shows the absorption peaks after AKTA separation and purification, and 2 peaks (designated as (r) and (c)) appear and are collected.

FIG. 10 shows Tricine-SDS-PAGE, which shows that the target protein mainly appears in the first peak (indicated by an arrow in FIG. 9; a band of less than 10kDa in FIG. 10). 5. Preliminary antimicrobial Activity detection

In the experiment, the antibacterial activity of the antibacterial peptide AMP-PA-10 is detected by an antibacterial circle method: and (3) putting at least 5 sterilized circular filter paper sheets with the diameter of about 5mm into the collected protein for soaking for 30-40 min. Uniformly coating the bacterial liquid on the surface of a solid culture medium, standing for 2-5 min, sticking the soaked small filter paper sheet on the surface of the solid culture medium, culturing at 37 ℃ for 12h, and observing whether a bacteriostatic circle appears. The concentrations of the fusion proteins in the experiment were: 1mg/ml, and the concentration of ampicillin and carbenicillin are both 0.5 mg/ml.

The experiment adopts staphylococcus aureus, salmonella, pseudomonas aeruginosa and escherichia coli, and the specific bacteriostatic effects of the fusion protein are respectively shown in fig. 11, fig. 12 and fig. 13: the inhibition effect on staphylococcus aureus and salmonella is obvious, and a transparent ring is formed; the inhibition effect on pseudomonas aeruginosa is found, a semitransparent ring is formed, a layer of thin bacteria is arranged in the ring and is smaller than bacterial colonies outside the ring, and the inhibition effect on pseudomonas aeruginosa is shown but limited. The inhibition effect on Escherichia coli is not obvious.

In conclusion, the antibacterial peptide AMP-PA-10 disclosed by the invention has obvious bacteriostatic activity.

Finally, the primers used for PCR and sequencing of the bacterial solution are T7 primers (the sequence of the T7 primer is F: 5'TAATACGACTCACTATA GGG 3'; R: 5'TGCTAGTTATTGCTCAGCGG 3').

SEQUENCE LISTING

<110> Sichuan good doctor Panxi pharmaceutical industry Limited responsibility company

<120> periplaneta americana antibacterial peptide AMP-PA-10 and preparation method and application thereof

<130> 2017

<160> 2

<170> PatentIn version 3.5

<210> 1

<211> 132

<212> DNA

<213> Periplaneta americana

<400> 1

aataagtttg aatatcgaac caatttccta tctaccattt cactagaaac aatgaagatc 60

ttcctccggc tctacaggtg tctcataaac aaggttcttc atgtggcccc aaaggaaaaa 120

gtcgagagga gt 132

<210> 2

<211> 44

<212> PRT

<213> Periplaneta americana

<400> 2

Asn Lys Phe Glu Tyr Arg Thr Asn Phe Leu Ser Thr Ile Ser Leu Glu

1 5 10 15

Thr Met Lys Ile Phe Leu Arg Leu Tyr Arg Cys Leu Ile Asn Lys Val

20 25 30

Leu His Val Ala Pro Lys Glu Lys Val Glu Arg Ser

35 40

Claims

1. The periplaneta americana antibacterial peptide AMP-PA-10 is characterized in that the amino acid sequence of the antibacterial peptide is SEQ ID No. 1.

2. The antimicrobial peptide AMP-PA-10 of claim 1, wherein a nucleotide sequence of a gene encoding the antimicrobial peptide AMP-PA-10 is SEQ ID No. 2.

3. The preparation method of the periplaneta americana antimicrobial peptide AMP-PA-10 according to claim 1, wherein the preparation method is realized by the following method:

4. The method according to claim 3, wherein the synthesis of the desired gene AMP-PA-10 in step (1) is carried out by:

b. designing primers P3 and P4 according to the sequence characteristics of a PYES2-NTA-AMP-PA-10 plasmid, adding an EcoR I enzyme cutting site at the 5 'end of AMP-PA-10, adding an Xho I enzyme cutting site at the 3' end of AMP-PA-10, and simultaneously adding enzyme cutting protection bases;

5. The preparation method of claim 4, wherein the sequence of the primer P3 in step b is 5'CCGGAATTCAATAAGTTTGAATATCGAAC 3', primer P4 has a sequence of 5'CCGCTCGAGACTCCTCTCGACTTTTTC 3'；

Wherein, the bold part in the primer P3 sequence is an EcoR I enzyme cutting site, and the underlined part is an enzyme cutting protection base; the bold part in the sequence of primer P4 is Xho I cleavage site, and the underlined part is the cleavage protection base.

6. The method according to claim 4, wherein the PCR reaction system in step c is a 25 μ l system, specifically: PYES2-NTA-AMP-PA-10 plasmid and Taq enzyme each 0.5. mu.l, upstream and downstream primers each 1. mu.l, buffer 2.5. mu.l, dNTP 1.5. mu.l, ddH₂O 18μl。

7. The method according to claim 4, wherein the PCR procedure in step c is as follows: pre-denaturation at 95 ℃ for 5 min; denaturation at 94 ℃ for 30S; annealing at 62.3 ℃ for 30S; stretching at 72 ℃ for 20S, and circulating for 35 times; final extension at 72 ℃ for 10 min.

8. The method according to claim 3, wherein the inducing culture conditions in the step (4) are: inoculating the strain with correct sequencing into 100ug/ml Amp LB liquid culture medium, culturing at 37 deg.C under 200rpm overnight shaking for 11h, taking the strain according to the ratio of 1:100, adding into 100ug/ml Amp LB liquid culture medium, culturing at 37 deg.C under 200rpm shaking until OD value reaches 0.5-0.6, adding IPTG to make induction concentration reach 0.4mM, and culturing at 30 deg.C under 200rpm shaking for 3.5 h.

9. The method according to claim 3, wherein the separation and purification condition parameters in step (4) are: dialyzing the enzyme digestion sample into 0.01M PBS, centrifuging at 12000rpm, and loading by using GE S200-24; mixing the following raw materials in a buffer solution: elution was performed with 0.01M PBS, pH7.4, 30mM NaCl, flow rate 0.2 ml/min.