CN107677816A - One kind is based on NproThe ELISA kit of Protein Detection pig atypia pestivirus antibody - Google Patents

One kind is based on NproThe ELISA kit of Protein Detection pig atypia pestivirus antibody Download PDF

Info

Publication number
CN107677816A
CN107677816A CN201710698053.9A CN201710698053A CN107677816A CN 107677816 A CN107677816 A CN 107677816A CN 201710698053 A CN201710698053 A CN 201710698053A CN 107677816 A CN107677816 A CN 107677816A
Authority
CN
China
Prior art keywords
pro
atypia pestivirus
pig atypia
elisa kit
antibody
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201710698053.9A
Other languages
Chinese (zh)
Other versions
CN107677816B (en
Inventor
宁章勇
刘健新
许古明
郭世宁
张凯照
葛士坤
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Guangzhou Danong Biotechnology Co.,Ltd.
Original Assignee
South China Agricultural University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by South China Agricultural University filed Critical South China Agricultural University
Priority to CN201710698053.9A priority Critical patent/CN107677816B/en
Publication of CN107677816A publication Critical patent/CN107677816A/en
Application granted granted Critical
Publication of CN107677816B publication Critical patent/CN107677816B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/569—Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
    • G01N33/56983—Viruses
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/005—Assays involving biological materials from specific organisms or of a specific nature from viruses

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Immunology (AREA)
  • Engineering & Computer Science (AREA)
  • Urology & Nephrology (AREA)
  • Chemical & Material Sciences (AREA)
  • Biomedical Technology (AREA)
  • Virology (AREA)
  • Molecular Biology (AREA)
  • Hematology (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Food Science & Technology (AREA)
  • Medicinal Chemistry (AREA)
  • Cell Biology (AREA)
  • Analytical Chemistry (AREA)
  • General Physics & Mathematics (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Pathology (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The invention discloses one kind to be based on NproThe ELISA kit of Protein Detection pig atypia pestivirus antibody, include the pig atypia pestivirus N of sequence shown in SEQ ID NO.1proThe coated reaction plate of albumen, enzyme labelled antibody, nitrite ion, terminate liquid, positive serum and negative serum.The present invention creates the ELISA kit of detection pig atypia pestivirus antibody first, and the kit can quickly, specifically, delicately detect the antibody of pig atypia pestivirus in serum, and it is 1 that it, which detects serum antibody sensitivity,：1000.Kit application method of the present invention is simple, cost is cheap, and reaction result is easy to observe, and specificity is good, suitable for the monitoring of pig atypia pestivirus infection, epidemiology survey and the detection of veterinary clinic sample, is suitable for large-scale promotion and application.

Description

One kind is based on NproThe ELISA kit of Protein Detection pig atypia pestivirus antibody
Technical field
The present invention relates to veterinary vaccination detection field, and N is based on more particularly, to one kindproProtein Detection pig atypia pest The ELISA kit of antiviral antibody.
Background technology
Piglet congenital tremors betide newborn piglet, are characterized in that piglet observes that bone myoclonia is shunk after birth, There is chattering, the meeting of serious symptom causes death because hungry.2015, Hause research groups confirmed pig atypia Pestivirus (Atypical porcine pestivirus, APPV) is the cause of disease of piglet congenital tremors.Then, Germany, lotus Multiple countries such as orchid, Austria successively find that swinery has APPV prevalences.Ning Zhangyong seminars of Agricultural University Of South China find first The generation of China swinery APPV infection, and APPV GD1 and GD2 strains have been separated, but up to the present China swinery APPV Popular situation is still unclear.Vaccine there is no to apply for pig atypia pestivirus infection at present, so lacking at present Detect the related kit of pig atypia pestivirus antibody.
The content of the invention
The invention aims to overcome the above-mentioned deficiency of prior art, there is provided one kind is based on NproProtein Detection pig is non- The ELISA kit of typical pestivirus antibody.
To achieve these goals, the present invention is achieved by the following technical programs：
A kind of ELISA kit for detecting pig atypia pestivirus antibody, include the pig atypia of sequence shown in SEQ ID NO.1 Pestivirus NproThe coated reaction plate of albumen, enzyme labelled antibody, nitrite ion, terminate liquid, positive serum and negative serum.
Preferably, the pig atypia pestivirus NproThe preparation method of albumen is：By sequence shown in SEQ ID NO.2 Pig atypia pestivirus NproOn gene cloning to prokaryotic expression carrier, the recombinant prokaryotic expression vector transformed competence colibacillus that will obtain Cell, screens positive restructuring bacterial strain, and induction positive restructuring bacterial strain obtains NproAlbumen.
Preferably, the prokaryotic expression carrier is pET-32a (+).
Preferably, the competent cell is BL21 Escherichia coli.
Preferably, positive restructuring bacterial strain express express target protein, final concentration of 1.0 mmol/L of IPTG, temperature are induced using IPTG Spend for induced expression under the conditions of 37 DEG C 8 hours.
Preferably, the method for coating is：10 μ g/mL NproAlbumen is pressed to be added in reaction plate per the μ L of hole 100,4 DEG C Coating overnight, next day PBST board-washing 3 times, is patted dry.
Preferably, the nitrite ion is TMB, and the terminate liquid is the mol/L of concentration 2 H2SO4。
Preferably, the enzyme labelled antibody is that HRP marks rabbit-anti pig IgG.
Preferably, the positive serum is the Swine serum attacked by pig atypia pestivirus after poison；Negative serum is health Swine serum.
Preferably, after inducing positive restructuring bacterial strain, bacterium solution is collected, bacterium solution is centrifuged 3 under the conditions of 12000 r/min Min, thalline press 1 with PBS:10（V/V）It is resuspended.By suspension bacteria liquid under condition of ice bath 60 bacterial cell disruption conditions of ultrasonication For, ultrasonication 60 times under condition of ice bath, 3 sec/ times, per the sec of minor tick 5.
Compared with prior art, the invention has the advantages that：
The present invention create first detection pig atypia pestivirus antibody ELISA kit, and the kit can quickly, spy Antibody that is different, delicately detecting pig atypia pestivirus in serum.It is embodied in, the detection pig atypia pestivirus antibody ELISA kit high specificity：Other known viral positive serums are carried out with the inspection of cross reactions, all serum to be checked with The ratio of APPV negative serums（P/N values）Respectively less than 2.1；Favorable reproducibility：In batch and batch between Repeatability checking, the coefficient of variation is equal Within 5 %；Susceptibility is high：It is 1 that it, which detects serum antibody sensitivity,：1000；Accuracy is high：Positive rate is with using fluorescence The result of quantifying PCR method detection fits like a glove.Kit application method of the present invention is simple, cost is cheap, and reaction result is easy to Observation, specificity is good, suitable for the monitoring of pig atypia pestivirus infection, epidemiology survey and the inspection of veterinary clinic sample Survey, be suitable for large-scale promotion and application.
Vaccine there is no to apply for pig atypia pestivirus infection at present, so detection pig atypia pestivirus serum The presence of antibody is to judging the infection of pig and taking corresponding treatment measures significant.Due to pig atypia pestivirus It is newfound cause of disease in China, there is presently no the detection method of serum antibody.The present invention is first by NproRecombinant expression protein （Escherichia coli prokaryotic expression albumen）Apply in APPV detections.Although can be by pig atypia seasonal febrile diseases using eukaryotic expression system Malicious NproThe space conformation and function that are more nearly real native protein of protein expression, but the present invention still have selected greatly Enterobacteria expression system, reason are that the recombinant protein antigen of Bacillus coli expression is easily prepared and purifies, and expresses restructuring Host cell of the host cell E. coli of proteantigen than preparing APPV antigens（Such as PK15 pigs source cell）With APPV's Host（Pig）Affiliation is farther, and producing nonspecific possibility during detection is also reduced.
Brief description of the drawings
Fig. 1 is the N of APPV GD1 strainsproGene PCR amplified production electrophoresis result（M：DL2000 DNA Marker, 1：Npro Gene PCR product）.
Fig. 2 is the N of APPV GD1 strainsproDouble digestion qualification result in gene plasmid building process（M：DL5000 DNA Marker, 1：EcoR I/Xho IDouble digestion band）.
Fig. 3 is NproThe induced expression result of albumen（M：Protein Marker, 1：PET-32a (+) empty carrier induced expression Product, 2：PET-32a (+) empty carrier not induced expression product, 3：pET-32a/APPV-NproRecombinant plasmid transformed BL21（DE3） Competent cell induced expression product, 4：pET-32a/APPV-NproRecombinant plasmid transformed BL21（DE3）Competent cell does not lure Lead expression product）.
Fig. 4 is NproAlbumen Western-blot is detected and purifying protein electrophoresis result（A is NproThe Western blotting inspection of albumen Survey result, M：Protein Marker, 1：NproProtein immunoblot；B is the N of SDS-PAGE detection purifyingproAlbumen, M：Protein Marker, 1：The N of purifyingproAlbumen）.
Embodiment
The present invention is made with reference to Figure of description and specific embodiment and further being elaborated, the embodiment It is served only for explaining the present invention, is not intended to limit the scope of the present invention.Test method used in following embodiments is such as without spy Different explanation, is conventional method；Used material, reagent etc., unless otherwise specified, for the reagent commercially obtained And material.
Embodiment 1
A kind of ELISA kit for detecting pig atypia pestivirus antibody, the kit include pig atypia pestivirus NproEgg White coated reaction plate, enzyme labelled antibody, nitrite ion, terminate liquid, positive serum and negative serum.
Wherein, pig atypia pestivirus NproThe preparation method of the coated reaction plate of albumen is as follows：
First, pig atypia pestivirus NproThe acquisition of albumen：
1st, clone pig atypia pestivirus NproGene：
According to APPV GD1 strains（GenBank：KX950761）Gene order design amplification NproThe primer of gene, specific primer It is as follows：
F1：5′- GCGGCGGAATTCATGAAGAAGCAGATTACAT -3′（SEQ ID NO：3）, underscore expression EcoRI enzymes Enzyme site；
R1：5′- GCGATGCTCGAGTTAACAGGTCTTCACATAAAGC -3′（SEQ ID NO：4）, underscore expressionXhoI Restriction enzyme site.Primer is by Invitrogen（Shanghai）Trade Co., Ltd synthesizes.
Serum sample carries out Total RNAs extraction according to the explanation of TRIzol kits.With reference to PrimeScript II 1st Strand cDNA Synthesis Kit explanation carry out reverse transcription cDNA, after freeze it is standby in -80 DEG C of ultra low temperature freezers.
CDNA synthesis：According to PrimeScriptTMII 1st Strand cDNA Synthesis Kit use is said Bright book, following reagent is added in 0.2 mL PCR pipes：
Reaction of degeneration (RD) is carried out in PCR instrument：65 DEG C, 5 min, chilling on ice.
Following inverse transcription reaction liquid is added in above-mentioned PCR pipe：
PCR response procedures：42 ℃ 60 min；70 ℃ 15 min；50 ℃ 1 min.
PCR is expanded：Expanded using cDNA obtained above as template, PCR reaction systems are as follows：
PCR programs are:94 DEG C of min of pre-degeneration 5；94 DEG C of 30 sec of denaturation, 56 DEG C of 40 sec of annealing, 72 DEG C extend 30 Sec, 30 circulations, 10 min of last 72 DEG C of extensions.Pcr amplification product is entered into row agarose gel electrophoresis, as a result（Fig. 1）It is aobvious Show, amplification obtains 567 bp fragment（It is not then 540 bp including restriction enzyme site, terminator codon and protectiveness base）, it is and pre- Phase clip size is consistent.According to precious bioengineering（Dalian）The DNA gel QIAquick Gel Extraction Kit specification recovery purpose of Co., Ltd Band, the fragment for reclaiming acquisition are named as APPV-Npro。
2nd, the N of APPV GD1 strains is builtproThe expression vector of albumen：By the APPV-N of recoveryproWith pET-32a (+) carrier WithEcoRI andXhoI carries out double digestion, and digestion condition is 37 DEG C of 1.5 h of effect, and digestion system is as follows：
According to precious bioengineering（Dalian）The DNA gel QIAquick Gel Extraction Kit specification recovery digestion products of Co., Ltd, then will return Receive product and be attached reaction, reaction condition is 16 DEG C of 3 h of connection, and linked system is as follows：
By recombinant plasmid transformed to JM109 competent cells, 12 h are cultivated on the LB solid mediums containing Amp, select sun Property colony inoculation in the LB fluid nutrient mediums containing Amp, after 37 DEG C of r/min of shaking table 180 cultivate 12~14 h, extract matter Grain, double digestion identification（Fig. 2）, send Invitrogen（Shanghai）Trade Co., Ltd is sequenced.Correct recombinant plasmid is sequenced to be named as pET-32a(+)/APPV-Npro.Pig atypia pestivirus N is found after sequencingproThe amino acid sequence of albumen such as SEQ ID NO：1 It is shown, pig atypia pestivirus NproThe nucleotide sequence of gene such as SEQ ID NO：Shown in 2.
3rd, the N of APPV GD1 strainsproThe expression of albumen：
BL21（DE3）Competent cell is purchased from Beijing Ding Guo Bioisystech Co., Ltd；The strains of GD1 containing APPV NproThe expression of albumen Plasmid pET-32a (+)/APPV-NproBuilt by step 2；Various molecular biology reagents are purchased from precious bioengineering（Dalian）Have Limit company.
PET-32a (+)/APPV-N that step 2 is obtainedproPlasmid converts BL21（DE3）Competent cell.Transformed bacteria in It is incubated overnight 37 DEG C in the LB fluid nutrient mediums of Amp resistances, under the conditions of 180 r/min, next day is by overnight culture and brand-new The LB fluid nutrient mediums of Amp resistances are 1 by volume:100 expand culture about 3 hours, bacterium solution OD600IPTG is added up to when 0.6 extremely Final concentration of 1.0 mmol/L, and 8 h are induced at 37 DEG C, bacterium solution is then collected, by bacterium solution under the conditions of 12000 r/min 3 min are centrifuged, thalline presses 1 with PBS:10（V/V）It is resuspended.Simultaneously feminine gender is used as using pET-32a (+) carrier conversion respective table up to bacterium Control.
Ultrasonication 60 times under condition of ice bath by suspension bacteria liquid obtained above, 3 sec/ times, per the sec of minor tick 5, Then the bacterium solution after will be broken centrifuges 10 min under the conditions of 4 DEG C, 12000 r/min, abandons supernatant, collects precipitation, and precipitation is used PBS presses 1:10（V/V）It is resuspended.80 μ L of supernatant are drawn, add 20 μ L 5 × SDS loading buffer, after boiling 10 min, Normal temperature centrifuges 30 sec under the conditions of 3000 r/min, then carries out SDS-PAGE electrophoretic examinationss, as a result（Fig. 3）It has been shown that, pass through by Recombinant plasmid pET-32a (+)/APPV-NproIt is transformed into BL21（DE3）Afterwards, there is purpose band at about 42 kD, and it is negative Control does not contain purpose band.
APPV GD1 strains NproAlbumen Western-blot is detected：N is expressed by above-mentioned expression conditionproAlbumen, then carry out SDS-PAGE, then the gel after electrophoresis is transferred on pvdf membrane, 80 V transfer 60 min, take pvdf membrane after transfer Go out, 2 h of closing are shaken in room temperature with 10% skimmed milk power, washed 3 times, every time 5 min with TBST, then with 1:1000 dilutions Rabbit-anti GST polyclonal antibodies take out after being incubated overnight at 4 DEG C, are washed 3 times, every time 5 min with TBST, then with 1:5000 is dilute The horseradish enzyme mark mouse anti-rabbit IgG antibody released is shaken in room temperature is incubated 2 h, is washed 3 times with TBS, 5 min, shows after washing every time Shadow（Fig. 4 A）.
APPV GD1 strains NproThe purifying of albumen：Recombinant plasmid pET-32a (+)/APPV-N will be containedproBL21 (DE3) sense Expressed by state cell under optimum condition, then collect thalline, ultrasonication 60 times under condition of ice bath after being resuspended with PBS, 3 Sec/ times, per the sec of minor tick 5, the bacterium solution after then crushing centrifuges 10 min under the conditions of 4 DEG C, 12000 r/min, receives Collection precipitation；Then after the precipitation of collection is resuspended with PBS, by 1:4 ratios add 5 × SDS loadings buffer and boil 5 min, so Centrifugation carries out SDS-PAGE afterwards.After electrophoresis, gel is cleaned repeatedly with distilled water 3 times, then with PBS 3 times.With 4 DEG C of precoolings After 0.25 mol/L KCl solution lucifuge dyes 10 min, the gel-tape containing destination protein of white is accurately cut.Grinding To broken, and in liquid nitrogen fast freeze-thaw 3 times, during which constantly it is ground to powdered, is thoroughly dissolved with appropriate PBS, 4 DEG C stand overnight. Next day centrifuging and taking supernatant is albumen after purification（Fig. 4 B）, the supernatant of recovery is moved on in Millipore super filter tubes, 4000 G is centrifuged, 20 times of volume concentrations, regulatory protein concentration to 1 mg/mL.
Two：Envelope antigen is coated with reaction plate：Protein sample is diluted to 10 μ g/mL with coating buffer, per the μ L of hole 100,4 DEG C overnight.Next day PBST board-washing 3 times, 5 min, is patted dry every time；（2）Closing：Add the skimmed milk powers of 100 μ L 5% per hole, in 37 DEG C Humidistat closes 2 h, ibid board-washing；
The detection method of the kit is：
（1）To pig atypia pestivirus NproThe μ L of Swine serum 100 to be checked are added in the coated reaction plate of albumen, 2 are incubated at 37 DEG C H, PBST board-washing 3 times, 5 min, is patted dry every time；
（2）The μ L of rabbit-anti pig enzyme labelled antibody 100 of working concentration are added, 1 h are incubated under the conditions of 37 DEG C, ibid board-washing；
（3）100 μ L TMB nitrite ions are added, room temperature lucifuge reacts 10 min；
（4）Add terminate liquid (2 mol/L H2SO4), 50 μ L/ holes；
（5）ELIASA reads OD with double wave long form450-OD630Value.
Embodiment 2
Detect the specific assay of the ELISA kit of pig atypia pestivirus antibody
Using the method that embodiment 1 describes known various viral positive serums are carried out with the inspection of cross reaction, to determine The specificity of this method.As a result show, using this method to CSFV（CSFV）, PRV（PRV）, pig breeding with Respiratory disorder syndrome virus（PRRSV）, swine influenza virus（SIV）And PCV-II（PCV）Standard positive serum is tested When, the ratio of all serum to be checked and APPV negative serums（P/N values）Respectively less than 2.1（Table 1）, it is good to show that this method has Specificity.
The specific assay of table 1
Embodiment 3
Detect the Repeatability checking of the ELISA kit of pig atypia pestivirus antibody
The method described using embodiment 1 carries out Repeatability checking, the results showed that, same sample is carried out using the experimental method In batch and batch between Repeatability checking, the coefficient of variation illustrates that this method has very high repeatability within 5 %（Table 2）.
The Repeatability checking of table 2
Embodiment 4
Detect the sensitivity assays of the ELISA kit of pig atypia pestivirus antibody
The method described using embodiment 1 carries out sensitivity assays, 10 times of doubling dilution is carried out to known serum, as a result table Bright serum to be checked carries out 1:10、1:100 and 1:During 1000 times of dilutions, as a result it is judged as the positive；Carry out 1:10000 and 1:100000 It is as a result feminine gender when diluting again（Table 3）.
The sensitivity assays of table 3
Embodiment 5
The applicability for detecting the ELISA kit of pig atypia pestivirus antibody is examined
Using the method that embodiment 1 describes to five poison of the pig atypia pestivirus of infection of Chinese swinery having now been found that Strain（APPV GD1, GD2, GD3, GD and CH-GX strain）The Swine serum of infection is detected.As a result show, five kinds of virus strain infections Swine serum is the positive, illustrates that the present invention has good Detection results for different strains.
Embodiment 6
Detect the inspection of the clinical sample of the ELISA kit of pig atypia pestivirus antibody
Using the method that embodiment 1 describes 100 parts of Swine serums of the collection from Guangdong Province are carried out with the detection of APPV positive serums, And it is compared using fluorescence quantifying PCR method.
As a result show, detect 100 parts of Swine serums, the ratio of APPV positive serums is 7%, ELISA kit and fluorescence are determined Amount PCR method have detected positive serum completely, and the detection coincidence factor of the comparison between both approaches is 100%.
As fully visible, coating N produced by the present invention is utilizedproThe ELISA kit detection APPV serum antibodies of albumen have The advantages of high specificity, favorable reproducibility, high susceptibility height and accuracy, the detection available for veterinary clinic sample.
SEQUENCE LISTING
<110>Agricultural University Of South China
<120>A kind of ELISA kit based on E2 Protein Detection pig atypia pestivirus antibody
<130>
<160> 4
<170> PatentIn version 3.3
<210> 1
<211> 180
<212> PRT
<213>Npro Argine Monohydrochlorides
<400> 1
Met Lys Lys Gln Ile Thr Tyr Tyr Leu Lys Lys Glu Lys Gln Arg Asn
1 5 10 15
Gly Trp Thr Glu Leu Val Val Gly Glu Ser His Met Lys Ile Thr Thr
20 25 30
Leu Ser Gly Arg Thr Tyr Arg Gly Thr Trp Glu Met Glu Lys Trp Ser
35 40 45
Asn Pro Tyr Gly Thr Tyr Leu Pro Arg Pro Ser Pro Gln Gln Leu Thr
50 55 60
Ala Leu His Pro His Pro Val Val Asn Cys Lys Met Ile Glu Tyr Lys
65 70 75 80
Gly Val Asp Pro Asp Tyr Gly Asp Cys Pro Asn Thr Asn Gly Val Phe
85 90 95
Ile Asp Glu Lys Gly Arg Arg Phe Ser Ser Pro Pro Leu Gly Ile Trp
100 105 110
Lys Ile Arg Leu Asp Tyr Asn Glu Leu Val Asn Ala Ser Arg Pro Val
115 120 125
Phe Thr Ser Gly Arg Asn Ser Tyr Gln Val Glu Thr Cys Ser Gly Glu
130 135 140
Leu Ala Thr Ile Ile Leu Glu His Asp Arg Val Leu Val Asp Asp Cys
145 150 155 160
Arg Gly Phe Tyr Gln Trp Lys Pro Asn Cys Glu Gly Met Val Leu Tyr
165 170 175
Val Lys Thr Cys
180
<210> 2
<211> 540
<212> DNA
<213>Npro gene nucleotides
<400> 2
atgaagaagc agattacata ttacttaaaa aaagaaaaac aaagaaacgg gtggacggaa 60
ctggtggtgg gagaaagtca catgaaaata accacactct ctgggaggac ctaccgaggt 120
acttgggaaa tggagaagtg gtcaaatcct tatggaacct acttacccag gcctagcccc 180
caacaactta cagccttaca cccacacccg gtggtgaact gcaagatgat agagtacaag 240
ggggtggatc ctgattatgg tgattgtcca aacacaaatg gggtttttat tgacgaaaaa 300
ggtagaaggt ttagtagtcc tccattgggt atttggaaga taagactgga ctacaatgaa 360
ctggtaaatg caagtagacc agtctttacc agcggaagaa attcatacca ggttgaaacc 420
tgcagtgggg aattggccac cataatactg gagcacgaca gggttctcgt ggacgactgt 480
agggggtttt atcaatggaa acccaactgt gaaggaatgg tgctttatgt gaagacctgt 540
<210> 3
<211> 31
<212> DNA
<213> F1
<400> 3
gcggcggaat tcatgaagaa gcagattaca t 31
<210> 4
<211> 34
<212> DNA
<213> R1
<400> 4
gcgatgctcg agttaacagg tcttcacata aagc 34

Claims (7)

1. a kind of ELISA kit for detecting pig atypia pestivirus antibody, it is characterised in that including shown in SEQ ID NO.1 The pig atypia pestivirus N of sequenceproThe coated reaction plate of albumen, enzyme labelled antibody, nitrite ion, terminate liquid, positive serum and feminine gender Serum.
2. the ELISA kit of detection pig atypia pestivirus antibody according to claim 1, it is characterised in that described Pig atypia pestivirus NproThe preparation method of albumen is：By the pig atypia pestivirus N of sequence shown in SEQ ID NO.2proBase Because being cloned on prokaryotic expression carrier, the recombinant prokaryotic expression vector transformed competence colibacillus cell that will be obtained, positive restructuring bacterium is screened Strain, induction positive restructuring bacterial strain obtain NproAlbumen.
3. the ELISA kit of detection pig atypia pestivirus antibody according to claim 2, it is characterised in that protokaryon Expression vector is pET-32a (+).
4. the ELISA kit of detection pig atypia pestivirus antibody according to claim 2, it is characterised in that described Competent cell is BL21 Escherichia coli.
5. the ELISA kit of detection pig atypia pestivirus antibody according to claim 2, it is characterised in that use IPTG induction positive restructuring bacterial strain express express target proteins, final concentration of 1.0 mmol/L of IPTG, temperature induce under the conditions of being 37 DEG C Expression 8 hours.
6. the ELISA kit of detection pig atypia pestivirus antibody according to claim 1, it is characterised in that described Method for coating is：10 μ g/mL NproAlbumen is pressed to be added in reaction plate per the μ L of hole 100, and 4 DEG C are coated with overnight, and next day, PBST was washed Plate 3 times, is patted dry.
7. the ELISA kit of detection pig atypia pestivirus antibody according to claim 1, it is characterised in that described Nitrite ion is TMB, and the terminate liquid is the mol/L of concentration 2 H2SO4。
CN201710698053.9A 2017-08-15 2017-08-15 One kind being based on NproThe ELISA kit of Protein Detection pig atypia pestivirus antibody Active CN107677816B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201710698053.9A CN107677816B (en) 2017-08-15 2017-08-15 One kind being based on NproThe ELISA kit of Protein Detection pig atypia pestivirus antibody

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201710698053.9A CN107677816B (en) 2017-08-15 2017-08-15 One kind being based on NproThe ELISA kit of Protein Detection pig atypia pestivirus antibody

Publications (2)

Publication Number Publication Date
CN107677816A true CN107677816A (en) 2018-02-09
CN107677816B CN107677816B (en) 2019-07-19

Family

ID=61134384

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201710698053.9A Active CN107677816B (en) 2017-08-15 2017-08-15 One kind being based on NproThe ELISA kit of Protein Detection pig atypia pestivirus antibody

Country Status (1)

Country Link
CN (1) CN107677816B (en)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2016176624A2 (en) * 2015-04-30 2016-11-03 Kansas State University Research Foundation Porcine pestvirus, vaccines, and assays
CN106801109A (en) * 2017-03-24 2017-06-06 广东温氏食品集团股份有限公司 One boar atypia pestivirus RT PCR detections specific primer, kit and detection method

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2016176624A2 (en) * 2015-04-30 2016-11-03 Kansas State University Research Foundation Porcine pestvirus, vaccines, and assays
CN106801109A (en) * 2017-03-24 2017-06-06 广东温氏食品集团股份有限公司 One boar atypia pestivirus RT PCR detections specific primer, kit and detection method

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
ALEXANDER POSTEL ET AL.: "Recent emergence of a novel porcine pestivirus: interference with classical swine fever diagnosis?", 《EMERGING MICROBES & INFECTIONS》 *
GENBANK: "Atypican procine pestivirus 1 strain GD1 polyprotein gene，complete cds", 《NCBI数据库》 *

Also Published As

Publication number Publication date
CN107677816B (en) 2019-07-19

Similar Documents

Publication Publication Date Title
CN111474367A (en) Kit for screening and detecting African swine fever virus P30 protein monoclonal antibody and preparation method thereof
CN109402069A (en) A kind of pseudovirion and its preparation method and application
CN114736290B (en) Nanometer antibody capable of recognizing porcine pseudorabies virus with high accuracy and sensitivity, preparation method and application
CN108956985B (en) Indirect ELISA (enzyme-linked immunosorbent assay) detection kit for detecting novel goose astrovirus antibody and application
CN109212230B (en) Sensitized polystyrene nano-microsphere for detecting canine parvovirus structural protein VP2 antibody and preparation method and application thereof
CN107664697A (en) Expression vector and preparation method thereof, PEDV S1 albumen and the indirect ELISA testing kit comprising the albumen
CN109239341B (en) Indirect ELISA kit for detecting bovine haemolytic mannheimia antibody and application thereof
CN111596070B (en) Application of portunus trituberculatus tropomyosin allergy detection reagent
CN107102148A (en) A kind of porcine reproductive and respiratory syndrome virus antibody detection method and its application
CN114152748A (en) Double-antibody sandwich ELISA diagnostic kit for detecting African swine fever virus and method thereof
CN107664694B (en) A kind of ELISA kit based on E2 Protein Detection pig atypia pestivirus antibody
CN108776225A (en) Pig parvoviral VLPs antibody assay kits and preparation method thereof, application
CN112147327B (en) ELISA kit for detecting salmonella antibody and detection method and application thereof
CN101367870A (en) Bovine rotavirus recombinant VP6 protein antigen and method of preparing the same
CN108318686A (en) A kind of bovine coronavirus ELISA detection kit
CN106771237B (en) A kind of ELISA kit for detecting porcine sapelo virus antibody
CN108982847B (en) Indirect ELISA (enzyme-linked immunosorbent assay) detection method for duck reovirus causing duck spleen necrosis
CN105063065A (en) Codon optimization type 1 type duck hepatitis A virus VP1 gene and application of recombinant protein of codon optimization type 1 type duck hepatitis A virus VP1 gene
CN110376388A (en) A kind of haemophilus parasuis antibody detection method and its kit
CN111607000A (en) Recombinant soluble African swine fever virus p30 subunit fusion protein and preparation method and application thereof
CN104888208B (en) The application of Rhodococcus equi Disease-causing gene VapA recombinant proteins
CN107677816A (en) One kind is based on NproThe ELISA kit of Protein Detection pig atypia pestivirus antibody
CN108318684A (en) A kind of the visible protein chip preparation method and detection method of detection pig parvoviral antibody
CN114839368A (en) Swine Gata virus indirect ELISA antibody detection method and kit thereof
CN101979406B (en) Multi-epitope protein for South Africa type II foot-and-mouth disease, and preparation method and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant
TR01 Transfer of patent right
TR01 Transfer of patent right

Effective date of registration: 20231206

Address after: Room 203, No. 19 Xiangshan Road, Huangpu District, Guangzhou City, Guangdong Province, 510700

Patentee after: Guangzhou Danong Biotechnology Co.,Ltd.

Address before: 510630 No. 483 Wushan Road, Tianhe District, Guangzhou City, Guangdong Province

Patentee before: SOUTH CHINA AGRICULTURAL University