CN107653331A - Detect pseudomonas aeruginosa and ExoY primer, kit and method in water - Google Patents
Detect pseudomonas aeruginosa and ExoY primer, kit and method in water Download PDFInfo
- Publication number
- CN107653331A CN107653331A CN201710633219.9A CN201710633219A CN107653331A CN 107653331 A CN107653331 A CN 107653331A CN 201710633219 A CN201710633219 A CN 201710633219A CN 107653331 A CN107653331 A CN 107653331A
- Authority
- CN
- China
- Prior art keywords
- exoy
- pseudomonas aeruginosa
- primer
- pcr
- water
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses pseudomonas aeruginosa and ExoY primer, kit and method in a kind of detection water, the sequence and probe of the primer are respectively:Sense primer P.AF, anti-sense primer P.AR, probe P.AP, sense primer ExoYF, anti-sense primer ExoYR, probe ExoYP.The invention aims to overcome weak point of the prior art, there is provided the primer of pseudomonas aeruginosa and ExoY genes a kind of water suitable for detection;Another object of the present invention is to provide a kind of primer and component and reasonable mixture ratio, easy to use, and detection is quick, accurately, the kit of pseudomonas aeruginosa and ExoY genes water is detected suitable for dual ddPCR;Another object of the present invention is to provide a kind of method of pseudomonas aeruginosa and ExoY genes in detection water using mentioned reagent box, and this method is easy to operate, quick, and testing result is accurate.
Description
Technical field
The present invention relates to pseudomonas aeruginosa and ExoY primer in a kind of detection water, the invention further relates to one kind to detect water
Middle pseudomonas aeruginosa and its main effect protein ExoY dual droplet type digital pcr detection kit, the present invention also relate to
A kind of and pseudomonas aeruginosa and ExoY method in detection drinking water using mentioned reagent box.
Background technology
Pseudomonas aeruginosa Pseudomonas aeruginosa are former to claim Pseudomonas aeruginosa.It is extensive in distributed in nature, for soil
One of most common bacterium present in earth.Various water, air, the skin of normal person, respiratory tract and enteron aisle etc. have this bacterium to deposit
.Essential condition existing for this bacterium is moist environment.The bacterium is a kind of common environmental microorganism, because to nutritional requirement not
Height, excel at leveraging various carbon sources and ammonification compound as nitrogen source, so wide in the environment such as water, soil, food and hospital
General presence.The limit of the U.S., Canada, Europe, Japan, Brazil and the World Health Organization to the green pseudomonad content of copper in drinking water
Determine MPN<3/L must not detect per 250mL.China《National food safety standard packs drinking water》(GB19298-2014), then
Provide in 5 water samples, 250mL must not detect pseudomonas aeruginosa in each sample.
In October, 2009,《Natural mineral water》Etc. aqueous phase close national food safety standard successively all by bacterium colony
This total index is deleted.Although this reform has practical significance, objectively so that water manufacturing enterprise simplifies sterilization
Program, substantially increase the exceeded probability of pseudomonas aeruginosa.On September 23rd, 2015, under food and medicine Surveillance Authority of Beijing
The exceeded serious pure water of frame 4 sections " pseudomonas aeruginosas ", mineral water.In recent years, various regions are even more that frequency shows the green vacation of copper in drinking water
The exceeded situation of unit cell.
The main reason for being currently known the successful host cells infected of pseudomonas aeruginosa and causing disease is that III type secretes system
Unite type III secretion system, TTSS effect, by TTSS by toxic protein ExoS, ExoT, ExoU and ExoY
Host cell is directly injected into, causes actin cytoskeleton to be reset, meronecrosis, is advantageous to the invasion of bacterium and diffusion and escapes
Keep away the phagocytosis or degraded of host phagocytes.In 4 kinds of albumen, ExoY is major toxicity albumen, and ExoY positive strains are in vivo and in vitro
Meronecrosis, death can be caused, be directly connected to disease progression and the prognosis of infected patient, played in pathogenic course crucial
Effect
, quick detection accurate to pseudomonas aeruginosa that the strict control of the drinking water quality of production needs, at the same it is false to verdigris
Monad is propagated risk and assessed.Special primer, probe of the invention by designing pin pseudomonas aeruginosa and ExoY genes
Combination, it may be appreciated that in water in the distribution of pseudomonas aeruginosa and bacterial strain ExoY genes popularity.
At present, varieties of food items safety standard requires carries out quantitative detection to pseudomonas aeruginosa, but false for verdigris
The quantitative detection of monad is main or counts after being cultivated by conventional method, but conventional method has a process cumbersome, week
The shortcomings of phase is long.It is not only cumbersome and conventional PCR method needs PCR to carry out electrophoresis after expanding, and quantitative inspection can not be realized
Survey.At present, Southern blot and real-time fluorescence quantitative PCR are two kinds of conventional copy number of foreign gene analytical technologies, extensively
The general copy number of foreign gene that is used for is analyzed.But there is also certain defect for both approaches.For example, Southern blot methods point
Workload is big during analysis, the cycle is long, operation requires that high, accuracy is poor, especially for the analysis of multi-copy gene, as a result easily
It is less than normal.Quantitative fluorescent PCR is necessarily dependent upon the gene of standard curve and known copy number when analyzing copy number of foreign gene, only
A kind of relative quantitation method, and the quality of standard curve be vulnerable to DNA purity, the concentration of primer and probe, response inhabitation because
The factors such as son influence;Established in addition, standard curve must be based on standard substance, and the limitednumber of standard substance and costliness
Price is not applied for all research.
Droplet digital pcr is a kind of new absolute quantitation technology of rising in recent years, and it is entered based on single-molecule PCR method
The nucleic acid quantification that row counts, is a kind of method of absolute quantitation.The main miniflow using the popular research field of present analysis chemistry
Control or droplet method, the nucleic acid solution after Macrodilution are dispersed in the microreactor or droplet of chip, each reactor
Nucleic acid-templated number be less than or equal to 1.So pass through after PCR cycle, have the reactor of a nucleic acid templates just
Fluorescence signal can be provided, does not just have fluorescence signal without the reactor of template.According to relative scale and the volume of reactor, so that it may
To extrapolate the gene copy number of original solution.
But the analysis work report of the copy number based on droplet digital pcr platform is less, for pseudomonas aeruginosa and
The detection of ExoY genes, which just more has no, to be reported.The present invention be based on droplet type ddPCR platforms, establish pseudomonas aeruginosa and its
ExoY gene copy number analysis methods, result of study provide to analyze the quantitative detection of food security biogenic risks and assumptions
New method and reference, also provide a technical support means for food security quality control.
The content of the invention
The invention aims to overcome weak point of the prior art, there is provided verdigris a kind of water suitable for detection
Pseudomonad and the primer of ExoY genes;
Another object of the present invention is to provide a kind of primer and component and reasonable mixture ratio, easy to use, and detection is quick, accurate
Really, the kit of pseudomonas aeruginosa and ExoY genes water is detected suitable for dual ddPCR;
Another object of the present invention is to provide pseudomonas aeruginosa and ExoY bases in a kind of detection water using mentioned reagent box
The method of cause, this method is easy to operate, quick, and testing result is accurate.
In order to achieve the above object, the present invention uses following scheme:
Pseudomonas aeruginosa and ExoY gene primers in a kind of water, it is characterised in that the sequence and probe sequence of the primer point
It is not:
Sense primer P.AF:TGGTAGTCCACGCCGTAAA
Anti-sense primer P.AR:CAGACTGCGATCCGGACTACG
Probe P.AP:TCGACCGCCTGGGGAGTACG
Sense primer ExoYF:GTCTCTACAGGATCAGCCGC
Anti-sense primer ExoYR:TGCGCATCAGACCTTACGTT
Probe ExoYP:GGCAACTGGTGGACGCCCTC.
The kit of pseudomonas aeruginosa and ExoY genes in a kind of ddPCR detections water, it is characterised in that in the kit
Reaction system includes following components:The μ L of wherein 2 × ddPCR Super Mix 10.0, pseudomonas aeruginosa and ExoY is forward and reverse draws
Each 0.01-1.0 μ L of thing, each 0.01-1.0 μ L of probe, the μ L of DNA profiling 4.0.
A kind of ddPCR detection pseudomonas aeruginosas and the method for ExoY genes, it is characterised in that comprise the following steps:
A, sample DNA is extracted;
B, each reactive component is added into reaction system as described above, then adds 70.0 μ l mineral oil, be transferred to after mixing
Droplet is automatically generated on drop generator;
C, caused droplet is carefully transferred completely into 96 hole reaction plate PCR reaction tubes;Again by 96 hole reaction plates in sealer
Instrument upper sealing film, it is placed in regular-PCR instrument and enters performing PCR reaction.
D, droplet fluorescence detector application software is opened, 96 hole reaction plates after PCR reactions are terminated are inserted directly into equipment,
The PCR response situations of droplet in the every PCR reaction tubes of detection, the copy number of testing gene is finally calculated according to amber pine distribution law.
DdPCR detection pseudomonas aeruginosas as described above and the method for ExoY genes, it is characterised in that PCR expands in step B
The response procedures of increasing are carried out according to the following steps:
(1) 94 DEG C of pre-degeneration 3min;
(2) 94 DEG C of denaturation 10s, 58.5 DEG C of annealing 1min, carry out 40 circulations altogether;
(3) 98 DEG C of enzyme heat inactivation 10min;
(4) 4 DEG C stop reaction.
DdPCR detection pseudomonas aeruginosas as described above and the method for ExoY genes, it is characterised in that carried described in step A
Take comprising the following steps that for sample DNA:
The direct 10000rpm of 50mL water samples founds the heart 10 minutes, or takes 50mL water samples to be gripped by membrane filtration with tweezers
Filter membrane 50mL centrifuge tube with after 2ml ultrapure waters again 10000rpm centrifuge 10 minutes, remove supernatant;5mL CTAB are added to carry
Liquid is taken, is fully mixed.65 DEG C of incubation 30min, vibrate frequently;8000r/min room temperatures centrifugation 10min afterwards, takes 1ml supernatants to enter
In 2ml centrifuge tubes;Forced oscillation is used after adding 700 μ L chloroforms, 13000g centrifugation 10min, shifts the μ L of supernatant 600 to new 2ml
In centrifuge tube;The CTAB precipitation solutions of 2 times of volumes of addition are reverse to be stored at room temperature 60min, 13000 × g centrifugation 10min afterwards for several times,
Supernatant discarding, adding 350 μ L NaCl solutions and precipitation is suspended, add 350 μ L chloroforms, vortex oscillation is mixed,
13000g centrifuges 10min, and the isopropanol that 0.8 times of volume is added after transfer supernatant is used for precipitate nucleic acids, and room temperature places 20min,
13000g centrifuges 10min, supernatant discarding, adds the ethanol solutions of 500 μ L 70% washing precipitation, is dissolved in 50 μ L TE solution.
Sensitivity and Specificity is tested in the present invention:
Sequence verification is carried out to positive amplification product using the methods of sequencing, as a result positive amplification Product Sequence is carried out
When Blast compares, sequence with Genbank aim sequence very high homologies.The reference strain genomic DNA of 10 times of dilutions is added
Previous reaction system, repeat that there is repeatability very well in experiment display detection sample.Dilute template concentrations logarithm value and copy
Also it is in good linear relationship R between shellfish numerical value2≥0.95.Illustrate that this method has preferable accuracy and good stabilization
Property.
The present invention compared with prior art, has advantages below:
1) reagent constituents and reasonable mixture ratio of the present invention, easy to use, detection is quick, accurately, is quantitatively examined suitable for ddPCR
Survey pseudomonas aeruginosa and ExoY genes;
2) detection method simplifies testing process, and need not make standard curve, substantially reduces detection week
Phase, detection time shorten two days or so than tradition culture method of counting;
3) detection method whole process is without using standard curve, and direct with new-generation sequencing slitless connection,
Absolute quantification analysis can perform to gene copy number.
4) digital pcr detecting system is handled by droplet, can greatly reduce the interference of background and matrix, and sensitivity can
With as little as 1 copy, therefore, the slight change to low concentration mrna concentration carries out detection accurate and that repeatability is good.
5) pseudomonas aeruginosa and ExoY genes simultaneously can be achieved in same reaction system using detection method
Precisely detected, it is easy to operate, quick.With preferable industrialization prospect.
Embodiment
The present invention is described further with reference to embodiment:
Embodiment 1
The primer of pseudomonas aeruginosa and ExoY genes in present invention detection water, sequence are respectively:
Sense primer P.AF:TGGTAGTCCACGCCGTAAA
Anti-sense primer P.AR:CAGACTGCGATCCGGACTACG
Probe P.AP:TCGACCGCCTGGGGAGTACG
Sense primer ExoYF:GTCTCTACAGGATCAGCCGC
Anti-sense primer ExoYR:TGCGCATCAGACCTTACGTT
Probe ExoYP:GGCAACTGGTGGACGCCCTC.
Embodiment 2
The kit of pseudomonas aeruginosa and ExoY genes in a kind of detection water of the present invention, wherein being wrapped in 20 μ L reaction systems
Include following components:
The μ L of wherein 2 × ddPCR Super Mix 10.0, pseudomonas aeruginosa and each 1.0 μ L of the forward and reverse primers of ExoY, visit
Each 1.0 μ L of pin, the μ L of DNA profiling 4.0.
Wherein primer sequence is as follows:
Sense primer P.AF:TGGTAGTCCACGCCGTAAA
Anti-sense primer P.AR:CAGACTGCGATCCGGACTACG
Probe P.AP:TCGACCGCCTGGGGAGTACG
Sense primer ExoYF:GTCTCTACAGGATCAGCCGC
Anti-sense primer ExoYR:TGCGCATCAGACCTTACGTT
Probe ExoYP:GGCAACTGGTGGACGCCCTC.
Embodiment 3
Pseudomonas aeruginosa and ExoY genetic methods in present invention detection water, comprise the following steps:
A, sample DNA is extracted;
B, each reactive component is added into the 20.0 μ l reaction systems such as embodiment 2, then adds 70.0 μ l mineral oil, mixed
After be transferred on drop generator and automatically generate droplet;
C, caused droplet is carefully transferred completely into 96 hole reaction plate PCR reaction tubes;96 hole reaction plates are being sealed again
Film instrument upper sealing film, it is placed in regular-PCR instrument and enters performing PCR reaction.
D, droplet fluorescence detector application software is opened, 96 hole reaction plates after PCR reactions are terminated are inserted directly into equipment,
The PCR response situations of droplet in the every PCR reaction tubes of detection, the copy number of testing gene is finally calculated according to amber pine distribution law.
Wherein primer sequence is as follows:
Sense primer P.AF:TGGTAGTCCACGCCGTAAA
Anti-sense primer P.AR:CAGACTGCGATCCGGACTACG
Probe P.AP:TCGACCGCCTGGGGAGTACG
Sense primer ExoYF:GTCTCTACAGGATCAGCCGC
Anti-sense primer ExoYR:TGCGCATCAGACCTTACGTT
Probe ExoYP:GGCAACTGGTGGACGCCCTC.
Described fluorescent PCR amplification is carried out according to the following steps:
(1) (1) 94 DEG C of pre-degeneration 3min;
(2) 94 DEG C of denaturation 10s, 58.5 DEG C of annealing 1min, carry out 40 circulations altogether;
(3) 98 DEG C of enzyme heat inactivation 10min;
(4) 4 DEG C stop reaction.
Embodiment 4
Pseudomonas aeruginosa and ExoY genetic methods in present invention detection water, comprise the following steps:
The direct 10000rpm of 50mL water samples founds the heart 10 minutes, or takes 50mL water samples to be gripped by membrane filtration with tweezers
Filter membrane 50mL centrifuge tube with after 2ml ultrapure waters again 10000rpm centrifuge 10 minutes, remove supernatant;5mL CTAB are added to carry
Liquid is taken, is fully mixed.65 DEG C of incubation 30min, vibrate frequently;8000r/min room temperatures centrifugation 10min afterwards, takes 1ml supernatants to enter
In 2ml centrifuge tubes;Forced oscillation is used after adding 700 μ L chloroforms, 13000g centrifugation 10min, shifts the μ L of supernatant 600 to new 2ml
In centrifuge tube;The CTAB precipitation solutions of 2 times of volumes of addition are reverse to be stored at room temperature 60min, 13000 × g centrifugation 10min afterwards for several times,
Supernatant discarding, adding 350 μ L NaCl solutions and precipitation is suspended, add 350 μ L chloroforms, vortex oscillation is mixed,
13000g centrifuges 10min, and the isopropanol that 0.8 times of volume is added after transfer supernatant is used for precipitate nucleic acids, and room temperature places 20min,
13000g centrifuges 10min, supernatant discarding, adds the ethanol solutions of 500 μ L 70% washing precipitation, is dissolved in 50 μ L TE solution.
The μ L of wherein 2 × ddPCR Super Mix 10.0, pseudomonas aeruginosa and each 0.1 μ L of the forward and reverse primers of ExoY, visit
Each 0.1 μ L of pin, the μ L of DNA profiling 4.0.Wherein primer sequence is as follows:
Sense primer P.AF:TGGTAGTCCACGCCGTAAA
Anti-sense primer P.AR:CAGACTGCGATCCGGACTACG
Probe P.AP:TCGACCGCCTGGGGAGTACG
Sense primer ExoYF:GTCTCTACAGGATCAGCCGC
Anti-sense primer ExoYR:TGCGCATCAGACCTTACGTT
Probe ExoYP:GGCAACTGGTGGACGCCCTC.
Enter performing PCR amplification, carry out according to the following steps:
(1) 94 DEG C of pre-degeneration 3min;
(2) 94 DEG C of denaturation 10s, 58.5 DEG C of annealing 1min, carry out 40 circulations altogether;
(3) 98 DEG C of enzyme heat inactivation 10min;
(4) 4 DEG C stop reaction.
Embodiment 5
Pseudomonas aeruginosa and ExoY genetic methods in present invention detection water, comprise the following steps:
The direct 10000rpm of 50mL water samples founds the heart 10 minutes, or takes 50mL water samples to be gripped by membrane filtration with tweezers
Filter membrane 50mL centrifuge tube with after 2ml ultrapure waters again 10000rpm centrifuge 10 minutes, remove supernatant;5mL CTAB are added to carry
Liquid is taken, is fully mixed.65 DEG C of incubation 30min, vibrate frequently;8000r/min room temperatures centrifugation 10min afterwards, takes 1ml supernatants to enter
In 2ml centrifuge tubes;Forced oscillation is used after adding 700 μ L chloroforms, 13000g centrifugation 10min, shifts the μ L of supernatant 600 to new 2ml
In centrifuge tube;The CTAB precipitation solutions of 2 times of volumes of addition are reverse to be stored at room temperature 60min, 13000 × g centrifugation 10min afterwards for several times,
Supernatant discarding, adding 350 μ L NaCl solutions and precipitation is suspended, add 350 μ L chloroforms, vortex oscillation is mixed,
13000g centrifuges 10min, and the isopropanol that 0.8 times of volume is added after transfer supernatant is used for precipitate nucleic acids, and room temperature places 20min,
13000g centrifuges 10min, supernatant discarding, adds the ethanol solutions of 500 μ L 70% washing precipitation, is dissolved in 50 μ L TE solution.
The μ L of wherein 2 × ddPCR Super Mix 10.0, pseudomonas aeruginosa and each 0.01 μ L of the forward and reverse primers of ExoY, visit
Each 0.01 μ L of pin, the μ L of DNA profiling 4.0.Wherein primer sequence is as follows:
Sense primer P.AF:TGGTAGTCCACGCCGTAAA
Anti-sense primer P.AR:CAGACTGCGATCCGGACTACG
Probe P.AP:TCGACCGCCTGGGGAGTACG
Sense primer ExoYF:GTCTCTACAGGATCAGCCGC
Anti-sense primer ExoYR:TGCGCATCAGACCTTACGTT
Probe ExoYP:GGCAACTGGTGGACGCCCTC.
Enter performing PCR amplification, carry out according to the following steps:
(1) 94 DEG C of pre-degeneration 3min;
(2) 94 DEG C of denaturation 10s, 58.5 DEG C of annealing 1min, carry out 40 circulations altogether;
(3) 98 DEG C of enzyme heat inactivation 10min;
(4) 4 DEG C stop reaction.
Interpretation of result
In development process of the present invention, while using the classical culture protocols of culture medium, carry out pseudomonas aeruginosa quantity survey
Fixed control.Test in triplicate, pseudomonas aeruginosa results averaged.As a result show, the present invention uses digital pcr method
To the copy number of pseudomonas aeruginosa in water, the total plate count result coefficient R detected with classical culture protocols2≥
99%.In addition, digital pcr of the present invention is enjoyed oneself to the full, single sample whole process detection time of method is 4 hours, and considerably shorter than existing traditional puts down
Plate culture method of counting, and detect pseudomonas aeruginosa simultaneously, moreover it is possible to quantitative detection is carried out to its ExoY, being capable of accurate evaluation cause
Pathogen transmission risk, therefore there is good technical advantage and Developmental Prospect of Industrialization.
The general principle and principal character and advantages of the present invention of the present invention has been shown and described above.The skill of the industry
For art personnel it should be appreciated that the present invention is not limited to the above embodiments, described in above-described embodiment and specification is explanation
The principle of the present invention, without departing from the spirit and scope of the present invention, various changes and modifications of the present invention are possible, these
Changes and improvements all fall within the protetion scope of the claimed invention.The claimed scope of the invention by appended claims and
Its equivalent thereof.
SEQUENCE LISTING
<110>Zhong Shan inspection and quarantine bureaus inspection and quarantine technique center
<120>Detect pseudomonas aeruginosa and ExoY primer, kit and method in water
<130>Detect pseudomonas aeruginosa and ExoY primer, kit and method in water
<160> 6
<170> PatentIn version 3.3
<210> 1
<211> 19
<212> DNA
<213> Pseudomonas aeruginosa
<400> 1
tggtagtcca cgccgtaaa 19
<210> 2
<211> 21
<212> DNA
<213> Pseudomonas aeruginosa
<400> 2
cagactgcga tccggactac g 21
<210> 3
<211> 20
<212> DNA
<213> Pseudomonas aeruginosa
<400> 3
tcgaccgcct ggggagtacg 20
<210> 4
<211> 20
<212> DNA
<213> Pseudomonas aeruginosa
<400> 4
gtctctacag gatcagccgc 20
<210> 5
<211> 20
<212> DNA
<213> Pseudomonas aeruginosa
<400> 5
tgcgcatcag accttacgtt 20
<210> 6
<211> 20
<212> DNA
<213> Pseudomonas aeruginosa
<400> 6
ggcaactggt ggacgccctc 20
Claims (5)
- A kind of 1. pseudomonas aeruginosa and gene ExoY primer in detection water, it is characterised in that the sequence of primer and probe combination Row are respectively:Sense primer P.AF:TGGTAGTCCACGCCGTAAAAnti-sense primer P.AR:CAGACTGCGATCCGGACTACGProbe P.AP:TCGACCGCCTGGGGAGTACGSense primer ExoYF:GTCTCTACAGGATCAGCCGCAnti-sense primer ExoYR:TGCGCATCAGACCTTACGTTProbe ExoYP:GGCAACTGGTGGACGCCCTC.
- A kind of 2. pseudomonas aeruginosa and gene ExoY kit in detection water, it is characterised in that reaction system in the kit Including following components:The μ L of 2 × ddPCR Super Mix 10.0, pseudomonas aeruginosa and each 0.01-1.0 of the forward and reverse primers of ExoY Each 0.01-1.0 μ L of μ L, probe, the μ L of DNA profiling 4.0.
- A kind of 3. pseudomonas aeruginosa and gene ExoY method in detection water, it is characterised in that comprise the following steps:A, sample DNA is extracted;B, each reactive component is added into above-mentioned reaction system as claimed in claim 2, then adds 70.0 μ l mineral oil, mixed After be transferred on drop generator and automatically generate droplet;Take positive quality control and the negative Quality Control in the kit respectively simultaneously, Handled according to step A identicals method, obtain corresponding DNA profiling;C, digital pcr mixed liquor will be prepared and be made as the micro- reactions of Water-In-Oil PCR, and be transferred completely into 96 hole reaction plate PCR reactions Guan Zhong;Again by 96 hole reaction plates in sealer instrument upper sealing film, it is placed in regular-PCR instrument and enters performing PCR reaction;D, droplet fluorescence detector application software is opened, 96 hole reaction plates after PCR reactions are terminated are inserted directly into equipment, detect The PCR response situations of droplet in per PCR reaction tubes, the copy number of testing gene is finally calculated according to amber pine distribution law.
- 4. pseudomonas aeruginosa and gene ExoY method in a kind of detection water according to claim 3, it is characterised in that The response procedures that PCR is expanded in step C are carried out according to the following steps:(1) 94 DEG C of pre-degeneration 3min;(2) 94 DEG C of denaturation 10s, 58.5 DEG C of annealing 1min, carry out 40 circulations altogether;(3) 98 DEG C of enzyme heat inactivation 10min;(4) 4 DEG C stop reaction.
- 5. pseudomonas aeruginosa and gene ExoY method in a kind of detection water according to claim 3, it is characterised in that Comprising the following steps that for sample DNA is extracted described in step A:The direct 10000rpm of 50mL water samples founds the heart 10 minutes, or takes 50mL water samples to grip filter membrane with tweezers by membrane filtration 50mL centrifuge tube with after 2ml ultrapure waters again 10000rpm centrifuge 10 minutes, remove supernatant;Add 5mL CTAB extractions Liquid, fully mix.65 DEG C of incubation 30min, vibrate frequently;8000r/min room temperatures centrifugation 10min afterwards, takes 1ml supernatants to enter 2ml In centrifuge tube;Forced oscillation, 13000g centrifugations 10min, the transfer μ L of supernatant 600 to new 2ml centrifugations are used after adding 700 μ L chloroforms Guan Zhong;The CTAB precipitation solutions of 2 times of volumes of addition are reverse to be stored at room temperature 60min afterwards for several times, 13000 × g centrifugation 10min, discards Supernatant, add 350 μ L NaCl solutions and precipitation is suspended, add 350 μ L chloroforms, vortex oscillation is mixed, 13000g Centrifuge 10min, shift the isopropanol of 0.8 times of volume is added after supernatant be used for precipitate nucleic acids, room temperature placement 20min, 13000g from Heart 10min, supernatant discarding, the ethanol solutions of 500 μ L 70% washing precipitation is added, is dissolved in 50 μ L TE solution.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201710633219.9A CN107653331A (en) | 2017-07-28 | 2017-07-28 | Detect pseudomonas aeruginosa and ExoY primer, kit and method in water |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201710633219.9A CN107653331A (en) | 2017-07-28 | 2017-07-28 | Detect pseudomonas aeruginosa and ExoY primer, kit and method in water |
Publications (1)
Publication Number | Publication Date |
---|---|
CN107653331A true CN107653331A (en) | 2018-02-02 |
Family
ID=61128267
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201710633219.9A Pending CN107653331A (en) | 2017-07-28 | 2017-07-28 | Detect pseudomonas aeruginosa and ExoY primer, kit and method in water |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN107653331A (en) |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN111172302A (en) * | 2019-12-27 | 2020-05-19 | 天津农学院 | Providencia retx gene primer, fluorescent quantitative PCR detection method and application |
-
2017
- 2017-07-28 CN CN201710633219.9A patent/CN107653331A/en active Pending
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN111172302A (en) * | 2019-12-27 | 2020-05-19 | 天津农学院 | Providencia retx gene primer, fluorescent quantitative PCR detection method and application |
CN111172302B (en) * | 2019-12-27 | 2022-12-13 | 天津农学院 | Providencia retx gene primer, fluorescent quantitative PCR detection method and application |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN107513561A (en) | Detect primer, kit and the method for P. aeruginosa and C.perfringens | |
CN103320434B (en) | Salmonella LAMP (loop-mediated isothermal amplification) primer group and kit and detection method | |
CN110453011A (en) | A kind of method and application based on CRISPR/Cas12a fast accurate detection African swine fever virus | |
CN113502352B (en) | EMA-ddPCR primer and probe for detecting infectious ASFV and application | |
CN101886138A (en) | Three-color fluorescent RT-PCR (Reverse Transcription-Polymerase Chain Reaction) combined detection method of enterovirus 71, Coxsackie virus A16 and other subtypes of enterovirus as well as kit thereof | |
CN106755592A (en) | Method based on RPA technology for detection bean pod mottle virus, RPA primers and kit | |
CN106048052A (en) | Kit and method for detecting staphylococcus aureus and integron in food | |
CN107513562A (en) | Detect pseudomonas aeruginosa and ExoU primer, kit and method in water | |
CN106868224A (en) | The RT PCR methods of detection pig blue-ear disease poison classical strainses, highly pathogenic mutant strain and the strains of NADC 30 | |
CN105112558B (en) | The triple real time fluorescent quantitative RT PCR detection kits of the type of foot and mouth disease virus O, A and Asia I | |
CN108977529A (en) | It is a kind of to utilize newborn's TRECs and KRECs gene copy number detection kit of digital pcr technology and its application | |
CN107988401A (en) | The dry powdered LAMP quick detection kits of salmonella | |
CN107287328A (en) | Detect primer, kit and the method for pseudomonas aeruginosa and toxA in water | |
CN108624713A (en) | A kind of porcine pseudorabies vaccine virus differentiates the method and kit of detection with wild poison | |
CN107653331A (en) | Detect pseudomonas aeruginosa and ExoY primer, kit and method in water | |
CN107447001A (en) | Detect pseudomonas aeruginosa and ExoS primer, kit and method in water | |
CN106967826A (en) | A kind of people's umbilical cord, placenta protection liquid detection of mycoplasma primer pair, kit and its detection method | |
CN100386442C (en) | Prime and probe sequence for detecting nucleotide fregment of 01 Group comma bacillus | |
CN106244691A (en) | A kind of based on the method for Salmonella in microdroplet digital pcr method fast quantification examination Fructus Fragariae Ananssae | |
CN106148534A (en) | For detecting shigella and the test kit of integron and method in food | |
CN107419012A (en) | Detect pseudomonas aeruginosa and lasB primer, kit and method in water | |
CN108913770A (en) | It is a kind of to utilize newborn's TRECs and KRECs gene copy number detection kit of digital pcr technology and its application | |
CN100395347C (en) | Primer for detecting salmonella nucleotide fragment and probe sequence | |
CN100395346C (en) | Primer for detecting Listern nucleotide segment of monocellular hyperplasia and probe sequence | |
CN102719548B (en) | Kit for detecting brucella and use method thereof |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PB01 | Publication | ||
PB01 | Publication | ||
WD01 | Invention patent application deemed withdrawn after publication | ||
WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20180202 |