CN107653252A - Cotton GbSLR1 genes are in plant roots and the developmental application of branch - Google Patents
Cotton GbSLR1 genes are in plant roots and the developmental application of branch Download PDFInfo
- Publication number
- CN107653252A CN107653252A CN201711135400.3A CN201711135400A CN107653252A CN 107653252 A CN107653252 A CN 107653252A CN 201711135400 A CN201711135400 A CN 201711135400A CN 107653252 A CN107653252 A CN 107653252A
- Authority
- CN
- China
- Prior art keywords
- gbslr1
- genes
- cotton
- plant
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Molecular Biology (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biophysics (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Biomedical Technology (AREA)
- Biochemistry (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Physics & Mathematics (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Cell Biology (AREA)
- Botany (AREA)
- Gastroenterology & Hepatology (AREA)
- Medicinal Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Peptides Or Proteins (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention discloses cotton GbSLR1 genes in Plant hormone signal response, seed sprouting, root development and the developmental application of branch.Cotton GbSLR1 gene nucleotides basic sequence such as SEQ ID NO.1 of the present invention, amino acid sequence such as SEQ ID NO.1;Plant main root is longer after GbSLR1 genes of the present invention overexpress in arabidopsis, lateral root is less;Plant branching is controlled after GbSLR1 genes of the present invention overexpress in arabidopsis Atd14 mutant, show that cotton GbSLR1 genes have the function that to control plant branching development, moulding and cultivating so as to the good plant type plant of application, cotton species especially mixed and disorderly to branch, its yield, lifting economic benefit can be improved.
Description
Technical field
The present invention relates to field of plant genetic, and in particular to cotton GbSLR1 genes are sent out in plant roots and branch
Application in educating.
Background technology
Cotton is a kind of important industrial crops, and planting range is quite varied at present.How seed selection high-quality cotton kind, remove
Can adapt to local climate and it is pest-resistant it is disease-resistant beyond, it is also necessary to consider the individual plant type of cotton.The plant type and plant height of cotton,
Leaf morphology, branching pattern, leaf spacing, crotch angle, fruit branch type have the relation of interwoveness, development and the cotton of plant type
The cultivation of growing environment, the kind of cotton and cotton, the quality of seed have very big association.Cotton has indeterminate growth
Habit, i.e., under suitable external environment, stem can with continued propagation, fruit branch also can continued propagation, cotton boll yield may proceed to increase
More, this habit is advantageous to the increase of output of cotton, but the indeterminate growth of cotton also has the shortcomings that a lot, such as is unfavorable for
Mechanized harvest, branch are mixed and disorderly, plant type is mixed and disorderly, are difficult to be managed collectively, waste soil etc..Therefore, good cotton plant type is favourable
In the raising of illumination utilization rate, be advantageous to the reasonable distribution in soil, be advantageous to dense planting and Mechaniaed harvest, be more beneficial for moulding reason
The yielding Populations structure thought, and bigger yield and economic benefit are createed within the limited time.The branch of plant and its strain
Type is inseparable, and most of plant in nature has branching habit, and the branch of plant is influenceed by many factors,
The plant type of plant is determined to a certain extent, and influences an important economical character of crop yield.Plant branching has
There is certain plasticity, but most of character is related to inherent cause, this provides substantial amounts of genetic information for biology.
During growth and development of plants, except water resource, illumination etc., it is also necessary to some internal small-molecule substances,
Referred to as plant hormone, this is that some can be synthesized in plant, and is transported to response position from generating unit, it is micro can be with
Produce a kind of acitve organic matter of biological effect.This small-molecule substance can adjust plant grow and it is degeneration-resistant
Property, it is most important to the growth course of plant.Well known several plant hormone mainly has auxin (Indole-3-acetic
Acid, IAA), brassinosteroid (Brassinosteroids, BRs), ethene (Ethylene, ETH), abscisic acid (Abscisic
Acid, ABA), gibberellin (Gibberellin, GA), these common hormones are indispensable in the growth and development process of plant
, and can not be substituted, different degrees of influence will be caused to growth and development of plants by lacking any one therein.Plant side
During branch development, there are several important hormones to participate in, in five kinds of classical plant hormones, the basic element of cell division and auxin
Plant branching can be developed and played an important role.Later scientist has found novel plant hormone witchweed lactone
(Strigolactone), it can stimulate plant seed germination, and the also branch development to higher plant has certain inhibitory action, can
To regulate and control the collateral development and lateral root development of plant together with auxin, the basic element of cell division.It can be seen that hormone signal approach is to planting
The morphological development of thing plays a very important role.
Had not been reported in cotton on the less report of branch study on regulation, branch development related gene.Pass through molecule
The key gene of biological means screening regulation and control cotton plant type or branch, cultivates good plant type, the raising to output of cotton, cotton
Economic benefit increases significant.
The content of the invention
In consideration of it, an object of the present invention is to provide cotton GbSLR1 genes answering in Plant hormone signal response
With the hormone is witchweed lactone, and the nucleotide sequence of the GbSLR1 genes exists with SEQ ID NO.1 sequence similarity
The amino acid sequence of more than 90% or described GbSLR1 genes is with SEQ ID NO.2 sequence similarity more than 85%.
Preferably, the nucleotide sequence of the GbSLR1 genes is identical with SEQ ID NO.1 or the GbSLR1 genes
Amino acid sequence is identical with SEQ ID NO.2;
Preferably, the plant is cotton or arabidopsis.
The second object of the present invention is to provide application of the cotton GbSLR1 genes in plant seed germination is promoted, described
The nucleotide sequence of GbSLR1 genes and SEQ ID NO.1 sequence similarity more than 90% or the GbSLR1 genes ammonia
Base acid sequence and SEQ ID NO.2 sequence similarity are more than 85%;
Preferably, the nucleotide sequence of the GbSLR1 genes is identical with SEQ ID NO.1 or the GbSLR1 genes
Amino acid sequence is identical with SEQ ID NO.2;
Preferably, the plant is cotton or arabidopsis.
The third object of the present invention is to provide application of the cotton GbSLR1 genes in the growth of plant main root is promoted, described
The nucleotide sequence of GbSLR1 genes and SEQ ID NO.1 sequence similarity more than 90% or the GbSLR1 genes ammonia
Base acid sequence and SEQ ID NO.2 sequence similarity are more than 85%;
Preferably, the nucleotide sequence of the GbSLR1 genes is identical with SEQ ID NO.1 or the GbSLR1 genes
Amino acid sequence is identical with SEQ ID NO.2;
Preferably, the plant is cotton or arabidopsis.
The fourth object of the present invention is to provide application of the cotton GbSLR1 genes in plant lateral roots growth is suppressed, described
The nucleotide sequence of GbSLR1 genes and SEQ ID NO.1 sequence similarity more than 90% or the GbSLR1 genes ammonia
Base acid sequence and SEQ ID NO.2 sequence similarity are more than 85%;
Preferably, the nucleotide sequence of the GbSLR1 genes is identical with SEQ ID NO.1 or the GbSLR1 genes
Amino acid sequence is identical with SEQ ID NO.2;
Preferably, the plant is cotton or arabidopsis.
The fifth object of the present invention is to provide the application that cotton GbSLR1 genes suppress branch in plant branching development, institute
The nucleotide sequences of GbSLR1 genes is stated with SEQ ID NO.1 sequence similarity more than 90% or the GbSLR1 genes
Amino acid sequence and SEQ ID NO.2 sequence similarity are more than 80%;
Preferably, the nucleotide sequence of the GbSLR1 genes is identical with SEQ ID NO.1 or the GbSLR1 genes
Amino acid sequence is identical with SEQ ID NO.2;
Preferably, the plant is cotton or arabidopsis.
The present invention is screened by cotton branch development gene early stage, obtains a cotton branch development related gene
GbSLR1, the gene nucleotide series such as SEQ ID NO.1, amino acid sequence such as SEQ ID NO.2, the gene can make plant more
Fast-response Plant hormone signal, especially witchweed lactone hormone signal, show that it participates in plant growth and development process;Passing through will
The gene in cotton overexpresses in arabidopsis, it is found that plant main root is longer, lateral root density is smaller, in witchweed lactone hormone
This phenomenon becomes apparent under processing, and seed germination rate improves under witchweed lactone HORMONE TREATMENT;With overexpressing plant table
The gene is overexpressed in the opposite arabidopsis Atd14 mutant of type, can make mutant plants are short and small, branch is more, root long is short to show
As recovering to wildtype Arabidopsis thaliana phenotype, show that cotton GbSLR1 genes have the function that to control plant roots and branch development, from
And can be applied to the controlling of plant branching, good plant type plant being moulded and cultivating, especially to important industrial crops but branch it is miscellaneous
Random cotton species, its yield, lifting economic benefit can be improved.Because cotton species are more, the sequence of the gene in different cottons
Row will not be identical, therefore with SEQ ID NO.1 sequences and SEQ ID NO.2 sequence similarities it is higher (similitude difference it is big
Also there is similar function in 90% and gene 85%).
Brief description of the drawings
Fig. 1 is the agarose gel electrophoresis figure of sea island cotton GbSLR1 coding sequences PCR of the present invention amplifications;
Fig. 2 is tissue expression spectrogram of the GbSLR1 genes of the present invention in cotton;
Fig. 3 is the expression variation diagram of present invention GbSLR1 genes in cotton under middle witchweed lactone HORMONE TREATMENT;
Fig. 4 is the expression variation diagram of GbSLR1 genes in cotton under the other HORMONE TREATMENTs of the present invention;
Fig. 5 is that the present invention turns GbSLR1 genes arabidopsis figure compared with GbSLR1 gene expression amounts between wild type;
Fig. 6 turns GbSLR1 gene arabidopsis figure compared with the seed germination rate of wild type for the present invention;
Fig. 7 is that invention turns GbSLR1 genes arabidopsis and the root long of wild type is relatively schemed with root density ratio;
Fig. 8 is arabidopsis wild type of the present invention, the mutant figure compared with the seedling morphology of covering system;
Fig. 9 is arabidopsis wild type of the present invention, the mutant figure compared with the seedling root long of covering system;
Figure 10 is arabidopsis wild type of the present invention, the mutant figure compared with the leaf blade size of covering system;
Figure 11 is arabidopsis wild type of the present invention, the mutant figure compared with the petiole length of covering system;
Figure 12 is arabidopsis wild type of the present invention, the mutant figure compared with the branch quantity of covering system;
Embodiment
The present invention is described in detail below in conjunction with embodiment and accompanying drawing, and these embodiments and accompanying drawing only play illustrative work
With, it is not limited to application of the invention.It is all without prejudice to the present invention the invention is not restricted to following embodiments or experimental example
The modification and deformation that spirit is made, all should be included within the scope of the present invention.
Experimental example 1:The clone of sea island cotton GbSLR1 genes
1st, the clone of sea island cotton GbSLR1 genes
1. the total serum IgE and reverse transcription that extract the leaf of new extra large 15 kinds of sea island cotton are cDNA.New extra large 15 variety seeds of sea island cotton
There is provided by the Chinese Academy of Agriculture Science and Technologys Cotton Research Institute.
2. the est sequence of a branch development related gene is filtered out by transcript profile sequencing analysis, by Central China agriculture
Sea island cotton database (the http that sparetime university is learned://cotton.cropdb.org/cotton/tools/blast.php) in carry out sequence
Row are compared, and compare out a complete cDNA sequence, and pair for amplification is designed with primer-design software Primer Premier 5.0
Primer (F:ATGGCAAACACCCTTTTAGAAG;R:CTAGAAAACTCACCGCGGAAG), using round pcr, with high-fidelity enzyme
(TaKaRa) sequence amplification, is carried out as amplification template using the cDNA in the new sea 15 of sea island cotton.PCR primer Gel electrophoresis results such as Fig. 1
Shown, M DNAMarker, product 1-3 is target gene, and its size is with expected consistent, i.e. 810bp or so.
A is added to react 3. carrying out flat end to pcr amplification product, reaction system is:Amplified production 14.5 μ L, 10 × PCR
The μ L of 2 μ L, Mix dNTP of Buffer, 3 μ L, rTaq enzymes 0.5.72 DEG C of heating 20min in PCR instrument.
4. A reaction products are added to flat end according to the step of its operational manual using full formula gold size recovery purifying kit
Carry out recovery purifying.
5. carrier T coupled reaction, reaction system are:The μ L of 0.5 μ L, solution I of pMD18-T (TaKaRa) 5, purifying production
Thing 3 μ L, ddH2O1.5μL.It is placed in 16 DEG C of thermostat water baths and connects overnight, is then turned connection product by heat shock response
Change into bacillus coli DH 5 d competent cell, picking single bacterium colony obtains GbSLR1 genetic fragments, single bacterium colony after culture
It is sent to the sequencing of Hua Da company and obtains sea island cotton GbSLR1 gene orders, i.e. SEQ ID NO.1.
Experimental example 2:GbSLR1 genes and hormone response signal, plant roots and branch development related experiment
1st, expression pattern analysis of the GbSLR1 genes in cotton
Extra large a kind (seed is provided by the Chinese Academy of Agriculture Science and Technologys Cotton Research Institute) of sea island cotton is chosen, with the strain after buddingging
Six positions of the cotton of phase include root, stem, leaf, stem apex, terminal bud and axillary bud.RNA is extracted respectively, is cDNA by reverse transcription,
Design the quantitative primer (F of GbSLR1:TCCCAGGTTTCTCAATG and R:CACGCAACACGGCACT), internal reference is selected in cotton
Ubiquitin7(UBQ7)(F:GAAGGCATTCCACCTGACCAAC and R:CTTGACCTTCTTCTTCTTGTGCTTG), use
The SYBR Green PCR master mix kits of the precious biology in Dalian carry out experimental analysis, detection by qRT-PCR methods
Expressions of the GbSLR1 in two kinds of cotton varieties.
QRT-PCR reaction systems are:5 0.2 μ L, cDNA templates of μ L, Dey of SYBR 3 μ L, each 0.5 μ L of upstream and downstream primer,
ddH2O 0.8μL.QRT-PCR programs are:95 DEG C of 20s, 95 DEG C of 3s, 60 DEG C of 30s, 40 circulations.Reaction uses dissolving after terminating
Tracing analysis detects the specificity of amplified production.Each reaction will include three biology and repeat at least.By by single mould
Plate is diluted to various concentrations, and the log values of template extension rate are made to the Ct values of each dilute sample, expands to detection primer
Increasing Efficiency.Using 2-ΔCTMethod calculates the relative expression quantity of target gene.
Analysis result has expression, expression quantity highest at each position as shown in Fig. 2 GbSLR1 expression is relatively broad
Position be axillary bud, axillary bud is the key position for controlling cotton collateral development again, shows that GbSLR1 may participate in cotton branch hair
Educate process.
2nd, expression pattern analysis of the GbSLR1 genes under witchweed lactone analogue (GR24) processing
It is sampling material with the kind of upland cotton 3798 (seed is provided by the Chinese Academy of Agriculture Science and Technologys Cotton Research Institute), chooses life
The cotton of 3 true leaves is grown to, cotton plants are handled with spraying method, GR24 concentration is 3 μM, and 95% absolute ethyl alcohol compares, point
It is separately sampled in 0min, 5min, 15min, 30min, 1h, 4h, 8h, 24h, 48h for 9 point in time sampling product.Extract cotton
RNA, and reverse transcription identifies gene expression amount to pass through qRT-PCR methods after cDNA.As a result as shown in figure 3, with compareing
(control) compare, after GR24 solution 5min is sprayed, GbSLR1 expression quantity begins to raise, and chronic up-regulation in 48h
Expression, in the 48h after spraying, expression quantity has reached second peak value, and expression quantity is 5-12 times of non-spray on plants, has aobvious
Work property.Show that GbSLR1 plays an important role during witchweed lactone signal, it may participate in phytomorph and build up.
3rd, expression pattern analysis of the GbSLR1 genes under other HORMONE TREATMENTs
It is sampling material to take new extra large 15 kinds of cotton, treats that cotton grows to three to the spray that hormone is carried out when four true leaves
Apply, the hormone of selection mainly has auxin (IAA), the basic element of cell division (6-BA), gibberellin (GA), jasmonic (JA), rape element
Lactone (BR) and abscisic acid (ABA), sample time are divided into 3, are 1h, 3h, 6h respectively, hormone concentration 50mg/L.Extract cotton
Flower RNA, and reverse transcription identifies gene expression amount to pass through qRT-PCR methods after cDNA.As a result as shown in figure 4, after HORMONE TREATMENT
GbSLR1 expression quantity improves to some extent, and GbSLR1 expression quantity gradually rises under brassinosteroid processing, auxin,
Come off acid treatment 1h when GbSLR1 expression quantity there is peak value, GbSLR1 tables when the basic element of cell division, gibberellin and jasmine acid treatment 3h
There is peak value up to amount, wherein auxin processing makes GbSLR1 expression quantity quick and largely raised.Auxin participates in the branch of plant
Growth course, there is document once to report that auxin can promote witchweed lactone route of synthesis gene M AX3, MAX4 synthesis, so
GbSLR1 expression quantity amplitudes of variation are larger when auxin handles cotton.One of brassinosteroid signal path is crucial to be adjusted
Correlation occurs between control gene and witchweed lactone downstream gene BRC1, this interaction may be caused in witchweed
The up-regulated expression of ester approach related gene.The mistake that the branch development of plant is a complexity and needs a variety of hormones to adjust jointly
Journey, a variety of HORMONE TREATMENTs can induce GbSLR1 expression, show that GbSLR1 albumen participates in a variety of hormone signal approach, so as to join
With the morphogenesis of cotton.
4th, the influences grown of the GbSLR1 to Arabidopsis plant
1. GbSLR1 overexpression vector structure
The connection of GbSLR1 genes and PK7WG2.0 overexpression vectors is completed using Gateway technologies.
Add attB1 and attB2 respectively first before the sense primer and anti-sense primer of original amplification gene, use high-fidelity
The sequence that enzyme is expanded to obtain by carrying out the next step again after purification.So as to which GbSLR1 gene magnification primers are:
F:GGGGACAAGTTTGTACAAAAAAGCAGGCTACATGGCAAACACCCTTTTA
R:GGGGACCACTTTGTACAAGAAAGCTGGGTCGAAAACTCACCGCG
BP reaction systems:μ L, TE8.01 the μ L of pDONOR221 carriers 0.5, the μ L of 0.5 μ L, BP enzyme of gene amplification product 0.5.Will
1-3h under conditions of mixture is placed on 25 DEG C, then heat shock is transferred in DH5 α competent cells, and carries out sequencing identification.LR is anti-
Answer system:PK7WG2.0 carriers 0.5 μ L, TE 8.01 μ L, the μ L of 0.5 μ L, BP enzyme of intermediate carrier plasmid 0.5.Mixture is placed on
1-3h under conditions of 25 DEG C, then heat shock are transferred in bacillus coli DH 5 alpha competent cell, and are carried out sequencing identification and obtained super table
Up to carrier pK7WG2.0::GbSLR1, finally the carrier heat shock is transferred in Agrobacterium GV3101.
2. turn the acquisition of GbSLR1 gene arabidopsis
The Agrobacterium for carrying target gene is infected to the Arabidopsis plant of wild type by titbit dip method, collects transgenosis
T0 in the MS cultured on solid medium containing kanamycins, carries out the preliminary screening of positive seedling for seed, and arabidopsis is being cultivated
After the culture a period of time of room, pick out that upgrowth situation is good, and root long and the normal plant of blade carry out continuing to cultivate, culture
Sowing after maturation.Detected by the expression quantity for screening the detection of plant segregation ratio and GbSLR1, as shown in figure 5, single copy turns base
Because of strain L6 expression quantity highests, L8 expression quantity is moderate, will be both as subsequent experimental material.
3. turn the phenotype comparative analysis of GbSLR1 genes arabidopsis and wild type
To probe into the influence that GbSLR1 overexpression grows to arabidopsis, by wildtype Arabidopsis thaliana seed and turn
GbSLR1 genes arabidopsis (overexpression arabidopsis) seed point is on MS culture mediums or MS culture mediums added with GR24, vernalization treatment
After 2-3 days, usable material chamber growth is put into, then counts germination rate daily.As shown in fig. 6, on normal MS culture mediums, strain is overexpressed
Be L6, L8 compared with wild type WT, germination rate on the MS culture mediums containing GR24, overexpresses the sprouting of strain without significant difference
Rate is higher than wild type, illustrates that overexpress plant increases compared to WT lines to the GR24 sensitiveness handled, shows GbSLR1
Gene can promote plant seed germination.Then select the wildtype Arabidopsis thaliana and two that upgrowth situation is consistent on blank MS culture mediums
Individual overexpression Arabidopsis thaliana Seedlings simultaneously put on MS culture mediums or MS culture mediums containing 3 μM of GR24 by vertical pendulum, observation wild type and
The growth differences of two overexpression plant, plant phenotype picture as shown in Figure 7, observed after placing 5 days on MS culture mediums
The root for overexpressing plant is grown compared with wild type, and the root that plant is overexpressed on the MS culture mediums containing GR24 is considerably longer than wild type;Put
Observed after putting 10 days, the difference for overexpressing plant and wild type is mainly reflected in lateral root density, is overexpressed on MS culture mediums
The lateral root density of plant is small compared with wild type, and the root density of overexpression plant is significantly less than wild on the MS culture mediums containing GR24
Type.Also know from root Statistics of Density block diagram as shown in Figure 7, the root density of plant is overexpressed on MS culture mediums compared with wild type
It is low, plant is overexpressed on the MS culture mediums containing GR24 and the root density of wild type decreases, but overexpresses plant to reduce
Much.As fully visible, overexpression GbSLR1 can make plant faster response witchweed lactone signal, show that GbSLR1 participates in unipods
Golden lactone signal approach, and promoting the growth of plant main root and suppressing to work in lateral root growth, and GbSLR1 expression quantity is higher,
This effect is more obvious.
5th, the influence that GbSLR1 grows to arabidopsis Atd14 mutant
Arabidopsis is species biology, has mutant library.Due to arabidopsis Atd14 mutant have much with super table
The growth of the phenotype opposite up to GbSLR1 transgenic arabidopsis, such as main root is suppressed, branch is more, therefore selects its conduct
GbSLR1 gene pairs Atd14 mutant covers experimental study.Arabidopsis Atd14 mutant is taught by China Agricultural University Zhao Liangjun
Present, the mutant is compared with wild type, and mainly plant is short and small, tiller increases, root long is shorter.
Arabidopsis Mutants covering carrier is built using plant expression vector pCAMBIA 1300, by Agrobacterium-mediated Transformation,
Picking positive bacterium colony, arabidopsis Atd14 mutant plants are infected, collect T0 for seed, put in the hygromycin that concentration is 25mg/mL
MS solid mediums carry out screening transgenic material.20 plants of positive Arabidopsis plants are shared by preliminary screening, by these positive seedlings
Further bred and screened, after obtaining T2 generation pure lines plant, selected two of which strain to be observed, be respectively designated as
Covering is Line1 and Line2.Will covering plant (Line1 and Line2), WT lines (WT) and mutant plants
(Atd14) point is in same MS culture mediums.Observed in Seedling Stage, cover plant Line1, Line2 and wild type WT phenotype
Increasingly similar (as shown in Figure 8), root long are recovered normal (as shown in Figure 9), and leaf blade size recovers normal (as shown in Figure 10), petiole
Length is also necessarily recovered (as shown in figure 11).After arabidopsis grows into the maturity period, it is observed that mutant branch increases
More mutant phenotypes, covering plant number of branches significantly reduces compared to mutant, and (as shown in figure 12) similar to WT.Show
GbSLR1 has the function that to promote main root growth, and has developed inhibitory action to plant branching.
It should be noted that experimental implementation involved in above-mentioned experimental example, part Experiment operation is with necessarily general
Property, thus plus it is described in detail, partial content is not described in detail with reference to associative operation in other experimental examples or with reference to prior art,
Repeat no more.
Sequence table
<110>He'nan University
<120>Cotton GbSLR1 genes are in plant roots and the developmental application of branch
<160> 2
<170> SIPOSequenceListing 1.0
<210> 1
<211> 801
<212> DNA
<213>Sea island cotton (Gossypium barbadense)
<400> 1
atggcaaaca cccttttaga agctttgaac gtgcgagttg tcggctccgg cgacagaatc 60
cttgtcttgg ctcacggttt cggtacggac caatcggttt ggcaacggat tctcccattt 120
ttcacaccta attatcgtgt aatcctatac gacctcgttt gtgccggcag cgtcaacccc 180
gattacttcg attccactag gtacgacact ctcgatgctt tcgtcgacga tttgcttaat 240
attcttaaag ctctcggcgt tcaccgttgc gcttacgtcg gccactccgt ctccgccatg 300
atcggtatct tggcttccat tcgctgccct caactcttct ccaaactcat cctcatcggc 360
gcttctccca ggtttctcaa tgacgaaaat taccacggag ggttcgagct aggcgagatt 420
gaggaagtat tttcagcaat ggaagccaat tacgaagctt gggtcaacgg gtttgcccca 480
gtgttggtgg gggccgatgt gccgacagcg gttcgagagt tcagccggac acttttcaac 540
atgagaccgg acatatcatt gttcgtttca aggacgatat tcaacagtga tctgagaggg 600
gaactcggga aagtgagagt gccgtgttgc gtgatccaga cggcgaaaga tgtgtcggtt 660
ccggcatcgg tggcggagta tttaaagacc cgtcttgggg ggcgaaccac ggtggagatt 720
ttgagaacag aaggccattt accgcacttg actgcgccgg tgttgcttgc tcaagtgctt 780
cggcgagccc ttccgcggtg a 801
<210> 2
<211> 266
<212> PRT
<213>Sea island cotton (Gossypium barbadense)
<400> 2
Met Ala Asn Thr Leu Leu Glu Ala Leu Asn Val Arg Val Val Gly Ser
1 5 10 15
Gly Asp Arg Ile Leu Val Leu Ala His Gly Phe Gly Thr Asp Gln Ser
20 25 30
Val Trp Gln Arg Ile Leu Pro Phe Phe Thr Pro Asn Tyr Arg Val Ile
35 40 45
Leu Tyr Asp Leu Val Cys Ala Gly Ser Val Asn Pro Asp Tyr Phe Asp
50 55 60
Ser Thr Arg Tyr Asp Thr Leu Asp Ala Phe Val Asp Asp Leu Leu Asn
65 70 75 80
Ile Leu Lys Ala Leu Gly Val His Arg Cys Ala Tyr Val Gly His Ser
85 90 95
Val Ser Ala Met Ile Gly Ile Leu Ala Ser Ile Arg Cys Pro Gln Leu
100 105 110
Phe Ser Lys Leu Ile Leu Ile Gly Ala Ser Pro Arg Phe Leu Asn Asp
115 120 125
Glu Asn Tyr His Gly Gly Phe Glu Leu Gly Glu Ile Glu Glu Val Phe
130 135 140
Ser Ala Met Glu Ala Asn Tyr Glu Ala Trp Val Asn Gly Phe Ala Pro
145 150 155 160
Val Leu Val Gly Ala Asp Val Pro Thr Ala Val Arg Glu Phe Ser Arg
165 170 175
Thr Leu Phe Asn Met Arg Pro Asp Ile Ser Leu Phe Val Ser Arg Thr
180 185 190
Ile Phe Asn Ser Asp Leu Arg Gly Glu Leu Gly Lys Val Arg Val Pro
195 200 205
Cys Cys Val Ile Gln Thr Ala Lys Asp Val Ser Val Pro Ala Ser Val
210 215 220
Ala Glu Tyr Leu Lys Thr Arg Leu Gly Gly Arg Thr Thr Val Glu Ile
225 230 235 240
Leu Arg Thr Glu Gly His Leu Pro His Leu Thr Ala Pro Val Leu Leu
245 250 255
Ala Gln Val Leu Arg Arg Ala Leu Pro Arg
260 265
Claims (10)
1. application of the cotton GbSLR1 genes in Plant hormone signal response, the hormone is witchweed lactone, described
The nucleotide sequence of GbSLR1 genes and SEQ ID NO.1 sequence similarity more than 90% or the GbSLR1 genes ammonia
Base acid sequence and SEQ ID NO.2 sequence similarity are more than 85%.
2. application of the cotton GbSLR1 genes as claimed in claim 1 in Plant hormone signal response, the GbSLR1 genes
Nucleotide sequence it is identical with SEQ ID NO.1 or the amino acid sequence of the GbSLR1 genes is identical with SEQ ID NO.2, institute
It is cotton or arabidopsis to state plant.
3. application of the cotton GbSLR1 genes in plant seed germination is promoted, the nucleotide sequence of the GbSLR1 genes with
SEQ ID NO.1 sequence similarity is more than 90% or the amino acid sequence of the GbSLR1 genes is with SEQ ID NO.2's
Sequence similarity is more than 85%.
4. application of the cotton GbSLR1 genes as claimed in claim 1 in plant seed germination is promoted, the GbSLR1 genes
Nucleotide sequence it is identical with SEQ ID NO.1 or the amino acid sequence of the GbSLR1 genes is identical with SEQ ID NO.2, institute
It is cotton or arabidopsis to state plant.
5. cotton GbSLR1 genes promote plant main root growth in application, the nucleotide sequence of the GbSLR1 genes with
SEQ ID NO.1 sequence similarity is more than 90% or the amino acid sequence of the GbSLR1 genes is with SEQ ID NO.2's
Sequence similarity is more than 85%.
6. application of the cotton GbSLR1 genes as claimed in claim 3 in the growth of plant main root is promoted, the GbSLR1 genes
Nucleotide sequence it is identical with SEQ ID NO.1 or the amino acid sequence of the GbSLR1 genes is identical with SEQ ID NO.2, institute
It is cotton or arabidopsis to state plant.
7. cotton GbSLR1 genes suppress plant lateral roots growth in application, the nucleotide sequence of the GbSLR1 genes with
SEQ ID NO.1 sequence similarity is more than 90% or the amino acid sequence of the GbSLR1 genes is with SEQ ID NO.2's
Sequence similarity is more than 85%.
8. application of the cotton GbSLR1 genes as claimed in claim 5 in plant lateral roots growth is suppressed, the GbSLR1 genes
Nucleotide sequence it is identical with SEQ ID NO.1 or the amino acid sequence of the GbSLR1 genes is identical with SEQ ID NO.2, institute
It is cotton or arabidopsis to state plant.
9. cotton GbSLR1 genes suppress the application of branch, the nucleotide sequence of the GbSLR1 genes in plant branching development
With SEQ ID NO.1 sequence similarity more than 90% or the amino acid sequence of the GbSLR1 genes and SEQ ID NO.2
Sequence similarity more than 85%.
10. cotton GbSLR1 genes as claimed in claim 7 suppress the application of branch, the GbSLR1 in plant branching development
The nucleotide sequence of gene is identical with SEQ ID NO.1 or the amino acid sequence of the GbSLR1 genes and SEQ ID NO.2 phases
Together, the plant is cotton or arabidopsis.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201711135400.3A CN107653252B (en) | 2017-11-16 | 2017-11-16 | Application of cotton GbSLR1 gene in plant root and branch development |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201711135400.3A CN107653252B (en) | 2017-11-16 | 2017-11-16 | Application of cotton GbSLR1 gene in plant root and branch development |
Publications (2)
Publication Number | Publication Date |
---|---|
CN107653252A true CN107653252A (en) | 2018-02-02 |
CN107653252B CN107653252B (en) | 2021-07-06 |
Family
ID=61121425
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201711135400.3A Active CN107653252B (en) | 2017-11-16 | 2017-11-16 | Application of cotton GbSLR1 gene in plant root and branch development |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN107653252B (en) |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN109628475A (en) * | 2019-01-22 | 2019-04-16 | 中国农业科学院郑州果树研究所 | Brassinosteroid synthesizes purposes of the gene PaCYP724B1 in regulation plant branching |
Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN105849104A (en) * | 2013-10-25 | 2016-08-10 | 阿西洛玛生物公司 | Strigolactone formulations and uses thereof |
-
2017
- 2017-11-16 CN CN201711135400.3A patent/CN107653252B/en active Active
Patent Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN105849104A (en) * | 2013-10-25 | 2016-08-10 | 阿西洛玛生物公司 | Strigolactone formulations and uses thereof |
Non-Patent Citations (4)
Title |
---|
HIDEMITSU NAKAMURA等: "Molecular mechanism of strigolactone perception by DWARF14", 《NATURE COMMUNICATIONS》 * |
LORENZO ALEMAN等: "Functional analysis of cotton orthologs of GA signal transduction factors GID1 and SLR1", 《PLANT MOL BIOL》 * |
MARK T. WATERS等: "Specialisation within the DWARF14 protein family confers distinct responses to karrikins and strigolactones in Arabidopsis", 《DEVELOPMENT》 * |
ZHANG,S.等: "Gossypium barbadense dwarf 14 mRNA, complete cds", 《NCBI》 * |
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN109628475A (en) * | 2019-01-22 | 2019-04-16 | 中国农业科学院郑州果树研究所 | Brassinosteroid synthesizes purposes of the gene PaCYP724B1 in regulation plant branching |
CN109628475B (en) * | 2019-01-22 | 2022-06-21 | 中国农业科学院郑州果树研究所 | Application of brassinolide synthetic gene PaCYP724B1 in regulation and control of plant branches |
Also Published As
Publication number | Publication date |
---|---|
CN107653252B (en) | 2021-07-06 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN109456982B (en) | Application of rice OsMYB6 gene and encoding protein thereof in drought resistance and salt resistance | |
CN108004255A (en) | The coded sequence of rice cell mitogen oxidation/dehydrogenase gene OsCKX4 and its application | |
CN112812163A (en) | Application of transcription factor in rice breeding and rice breeding method | |
CN113621625B (en) | Application of sesame SiERF103 gene in enhancing plant resistance | |
CN113088526B (en) | Heat shock related gene ZmHsf11 and application thereof in regulation and control of plant heat resistance | |
CN106749577B (en) | Stress tolerance associated transcription factor protein NAC and application thereof | |
CN114686494B (en) | SlERF.H2 gene and application of protein encoded by same in regulation and control of salt tolerance of tomatoes | |
CN114990137B (en) | Arabidopsis thaliana calbindin gene AtCAREF and application thereof | |
CN107653252A (en) | Cotton GbSLR1 genes are in plant roots and the developmental application of branch | |
CN107573411B (en) | Application of wheat TaZIM1-7A protein in regulation and control of crop heading period | |
CN116064568A (en) | Alfalfa MsASG166 gene and application thereof in improving drought tolerance of plants | |
Miao et al. | Genome-wide analysis of the AINTEGUMENTA-like (AIL) transcription factor gene family in pumpkin (Cucurbita moschata Duch.) and CmoANT1. 2 response in graft union healing | |
CN114657188A (en) | Gene PK1 for regulating and controlling rice cadmium accumulation, protein and application thereof | |
CN114480341A (en) | Application of poncirus trifoliata protein kinase PtrSnRK2.4 in drought-resistant genetic improvement of plants | |
CN114277041A (en) | Application of soybean gibberellin 3 beta-hydroxylase encoding gene GmGA3ox1 | |
CN106834340A (en) | A kind of method for obtaining the rape material for being adapted to high-density planting and mechanized harvest | |
CN110468138B (en) | Gene TSG2 for controlling cold resistance of rice and application thereof | |
CN114107333B (en) | Application of barley receptor kinase HvSERK1 in root hair growth | |
CN117568289B (en) | Protein for resisting soybean cyst nematode disease, encoding gene and application thereof | |
CN115094072B (en) | Populus tomentosa PtYABBY7 gene and application thereof | |
CN116622725B (en) | Hybrid tulip tree LhMFT2 gene and application | |
CN114561404B (en) | Apple MdSHN1 gene and application thereof in improving waterlogging tolerance of plants | |
CN114958870B (en) | Application of GmPTF1a/b gene in regulation and control of soybean nodulation | |
CN101906426A (en) | Method for regulating plant photoperiod by combining soybean gibberellin with protein gene | |
CN107142261B (en) | Promoter specifically expressed in young ears of rice and application thereof |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PB01 | Publication | ||
PB01 | Publication | ||
SE01 | Entry into force of request for substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
GR01 | Patent grant | ||
GR01 | Patent grant |