CN107641629B

CN107641629B - Bacillus caldarius halotolerant gene rdd and identification method thereof

Info

Publication number: CN107641629B
Application number: CN201710731793.8A
Authority: CN
Inventors: 姜巨全; 邵丽; 孟琳; 陈金; 王利丹; 李金城; 闫明雪
Original assignee: Northeast Agricultural University
Current assignee: Northeast Agricultural University
Priority date: 2017-08-23
Filing date: 2017-08-23
Publication date: 2020-03-10
Anticipated expiration: 2037-08-23
Also published as: CN107641629A

Abstract

The invention belongs to the technical field of molecular biology and genetic engineering, and discloses a bacillus adapalensis saline alkali tolerant gene rdd and an identification method thereof, wherein the bacillus adapalensis saline alkali tolerant gene rdd comprises a 534bp complete open reading frame ORF, and the nucleotide sequence of the ORF is SEQ ID NO. 1; the identification method comprises the following steps: screening saline-alkali tolerance related gene segments, and constructing a prokaryotic expression vector containing rdd gene; the gene rdd is introduced into a KNabc host by transforming a heterologous host Escherichia coli KNabc, and the physiological function and the coded protein activity of the gene rdd are identified. The rdd gene provided by the invention has important significance for improving saline-alkali soil, and can be used for the research of the transgenic field for constructing high-efficiency saline-alkali resistant engineering bacteria, developing microbial fertilizers and improving the saline-alkali resistance of plants.

Description

Bacillus caldarius halotolerant gene rdd and identification method thereof

Technical Field

The invention belongs to the technical field of molecular biology and genetic engineering, and particularly relates to a saline-alkali tolerant gene rdd of bacillus adamsii and an identification method thereof.

Background

With global warming, the salinization of the soil in arid and semi-arid regions is increasingly serious, which is characterized in that the area of the salinized land is continuously expanded, the salinization degree is increasingly intensified, the heavily salinized land is in a growing trend, the area of the alkali spots without utilization value is enlarged, and the improvement of the land productivity and the national economic development are seriously influenced. At present, more than 100 countries in the world have different types of saline-alkali soil of 10 hundred million hm²And accounts for about 10% of the total arable land area. The area of the saline-alkali soil in China reaches 9913 kilohm²The fertilizer is mainly distributed in arid and semiarid regions such as North China, northwest China and northeast China. The original saline-alkali soil area of the tender and flat parts of the northeast of China is more than 370 ten thousand hm²Is one of three concentrated distribution areas of sodium bicarbonate in the world. Meanwhile, the area of secondary salinized soil is also rapidly increased due to the causes of industrial pollution, unreasonable irrigation, improper fertilizer use and the like. Saline-alkali soil affects vegetation growth, so that crop yield is reduced or crop harvest is avoided, and ecological environment is deteriorated indirectly.

At present, the saline-alkali soil improvement needs a plurality of disciplines to be jointly attacked and customed to complete. From the biological point of view, the main method starts from the microorganisms and the plants at the same time, and the efficient salt-tolerant microorganisms and the plants have synergistic action. Research shows that compared with chemical fertilizers, the application of the microbial fertilizers such as azotobacter, rhizobium and the like has more obvious effect on promoting the saline-alkali soil improvement of high-efficiency saline-alkali tolerant plants. However, many plants cannot directly obtain carbon and nitrogen sources poor in saline-alkali soil, and only chemical fertilizers are applied, so that a more serious environmental disaster is caused.

The microbial fertilizer and the plant which can be used for soil improvement do not have the capacity of resisting high saline alkali, which is a difficult problem in the prior art. Therefore, in addition to the development of efficient saline-alkali tolerant microorganisms and plant resources, the large-scale development of efficient saline-alkali tolerant new functional genes for constructing corresponding genetic engineering strain microbial fertilizers and transgenic plants is very important.

In prokaryotes, the Na + -dependent transporter is the Na +/H + antiporter, and the secondary transporter can facilitate the excretion of sodium ions and the entry of protons, thus regulating the sodium ion and pH homeostasis under alkaline conditions. Since the Na +/H + transporters simultaneously have Li +/H + transporter activity, they are also referred to as Na + (Li +)/H + antiporters. Some of these reports show simultaneous K +/H + antiporters. Since the ant gene of E.coli was first found to affect the host's Na +/H + antiporter activity, the gene named nhaA, Na + (Li +)/H + antiporter or having Na + (Li +)/H + antiporter activity was increasingly cloned and functionally characterized in EP432 or KNabc, which E.coli mutants lack two or three antiporters. In combination with the number of encoding genes and the specificity of the substrate, Na +/H + antiporters fall into two broad categories: one class of Na +/H + antiporters, primarily for Na + and Li +, is encoded by a single gene, e.g., nhaA, nhaB, nhaC, nhaD, nheE, napA, nhaP, nhaG, or nhaH, equally divided into the monovalent cation/proton antiporter type 1 family (CPA-1) and the NapA K +/H + antiporters are highly identical, and classified as the CPA-2 family. Another class of monovalent cation/proton antiporters with substrates for Na + and Li +, sometimes used for K +, is encoded by polycistronic operons containing six or seven genes, named, e.g., mrp, mnh, pha2 or sha, which are grouped into the CPA-3 family due to their unique multigenic structural properties. In addition to the two main classes mentioned above, there are also some non-specific Na +/H + antiporters that continue to show Na +/H + antiporter activity. For example, ChaA classified as the CPA-1 family is reported to have Ca2+ (Na +)/H + and K +/H + antiporter activities. MleN, a novel HCT (2-hydroxy-carboxylate transporter) family transporter, exhibits Na +/H + antiporter activity while having the activity to exchange cytosolic lactate and periplasmic malate. A unique tetracycline/H + antiporter, TetA (L), belongs to the MF (majorfacilator) family, a primary Na + pump, Nap belongs to the NDH (NADH dehydrogenase) family and is reported to have Na +/H + antiporter activity. The E.coli multidrug resistance (MDR) protein, MdfA, belonging to the MF family with a broad specificity MDR phenotype was also characterized as exhibiting Na + (K +)/H + antiporter activity. The putative Paired Small Multidrug Resistance (PSMR) family protein PsmrAB as a homolog of YvdSR is characterized primarily as a novel bi-component Na +/H + antiporter.

Therefore, the separation of the salt-resistant gene is the primary task of salt-resistant crop cultivation by using a genetic engineering method at present.

In summary, the problems of the prior art are as follows:

the prior art has the defects that the microbial fertilizer and the plant which can be used for soil improvement do not have high-efficiency saline-alkali resistance, theoretical basis is lacked in the aspect of digging high-efficiency saline-alkali resistance new functional genes in a large scale to construct corresponding genetic engineering strain microbial fertilizer and transgenic plant, and an effective identification method is lacked in the aspect of cultivating salt-resistant crops.

Disclosure of Invention

Aiming at the problems in the prior art, the invention provides a saline-alkali resistant gene rdd of bacillus adamsii and an identification method thereof. An efficient saline-alkali resistant gene rdd of the bacillus adaptis is discovered by utilizing an innovative technical means for constructing a gene library, the saline-alkali resistant gene rdd of the bacillus adaptis contains a complete open reading frame ORF, the nucleotide sequence of the ORF is SEQID No.1, and an efficient salt-tolerant strain is constructed by a novel genetic engineering means, so that efficient soil improvement microorganisms and plants are cultured.

The invention also aims to provide a protein encoded by the saline-alkali tolerant gene rdd of the bacillus adamsii, wherein the nucleotide sequence is SEQ ID NO. 2.

Further functional verification shows that the protein has Na in fluorescence quenching experiment⁺(Li⁺、K⁺)/H⁺Antiporter activity, and Na⁺(Li⁺、K⁺)/H⁺Antiporter activity is pH dependent.

The invention also aims to provide a method for identifying the saline-alkali tolerance gene rdd of the bacillus adamsii, which comprises the following steps:

(1) through a screening technology of combining a gene library with gene function complementation, a gene fragment related to salt and alkali tolerance is obtained from bacillus adatanshii, wherein the gene fragment related to salt and alkali tolerance contains a complete open reading frame ORF of a rdd gene with the length of 534bp, and the nucleotide sequence of the ORF is shown as SEQ ID No. 1;

(2) constructing a prokaryotic expression vector containing rdd gene;

(3) the gene rdd is transformed into a KNabc host by transforming a heterologous host Escherichia coli KNabc by an electric transformation method, and the physiological function and the coded protein activity of the gene rdd are identified.

Further, constructing prokaryotic expression vectors containing rdd genes, wherein the prokaryotic expression vectors comprise prokaryotic expression vectors pET28b-rdd and pET22 b-rdd; the prokaryotic expression vector pET28b-rdd and pET22b-rdd are constructed by the following method:

according to the Rdd gene sequence, firstly, utilizing Primer5 software to design Rdd-F/Rdd-R specific primers, respectively introducing Nde I and XhoI enzyme cutting sites at the 5 'end and the 3' end of the gene, then carrying out PCR amplification of the Rdd gene, and carrying out subcloning on the Rdd gene;

purifying the PCR amplification product by adding A, connecting the PCR amplification product to a cloning vector pEASY-T3, transforming the PCR amplification product into a Trans1-T1 competent cell, and carrying out blue-white screening on the transformation product;

carrying out enzyme digestion identification on the pEASY-Rdd recombinant plasmid by using restriction enzyme; to further determine the accuracy of the sequence, the insert ligated into the cloning vector pEASY-T3 was sequenced.

Further, the subcloning of the Rdd gene includes:

RDD subclone NdeI-XhoI is built into pET28bNdeI-XhoI, then BglII-XhoI is used for building into pET22, transformation is carried out into Escherichia coli KNabc, recombinant plasmid pET22b-Rdd is obtained, double enzyme digestion verification is carried out on RDD fragment inserted into saline-alkali resistant gene of Bacillus adapti, and gene sequencing is carried out on plasmid with correct enzyme digestion result.

Another objective of the invention is to provide a protein with Na + (Li +)/H + antiporter constructed by utilizing the bacillus adapti halophilic alkali-tolerant gene rdd.

The invention also aims to provide a saline-alkali resistant engineering bacterium constructed by the saline-alkali resistant gene rdd of the bacillus adamsii.

The invention also aims to provide a developed microbial fertilizer prepared by the saline-alkali tolerant gene rdd of the bacillus adamsii.

The invention also aims to provide a saline-alkali resistant transgenic plant prepared by the saline-alkali resistant gene rdd of the bacillus adamsii.

The invention has the advantages and positive effects that:

the invention randomly screens related genes related to Na + output from the genome of Bacillus adaptilis based on a gene library screening method and a sodium ion tolerance function complementation method, further determines valuable genes through sequencing analysis and physiological and biochemical experiments, preliminarily verifies the ion transport mechanism of the genes through identification of the ion transport function and positioning and analysis of self protein, and further obtains a novel Na +/H + antiporter protein. The Ha _ RDD is a novel Na +/H + antiporter which is excavated and identified for the first time, salt and alkali resistant strains are constructed efficiently, the success rate is up to one hundred percent, and the method saves 60 percent of technical cost.

Compared with the traditional technology, the invention discloses the identification and the application of the saline-alkali resistant gene of bacillus adahli for the first time, obtains the nucleotide sequence shown by SEQID NO.1 in the sequence table from the bacillus adahli, and can obtain the recombinant vector and the host cell containing the gene.

The invention starts from molecular biology and genetic engineering technology, constructs high-efficiency saline-alkali tolerant genetic engineering strains and transgenic plants, and obtains saline-alkali tolerant microorganisms and plants for soil improvement. Since bacteria and plants have great similarities in salt and alkali tolerance, they all accumulate similar compounds in cells under hypertonic conditions. Therefore, the construction of the high-efficiency saline-alkali tolerant bacterial resource pool and the discovery of key new functional genes can solve the problem of constructing saline-alkali tolerant bacterial genetic engineering strains, and the excellent high-efficiency saline-alkali tolerant bacterial genes can provide important gene resource reserve for constructing high-efficiency saline-alkali tolerant transgenic plants, which is the core value of the invention.

Drawings

FIG. 1 is a flow chart of the method for identifying the halophilic bacillus anserinus salt tolerance gene rdd provided by the embodiment of the invention.

In the figure: A. predicting a transmembrane region of the protein; B. and (4) analyzing the hydrophobicity of the protein.

FIG. 2 is a flow chart of the construction of a prokaryotic expression vector pET-22b-rdd of Ha _ rdd gene provided by the embodiment of the invention;

FIG. 3 is an electrophoretic map of the construction of a Ha _ rdd gene expression vector as provided in the examples of the present invention;

in the figure: results of PCR products from Ha _ rdd gene (rdd PCR products in lanes 1-6); B. pEASY-T3-rdd; pEASY-rdd identification (1, 2: pEASY-rdd digested by EcoRI,3, 4: pEASY-T3 digestedbyEcoRI as control); pEasy-T3-rdd digested by NdeI-XhoI; e.1-4: pET-28b-RDD, 5: pET-28b control; f.1, pET-28b-RDD digested by XhoI and NdeI 2, pET-28b enzyme digestion control; g.1 pET-

22b controls

2, 3, 4, 5: pET-22 b-RDD; pET-22b-RDD restriction enzyme identification (1: pET-22b

restriction enzyme control

2, 3, 4, 5: pET-22b-RDD digest by BglII-XhoI).

FIG. 4 is a diagram showing the identification of the physiological function of Ha _ rdd gene provided in the examples of the present invention;

FIG. 5 is a Ha _ rdd phylogenetic tree diagram provided by an embodiment of the present invention;

◆ Amaranthus blifolius RDD protein, ◇ other homologous protein members of the RDD family, ▲ known protein with sodium/hydrogen antiporter activity, ● known sodium/hydrogen antiporter protein;

FIG. 6 is a homology alignment of Ha _ RDD proteins provided by an embodiment of the invention;

in the figure: ━ denotes the transmembrane region

FIG. 7 is a graph depicting the identification of Ha _ RDD protein activity provided by an embodiment of the present invention;

in the figure: A.Na⁺/H⁺Antiport activity, B.Li⁺/H⁺Antiporter Activity, C.K⁺/H⁺Reverse transport activity;

FIG. 8 is a pH profile of Ha _ RDD protein activity provided by an example of the invention;

FIG. 9 is a Ha _ RDD vs. Na representation provided by an embodiment of the present invention⁺、Li⁺、K⁺(ii) an affinity diagram;

FIG. 10 shows K for Ha _ RDD provided by an embodiment of the present invention⁺/H⁺An identification profile of activity;

FIG. 11 is a cellular map of the Ha _ RDD protein provided by an embodiment of the present invention;

in the figure: m is a prestained protein molecular weight standard marker,

lanes

1, 3 and 5 are corresponding samples expressing RDD protein, and

lanes

2, 4 and 6 are corresponding samples of negative control.

Detailed Description

In order to make the objects, technical solutions and advantages of the present invention more apparent, the present invention is further described in detail with reference to the following embodiments. It should be understood that the specific embodiments described herein are merely illustrative of the invention and are not intended to limit the invention.

The invention randomly screens related genes related to Na + output from the genome of Bacillus adaptilis based on a gene library screening method and a sodium ion tolerance function complementation method, further determines valuable genes through sequencing analysis and physiological and biochemical experiments, preliminarily verifies the ion transport mechanism of the genes through identification of the ion transport function and positioning and analysis of self protein, and further obtains a novel Na +/H + antiporter protein. The Ha _ RDD of the invention is a novel Na +/H + antiporter which is excavated and identified for the first time.

The following detailed description of the principles of the invention is provided in connection with the accompanying drawings.

The saline-alkali tolerant gene rdd of the bacillus adamsii provided by the embodiment of the invention comprises a 537bp complete open reading frame ORF, and the nucleotide sequence of the ORF is shown as SEQ ID No. 1.

The nucleotide sequence of the protein coded by the rdd gene of the bacillus adamsii provided by the embodiment of the invention is shown in SEQ ID No. 2.

The protein coded by the rdd gene of the bacillus adamsii shows obvious Na in a fluorescence quenching experiment⁺(Li⁺、K⁺)/H⁺Antiporter activity, and the above activity is pH dependent.

The protein encoded by Bacillus amdahliae RDD belongs to the RDD protein family (thisfield of proteins in three high level conserved amino acids: one arginine (R) and two aspartates (D), the science of the name of RDD family) with unknown functions, which are not annotated in the NCBI protein database. RDD is prokaryotic expression protein of the RDD gene of Bacillus caldarius.

The identification method of the bacillus adamsii haloduran gene rdd provided by the embodiment of the invention comprises the following steps:

(2) constructing a prokaryotic expression vector containing rdd gene;

(3) the rdd gene is introduced into a KNabc host by transforming a heterologous host Escherichia coli KNabc, and the physiological function and the protein activity of the rdd gene are identified.

The application of the principles of the present invention will now be described in further detail with reference to specific embodiments.

Example 1. on-line biological software analysis of the transmembrane domain and hydrophobicity of the Ha _ RDD protein, as shown in FIG. 1;

according to the invention, bioinformatics analysis is carried out on a protein sequence coded by an online prediction website http:// www.cbs.dtu.dk/services/TMHMM-2.0/http:// web.expasy.org/protscale/RDD gene, and the protein RDD coded by the gene is found to have three transmembrane regions and presents high hydrophobicity.

Example 2. the construction scheme for Ha _ rdd Gene prokaryotic expression vectors pET28b-rdd, pET22b-rdd, is shown in FIG. 2;

based on the rdd gene sequence, rdd-F/rdd-R specific primers (shown in Table 1) were first designed using Primer5 software, SEQ ID NO. 3: rdd-F: CATATGGATACAGTAGAACCCAC, respectively;

SEQID NO.4：rdd-R：CTCGAGTTAATCTACAGAAGATTCAA。

and Nde I and XhoI restriction sites are respectively introduced into the 5 'end and the 3' end of the gene, and then Rdd gene amplification is carried out (shown in a table 2), and the Rdd gene is subcloned.

TABLE 1 rdd Gene expression vector construction primer sequences

TABLE 2 PCR amplification reactions

The PCR product is added with A for purification, then is connected to a cloning vector pEASY-T3 and is transformed into a Trans1-T1 competent cell, and the transformed product is subjected to blue-white screening. As shown in FIG. 3, the comparison of the size of the PCR product, Rdd (547bp), with that of the DNA Marker, should match the actual length of the PCR product. To further determine whether the pEASY-Rdd recombinant plasmid was correct, restriction enzyme digestion was performed. As can be seen from FIG. 3, the size of the fragment generated by double digestion is substantially identical to that of the PCR product, and in order to further determine the accuracy of the sequence, the inserted fragment is sequenced, and the sequencing result is identical to the original sequence. The above results indicate that the Rdd gene was successfully inserted into the pEASY T3 vector.

RDD subclone (NdeI-XhoI) is built into pET28b (kana resistance) (NdeI-XhoI), then BglII-XhoI is used for constructing pET22b (ampicillin resistance) and is transformed into Escherichia coli (E.coli) KNabc to obtain a recombinant plasmid pET22b-Rdd, double enzyme digestion verification is carried out on the inserted fragment, the plasmid with correct enzyme digestion result is subjected to gene sequencing, and the sequencing result is consistent with the original sequence. The success of construction of the recombinant plasmid pET22b-Rdd was demonstrated (FIG. 3).

Example 3 identification of physiological function of Ha _ rdd Gene:

in order to identify the physiological function of Ha _ rdd gene, the present invention uses KNabc/pUC18 as negative control, and the bacterial liquid of original clone KNabc/pUC-SL38 was inoculated at 1% of the original clone into fresh LBK medium containing different salt concentrations (0-0.2M NaCl or 50mM LiCl) and cultured for 24 h. The results are shown in FIGS. 4A-D: under the stress of 0.2M NaCl or 5mM LiCl, the subcloned KNabc/pET22-rdd and the original KNabc/pUC-SL38 both restored the growth of the salt-sensitive mutant KNabc and their growth trends were substantially consistent compared with the negative control. In an alkaline environment (see FIGS. 4E-F), the original clone KNabc/pUC-SL38 restored growth of the salt-sensitive mutant KNabc when 50mM NaCl at pH8 was added, and in an environment of pH 8.5 without NaCl. This indicates that rdd gene has obvious saline-alkali tolerance.

Example 4 bioinformatic analysis of rdd Gene expression proteins

The physicochemical properties of proteins encoded by Ha _ rdd genes are as follows:

the basic physicochemical properties of rdd gene-encoded protein were predicted and analyzed using ExPASy Protparam. The results show that: the saline-alkali tolerant gene rdd encodes 178 amino acids, has the relative molecular weight of 20.42306kD and the isoelectric point of 9.26, and is alkaline protein; the atoms formed are C (948) H (1493) N (243) O (248) S (5), the total number of 2937 atoms, the theoretical half-life period is 30H, the instability parameter is 25.08, the protein is stabilized, the amino acids have 18 positively charged amino acids (Arg and Lys) and 15 negatively charged amino acids (Asp and Glu). The amino acid composition of the ASP protein (Table 3) showed that the neutral hydrophobic amino acid, the hydrophilic amino acid, the acidic amino acid, and the basic amino acid were 58.9%, 36.5%, 8.4%, and 13.5%, respectively. The result shows that the protein coded by the halokaline resistant gene rdd has certain hydrophobic capability and is stable.

TABLE 3 amino acid composition of protein encoded by Ha _ rdd Gene

Two, Ha _ RDD phylogenetic evolutionary tree

Phylogenetic distance analysis was performed on RDD family proteins, known sodium/hydrogen antiporters or proteins with sodium/hydrogen antiporter activity using the Neighbor-Joining algorithm. The results show (fig. 5): RDD aggregates with other proteins of the same family on a cluster of 96% branches that have evolved far from the known sodium/hydrogen antiporters or protein systems with sodium/hydrogen antiporter activity. Therefore, the RDD is considered to be a novel sodium/hydrogen antiporter by the invention.

Homology alignment of three, Ha _ RDD and homologs

The invention selects 24 homologous proteins which are most similar to the BLAST database with 40% -60% of homology to carry out multiple sequence alignment (figure 6), and as a result, the following results are found: ha _ RDD is highly conserved with these homologs R35, D42, R124, R129, D154, D158 amino acids.

Example 5 identification of Ha _ RDD protein function

Identification of Activity of Ha _ RDD protein

The invention prepares KNabc cells containing pET-RDD and pET22b into a reverse membrane by using a French cell crusher, uses acridine orange as a fluorescent indicator, and detects Na of the acridine orange⁺(Li⁺，K⁺)/H⁺Antiporter activity (fig. 7). As a result, it was found that: the fluorescence of the inversion membrane KNabc/pET-RDD increased by adding a single monovalent cation solution at the lowest equilibrium point of fluorescence quenching (FIG. 7-A)&B&Left side of C), while the negative control, KNabc/pET22b, showed no change in fluorescence value after addition of monovalent cation solution (FIG. 7-A)&B&C right). Therefore, we consider Ha _ RDD as having transport Na⁺(Li⁺、K⁺)/H⁺Antiporter active.

pH Profile of Activity of the two, Ha _ RDD protein

The sodium/hydrogen antiporter is pH-dependent, i.e.its transport activity changes with the pH in the environment. Therefore, the protein activity of Ha _ RDD is detected in the reaction system with different pH values (6.5-9.5). As a result, it was found that: ha _ RDD vs Na in the pH range of 7.0-9.0⁺、Li⁺、 K⁺The transport activity of (A) will change with the change of pH (the trend is shown in FIG. 8), and when the pH in the reaction system is 9.0, the ion transport activity of RDD is the highest, and there is a certain difference in the transport activity of three different ions.

Three, Ha _ RDD pair Na⁺、Li⁺、K⁺Affinity of (2)

Due to Ha _ RDD pair Na⁺、Li⁺、K⁺The three ion transport capacities are distinct, i.e., differ in substrate preference. When K is_0.5Lower values indicate better transport preference for a substrate. Therefore, the invention calculates K by originPro 8.6 data analysis software_0.5Values (fig. 9). It was found that Na when the transport activity reached half of the maximum reactivity⁺、Li⁺、K⁺K of_0.5Values were 1.29. + -. 0.14mM, 1.89. + -. 0.20mM, 1.37. + -. 0.21mM, respectively, in other words Ha _ RDD vs Na⁺The preference of the ion pair is preferably from strong to weak: na (Na)⁺>K⁺>Li⁺。

Example identification of KCl Activity of the six Ha _ RDD protein

The invention utilizes pUC18 and pUC-NhaD as negative controls and pUC-UmP-AB as positive controls to identify the KCl activity of Ha _ RDD protein. When the OD was 0.1, the medium was inoculated at 1% to different pH media of 0M LBK without KCl and normal, respectively, pUC-UmP-AB and pUC-SL38 grew slightly at pH8.0 of the medium without KCl, grew well at pH8.0 of the medium with 0M LBK, and the negative control growth was inhibited (FIG. 10A)&B) In the present invention, it was found that FIG. 10C pUC-SL38 can restore growth in 1.0M1.2MKCl, while others are inhibited, therefore the present invention demonstrates that Ha _ RDD protein has K⁺And (4) activity.

Example cellular localization of seven Ha _ RDD proteins

The invention separates cytoplasmic protein and membrane protein of KNabc/pET22-rdd cells by using a super-separation method, and detects the extracted cell holoprotein (ultrasonic disruption supernatant), the cytoplasmic protein (super-separation supernatant) and the membrane protein (super-separation precipitate) respectively by using a technical means of Western Blot (WB for short). Theoretically, the WB assay only detected the band of interest (i.e., the tag antibody signal carried by Ha _ RDD) in the whole cell protein (sonicated supernatant) and membrane protein (ultraprecipitated) samples prepared, whereas the cytoplasmic protein (ultrasupernatant) sample did not detect the band of interest.

Found (fig. 10): first, Ha _ RDD protein was detected only as bands in the whole and membrane protein samples of cells (B-1, 5) compared to the negative controls (B-2, 4, 6), but not in the cytoplasmic protein sample (B-3), and, taken together, Ha _ RDD was indeed a membrane protein localized on the inner membrane, which was mutually corroborated with its previous analysis.

The above description is only for the purpose of illustrating the preferred embodiments of the present invention and is not to be construed as limiting the invention, and any modifications, equivalents and improvements made within the spirit and principle of the present invention are intended to be included within the scope of the present invention.

Claims

1. The bacillus adamsii saline-alkali tolerant gene rdd is characterized in that the bacillus adamsii saline-alkali tolerant gene rdd contains a 537bp complete open reading frame ORF, and the nucleotide sequence of the ORF is SEQ ID No. 1.

2. A protein encoded by the saline-alkali tolerant gene rdd of bacillus adamsii of claim 1, wherein: the amino acid sequence is SEQ ID NO. 2.

3. The protein of claim 2, wherein said protein has Na in a fluorescence quenching assay⁺/H⁺Antiporter activity, Li⁺/H⁺Antiporter activity or K⁺/H⁺Antiporter activity, which is pH dependent.

4. Na expressed by using the salt-alkali tolerance gene rdd of the bacillus adamsii of claim 1⁺/H⁺Reverse transport Activity or Li⁺/H⁺An active protein for retrograde transport.

5. A saline-alkali resistant engineering bacterium constructed by utilizing the saline-alkali resistant gene rdd of the bacillus adamsii of claim 1.

6. A microbial fertilizer prepared by using the saline-alkali tolerant gene rdd of Bacillus adamsii of claim 1.