CN107614762B

CN107614762B - Single-chain variant fragment antibody library expressed by phage

Info

Publication number: CN107614762B
Application number: CN201680009046.7A
Authority: CN
Inventors: 杨安綏; 陈鸿森; 陈英谦; 董昭萍; 侯信成; 余忠銘; 杨淇凯; 邱奕凯
Original assignee: Central Research Institute In Taiwan
Current assignee: Central Research Institute In Taiwan
Priority date: 2015-02-24
Filing date: 2016-02-23
Publication date: 2022-08-05
Anticipated expiration: 2036-02-23
Also published as: EP3514181A1; CN107614762A; US20180009877A1; EP3262216A2; WO2016137992A2; WO2016137992A3; EP3262216A4; TW201632547A; TWI636060B; US10336816B2

Abstract

The present disclosure relates to a phage-expressed scFv antibody library comprising a plurality of phage-expressed scFv, each scFv characterized by: (1) having a specific canonical structural combination; (2) each complementarity determining region having a specific distribution of aromatic residues; and (3) each complementarity determining region has a specific sequence. The libraries of single-chain variant fragment antibodies of the present disclosure can be used to efficiently prepare different antibodies that bind to different antigens. Accordingly, the present disclosure provides a method for preparing different antibodies against different antigens in real time in response to the requirements of experimental research and/or clinical application.

Description

Single-chain variant fragment antibody library expressed by phage

Technical Field

The present disclosure relates to antibody libraries comprising different antibody fragments. More specifically, the present disclosure relates to a phage-expressed single-chain variable fragment (scFv) antibody library and uses thereof.

Background

Antibodies, also known as immunoglobulins, are large molecular weight Y-type proteins produced by plasma cells (plasma cells) of the immune system responsible for the recognition and neutralization of foreign substances such as bacteria and viruses. Antibodies can recognize specific sites in foreign targets, commonly referred to as antigens. The Y-type structure of the antibody contains an antigen binding site (paratope) at each end, which specifically binds to a specific epitope (epitope) on the antigen, thereby allowing the antigen and antibody structures to be accurately bound together. By virtue of this binding mechanism, an antibody targets a microorganism or an infected cell, thereby assisting other components of the immune system in subsequent challenge, or directly neutralizes the target (e.g., blocks a portion of a microorganism that is used to invade the subject or survive). The main function of the human humoral immune system (humoral immune system) is to produce antibodies.

Antibodies are generally composed of basic building blocks; in general, an antibody has two heavy chains of greater molecular weight and two light chains of lesser molecular weight. Five heavy chains are known, designated α (alpha), δ (delta), ε (epsilon), γ (gamma) and μ (mu), respectively. Depending on the heavy chain type, antibodies of different isotypes (isotype) are produced, which are immunoglobulin a (IgA), immunoglobulin D (IgD), immunoglobulin E (IgE), immunoglobulin G (IgG), and immunoglobulin M (IgM). Each heavy chain has two regions: constant region (CH) and variable region (VH). The same isotype antibody has the same constant region, while different isotypes have different constant regions. Antibodies produced by different B cells have different heavy chain variant regions; conversely, a single B cell or group of B cells stimulated and activated by a particular antigen will produce antibodies with the same heavy chain variable region. As for the light chain, two types are known at present, named lambda (lambda) and kappa (kappa), respectively. Similar to the structure of the heavy chains, each light chain has two regions: constant region (CH) and variable region (VH), the same homoantibody will have the same constant region, while the variable region will vary depending on the stimulus antigen.

Even though all antibodies have similar protein structures, the small regions at the ends of the antibodies are completely different, and thus millions of antibodies (with only minor differences in end structures; i.e., different antigen binding sites) can coexist in each individual. This small region is generally referred to as a hypervariable region (hypervariable region) or a Complementarity Determining Region (CDR). The diversity of antibodies ensures that the immune system recognizes a significant number of different antigens. These large and diverse antibodies are generated by randomly recombining a set of gene segments (i.e., variable segments, diverse segments, and connecting segments) encoding different antigen binding sites, and then randomly mutating the gene segments (also known as Somatic Hypermutation (SHM)), wherein the random mutation can further increase the diversity of the antibodies.

In the course of preparing antibodies, natural or recombinant proteins or fragments thereof are typically injected immunologically into animals to generate an immune response (imminize); the resulting antibodies specifically recognize and bind to the protein/fragment. Then, antibodies (e.g., monoclonal antibodies or polyclonal antibodies) can be prepared from the animal using different methods according to the need. In general, monoclonal antibodies are prepared by those skilled in the art using hybridoma technology (hybridoma technique). The technology is that after the animal generates immune reaction, cells are taken out from the animal body and fused to prepare hybridoma capable of generating antibody; then, the hybridoma is constructed as a cell line for preparing the antibody, and the obtained antibody is purified and analyzed. Although these techniques are conventional techniques for preparing antibodies, they still suffer from the following disadvantages: the complex technology is involved, so that the preparation time is too long, the epitope position recognition is not complete, the preparation cost is too high, and the like. In addition, not every protein/protein fragment can be used to produce corresponding antibodies using these techniques, such as low solubility antigens, low immunity (immunogenicity) antigens, or toxic antigens.

Accordingly, there is a need in the art for a system and/or method for producing antibodies with binding affinity and specificity for a particular antigen in a more cost-effective manner.

Disclosure of Invention

This summary is provided to provide a simplified summary of the disclosure in order to provide a basic understanding to the reader. This summary is not an extensive overview of the disclosure and is intended to neither identify key/critical elements of embodiments nor delineate the scope of such embodiments.

In a first aspect, the present disclosure relates to a phage-expressed single-chain variable (scFv) antibody library comprising a plurality of phage-expressed scFv. In the repertoire of antibodies of the present invention, each phage-expressed scFv comprises a first heavy chain complementarity determining region (CDR-H1), a second heavy chain CDR (CDR-H2), a third heavy chain CDR (CDR-H3), a first light chain CDR (CDR-L1), a second light chain CDR (CDR-L2), and a third light chain CDR (CDR-L3); wherein the content of the first and second substances,

each of CDR-H1, CDR-L2 and CDR-L3 has a Canonical Structure (CS) of a first type, and each of CDR-H2 and CDR-L1 has a CS of a second type; and

the distribution of aromatic residues in each of CDR-H1, CDR-H2, CDR-H3, CDR-L1, CDR-L2 and CDR-L3 is similar to the distribution of aromatic residues in the corresponding CDR-H1, CDR-H2, CDR-H3, CDR-L1, CDR-L2 and CDR-L3 of a natural antibody.

According to embodiments of the present disclosure, CDR-L1 is formed from a sequence comprising SEQ ID NO: 2-10, and CDR-L2 is encoded by a first coding sequence comprising the nucleic acid sequence of SEQ ID NO: 11-14, and CDR-L3 is encoded by a second coding sequence comprising the nucleic acid sequence of any one of SEQ ID NOs: 15-22, and CDR-H1 is encoded by a third coding sequence comprising the nucleic acid sequence of SEQ ID NO: 23-26, and CDR-H2 is encoded by a fourth coding sequence comprising the nucleic acid sequence of any one of SEQ ID NOs: 27-28, and CDR-H3 is encoded by a fifth coding sequence comprising the nucleic acid sequence of any one of SEQ ID NOs: 29-106, or a pharmaceutically acceptable salt thereof.

According to one embodiment of the present disclosure, the bacteriophage is a M13 bacteriophage or a T7 bacteriophage. Preferably, the bacteriophage is the M13 bacteriophage.

In an embodiment of the present disclosure, the at least one phage-expressed scFv is specific for a protein antigen selected from the group consisting of type II human epidermal growth factor receptor (human epidermal growth factor receptor 2, HER2), maltose-binding protein (MBP), bovine serum albumin (bovine serum albumin, BSA), human serum albumin (human serum albumin, HSA), lysozyme (lysozyme), interleukin-1 beta (IL-1 beta), influenza Hemagglutinin (HA), influenza nuclear protein (nucleoprotein of fluxuron virus, NP), Vascular Endothelial Growth Factor (VEGF), first epidermal growth factor receptor (epidermal growth factor receptor 1), epidermal growth factor receptor type III (EGFR), EGFR3), glucagon receptor (glucagon receptor), human deoxyribonuclease (human DNase I), programmed death-ligand of type I (programmed death-ligand 1, PD-L1), sialic acid binding immunoglobulin-like lectin of type iii (sialc acid binding Ig-like lectin 3, SIGLEC 3), fragment crystalline region of immunoglobulin G (IgG), and rituximab.

A second aspect of the present disclosure relates to a method for preparing a phage-expressed scFv antibody library of the present invention. The method comprises the following steps:

(1) synthesizing a first nucleic acid sequence comprising a first, a second, a third, a fourth, a fifth and a sixth coding sequence encoding CDR-L1, CDR-L2, CDR-L3, CDR-H1, CDR-H2 and CDR-H3, respectively, of an immunoglobulin gene;

(2) inserting the first nucleic acid sequence into a first phagemid (phagemid) vector;

(3) modifying the first, second and third coding sequences by site-directed mutagenesis (site-directed mutagenesis) to generate a library of variant light chain (VL) antibodies comprising a first set of phage-expressed scFv each having a modified CDR-L1, CDR-L2 and CDR-L3; and modifying the fourth, fifth and sixth coding sequences by site-directed mutagenesis to generate a variant heavy chain (VH) antibody repertoire comprising a second set of phage-expressed scFvs, wherein each scFv has a modified CDR-H1, CDR-H2 and CDR-H3;

(4) screening the VL library with protein L, and selecting a third set of phage-expressed scfvs from the VL library; screening the VH antibody library by using the protein A, and selecting a fourth group of scFv expressed by the phage from the VH antibody library;

(5) amplifying from the corresponding phage a plurality of second nucleic acid sequences encoding modified CDR-L1, CDR-L2 and CDR-L3, and a plurality of third nucleic acid sequences encoding modified CDR-H1, CDR-H2 and CDR-H3 from the corresponding phage; and

(6) the second and third nucleic acid sequences are inserted into a second phagemid vector to prepare the phage-expressed scFv antibody library of the invention.

According to an embodiment of the present disclosure, in step (3), the first, second and third coding sequences are represented by SEQ ID NOs: 107-115, 116-119 and 120-127, and the fourth, fifth and sixth coding sequences are represented by SEQ ID NO: the nucleic acid sequences of 128-, 131, 132-, 133-and 134-211 were modified.

According to some embodiments of the present disclosure, step (3) is preceded by a step of comparing the distribution of aromatic residues in CDR-H1, CDR-H2, CDR-H3, CDR-L1, CDR-L2 and CDR-L3 of the immunoglobulin gene with the distribution of aromatic residues in the corresponding CDR-H1, CDR-H2, CDR-H3, CDR-L1, CDR-L2 and CDR-L3 of a natural antibody.

According to certain embodiments of the present disclosure, the immunoglobulin gene of step (1) is derived from a mammal; such as mice, rats, hamsters, rabbits, monkeys, goats, and sheep. In one embodiment, the immunoglobulin gene is derived from a mouse. According to a preferred embodiment of the present disclosure, the immunoglobulin gene can be used to encode an antibody specific for VEGF.

According to embodiments of the present disclosure, the first and second phagemid vectors may be the same or different phagemid vectors. Optionally, the first and second phagemid vectors are both derived from the M13 phage.

In a third aspect, the present disclosure relates to a method for producing a recombinant antibody using the phage-expressed scFv antibody library of the present invention, wherein the recombinant antibody has binding affinity and specificity for a protein antigen. The method comprises the following steps:

(a) screening the phage-expressed scFv antibody library of the present invention with the protein antigen;

(b) selecting a plurality of phage, wherein the phage express scFv with binding affinity and specificity for the protein antigen;

(c) allowing the phages selected in step (b) to express scFv in soluble form, respectively;

(d) selecting from the scFv of step (c) a soluble form of scFv with high binding affinity and specificity for the protein antigen;

(e) extracting a phagemid DNA from the phage that expresses the soluble form of the scFv of step (d);

(f) using the phagemid DNA of the step (e) as a template, and respectively amplifying a first nucleic acid sequence for encoding CDR-H1, CDR-H2 and CDR-H3 and a second nucleic acid sequence for encoding CDR-L1, CDR-L2 and CDR-L3 by Polymerase Chain Reaction (PCR);

(g) inserting the first and second nucleic acid sequences into an expression vector comprising a third and a fourth nucleic acid sequences, wherein the third nucleic acid sequence encodes a heavy chain constant region of an immunoglobulin and the fourth nucleic acid sequence encodes a light chain constant region of the immunoglobulin; and

(h) transfecting the expression vector of step (g) comprising the first, second, third and fourth nucleic acid sequences into a host cell to produce the recombinant antibody.

In embodiments of the present disclosure, the first nucleic acid sequence is located upstream of the third nucleic acid sequence, and the second nucleic acid sequence is located upstream of the fourth nucleic acid sequence.

According to one embodiment of the present disclosure, the immunoglobulin of step (G) is selected from the group consisting of immunoglobulin G (IgG), immunoglobulin a (IgA), immunoglobulin D (IgD), immunoglobulin E (IgE), and immunoglobulin M (IgM); preferably, the immunoglobulin is IgG.

In one embodiment of the present disclosure, the host cell of step (h) is a mammalian cell.

According to another embodiment of the present disclosure, the protein antigen may be HER2, MBP, BSA, HSA, lysozyme, IL-1 β, human DNase I, HA, NP, VEGF, EGFR1, EGFR3, PD-L1, SIGLEC 3, the Fc region of IgG, glucagon receptor or rituximab.

A fourth aspect of the present disclosure pertains to recombinant antibodies made using the phage-expressed scFv libraries of the present invention. According to an embodiment of the present disclosure, the recombinant antibody comprises: (1) a CDR-L1 having CS of type ii and consisting of a sequence comprising SEQ ID NO: 2-10 is encoded by a first coding sequence of a nucleic acid sequence; (2) a CDR-L2 having a CS of type i consisting of a sequence comprising SEQ ID NO: 11-14, or a second coding sequence of a nucleic acid sequence; (3) a CDR-L3 having a CS of type i consisting of a sequence comprising SEQ ID NO: 15-22, or a third coding sequence of a nucleic acid sequence; (4) a CDR-H1 having a CS of type i and consisting of a sequence comprising SEQ ID NO: 23-26, or a fourth coding sequence of a nucleic acid sequence; (5) a CDR-H2 having CS of type ii and consisting of a sequence comprising SEQ ID NO: 27 or 28 is encoded by a fifth coding sequence; and (6) a CDR-H3 consisting of a CDR comprising SEQ ID NO: 29-106, or a pharmaceutically acceptable salt thereof. According to certain embodiments of the present disclosure, the distribution of aromatic residues in each of CDR-H1, CDR-H2, CDR-H3, CDR-L1, CDR-L2 and CDR-L3 is similar to the distribution of aromatic residues in the corresponding CDR-H1, CDR-H2, CDR-H3, CDR-L1, CDR-L2 and CDR-L3 of a natural antibody.

According to certain embodiments of the present disclosure, dissociation of recombinant antibodies is oftenA number (KD) of about 10 ^-7 To 10 ^-11 M。

According to some embodiments of the present disclosure, the recombinant antibody produced comprises a heavy chain variable region comprising a heavy chain variable region of SEQ ID NO: 241-330 at least 90% similar to the other amino acid sequence.

Alternatively, the disclosure also provides a recombinant antibody prepared and purified from HER 2-immunized mice. According to one embodiment, the recombinant antibody comprises a heavy chain variable region of SEQ ID NO: 233. 237 and 331-334, which are at least 90% similar. In addition, recombinant antibodies prepared from mice can be treated by humanization (humanized), the treated antibody comprising a heavy chain variable region of the amino acid sequence of SEQ ID NO: 235 amino acid sequence with at least 90% similarity.

According to embodiments of the present disclosure, the recombinant antibodies of the present invention (i.e., recombinant antibodies prepared from phage-expressed scFv libraries, recombinant antibodies prepared from HER 2-immunized mice, and humanized recombinant antibodies) can specifically bind to an epitope of HER 2. According to one embodiment, the recombinant antibodies of the invention elicit the internalization of the HER2 receptor. According to another embodiment, the recombinant antibody of the invention inhibits the function of the HER2 receptor.

Accordingly, the present invention also provides a method for treating a subject having or suspected of having a disease associated with HER 2; the method comprises administering to the subject a therapeutically effective amount of a recombinant antibody of the invention to alleviate or improve the symptoms of the HER 2-associated disease. According to one embodiment of the present disclosure, the HER 2-related disease is a tumor, and administration of the recombinant antibody of the present invention is effective in inhibiting tumor growth. Preferably, the subject is a human.

According to a preferred embodiment of the present disclosure, the antibody for treating HER 2-related diseases comprises a heavy chain variable region of SEQ ID NO: 233. 235, 237 and 241-330, which are at least 90% similar.

Another aspect of the disclosure relates to a composition for treating a HER 2-related disease. According to some embodiments of the present disclosure, the composition comprises a first recombinant antibody and a second recombinant antibody, wherein the first recombinant antibody and the second recombinant antibody are both prepared from a phage-expressed scFv library of the present invention. Preferably, the first recombinant antibody binds to a first epitope of HER2 and the second recombinant antibody binds to a second epitope of HER 2. According to a particular embodiment of the present disclosure, the first recombinant antibody comprises SEQ ID NO: 253, and the second recombinant antibody comprises the amino acid sequence of SEQ ID NO: 274 or 301.

The present disclosure further provides a method for treating a subject having or suspected of having a disease associated with HER 2; the method comprises administering to the subject a therapeutically effective amount of a composition of the invention to alleviate or improve the symptoms of the HER 2-related disease. According to one embodiment of the present disclosure, the HER 2-related disease is a tumor, and administration of the composition of the present invention is effective in inhibiting tumor growth. Preferably, the subject is a human.

According to a preferred embodiment of the present disclosure, the first recombinant antibody comprises SEQ ID NO: 253, and the second recombinant antibody comprises the amino acid sequence of SEQ ID NO: 274 or 301.

The basic spirit and other objects of the present invention, as well as the technical means and embodiments adopted by the present invention, will be easily understood by those skilled in the art after referring to the following embodiments.

Brief description of the drawings

In order to make the aforementioned and other objects, features, advantages and embodiments of the invention more comprehensible, the following description is given:

FIG. 1A is a photograph of SKBR3 cells stained with fluorescent light according to example 3 of the present disclosure, wherein the cells were treated with specific antibodies; scale bar represents 25 micrometers (μm);

FIG. 1B is a photograph of SKBR3 cells stained with fluorescent light according to example 3 of the present disclosure, wherein the cells were treated with specific antibodies; scale bar represents 25 microns;

FIG. 2 shows the Western blot analysis result of SKBR3 cells, wherein the cells were treated with specific antibodies and then the protein expression levels were detected by anti-phosphorylated HER2 (anti-phosphorylated HER2, p-HER2), anti-HER 2, anti-phosphorylated AKT (anti-phosphorylated AKT, p-AKT), anti-AKT, anti-phosphorylated ERK (anti-phosphorylated ERK, p-ERK), anti-ERK, and anti-tubulin (anti-tubulin) antibodies;

FIG. 3A is the result plotted in example 3 according to the present disclosure for the correlation of H1N1 neutralizing ability and native HA binding affinity of recombinant antibodies prepared from phage-expressed scFv antibody library; and

FIG. 3B is the result plotted in example 3 of the present disclosure for the correlation of native HA binding affinity and binding affinity to recombinant HA for recombinant antibodies prepared from phage-expressed scFv antibody libraries.

In accordance with conventional practice, the various features and elements of the drawings are not drawn to scale in order to best illustrate the particular features and elements associated with the present invention.

Detailed Description

In order to make the description of the present disclosure more complete and complete, the following description is given for illustrative purposes with respect to the embodiments and specific examples of the present invention; it is not intended to be the only form in which the embodiments of the invention may be practiced or utilized. The embodiments are intended to cover the features of the various embodiments as well as the method steps and sequences for constructing and operating the embodiments. However, other embodiments may be utilized to achieve the same or equivalent functions and step sequences.

To facilitate the reader's understanding, this specification collects the words that have been set forth in part in the specification, examples, and claims. Unless defined otherwise herein, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Furthermore, as used herein, the singular tense of a noun, unless otherwise conflicting with context, encompasses the plural form of that noun; the use of plural nouns also covers the singular form of such nouns. In particular, the singular forms "a", "an" and "the" include plural referents unless the context clearly dictates otherwise. Furthermore, in the present specification and claims, "at least one" and "one or more" have the same meaning and include one, two, three or more.

Although numerical ranges and parameters setting forth the broad scope of the invention are approximate, the values set forth in the specific examples are presented as precisely as possible. Any numerical value, however, inherently contains certain standard deviations found in their respective testing measurements. As used herein, "about" generally means that the actual value is within 10%, 5%, 1%, or 0.5% of a particular value or range. Alternatively, the term "about" means that the actual value falls within the acceptable standard error of the mean, subject to consideration by those of ordinary skill in the art to which the invention pertains. Except in the experimental examples, or where otherwise expressly indicated, it is to be understood that all ranges, amounts, values and percentages herein used (e.g., to describe amounts of materials, length of time, temperature, operating conditions, quantitative ratios, and the like) are to be modified by the word "about". Accordingly, unless indicated to the contrary, the numerical parameters set forth in the specification and attached claims are approximations that may vary depending upon the desired properties sought to be obtained. At the very least, these numerical parameters are to be understood as meaning the number of significant digits recited and the number resulting from applying ordinary carry notation. Herein, numerical ranges are expressed as from one end point to another or between the two end points; unless otherwise indicated, all numerical ranges recited herein are inclusive of the endpoints.

In the present specification, the term "antigen" (antigen or Ag) refers to a molecule that can elicit an immune response. The immune response may be the production of antibodies, the activation of specific immune competent cells, or both. It will be appreciated by those skilled in the art that macromolecules including almost all proteins and peptides can be used as antigens. Furthermore, antigens may also be derived from recombinant or genomic DNA. It will be appreciated by those skilled in the art that DNA encoding an "antigen" (antigen or Ag) may comprise a nucleic acid sequence or part of a nucleic acid sequence encoding a protein capable of eliciting an immune response. In addition, it will be understood by those skilled in the art that an antigen is not necessarily encoded by a single full-length nucleic acid sequence in a gene, but may be encoded by partial nucleic acid sequences derived from multiple genes arranged by different recombination regimes, thereby eliciting a specific immune response. Furthermore, it will be understood by those skilled in the art that an antigen is not necessarily encoded by a "gene" (gene); increasing amounts of data show that antigens can be synthetic or derived from biological samples. The biological sample includes, but is not limited to, a tissue sample, a tumor sample, a cell, or a biological fluid.

In the present specification, the term "immunization" refers to a process of inducing an immune response by administering (e.g., injecting, mucosal stimulating, etc.) an antigenic agent or substance to an animal, which is specific to the antigenic agent or substance, as is well known to those skilled in the art. The antigenic agent or substance may be administered alone or in combination with an adjuvant (adjuvant) to the animal.

The term "antibody" is used broadly herein to refer to monoclonal antibodies (including full length monoclonal antibodies), polyclonal antibodies (polyclonal antibodies), multi-effect antibodies (e.g., double effect antibodies) and antibody fragments that produce a particular biological activity. The term "antibody fragment" in this specification encompasses a portion of a full-length antibody, which is typically the site or region of variation in the antibody that binds to an antigen. Exemplary antibody fragments include Fab, Fab ', F (ab') 2, Fv fragments, diabodies (diabodies), linear antibodies (linear antibodies), single-chain antibody molecules (single-chain antibody molecules), and pleiotropic antibodies formed from antibody fragments.

The term "antibody library" as used herein refers to a collection of expressed antibodies and/or antibody fragments for screening and/or combining into whole antibodies. The antibody and/or antibody fragment may be expressed on the ribosome (ribosome), phage or cell surface (particularly yeast cell surface).

In the present specification, "single-chain variable fragment (scFv)" refers to a fusion protein comprising a variable region of the heavy chain of the immunoglobulin (VH) and a variable region of the light chain (VL), wherein the VH and VL are covalently bonded to form a VH and VL heterodimer (heterodimer). The VH and VL may be linked directly or via a peptide-encoded linker, wherein the linker may link the N-terminus of VH and the C-terminus of VL, or the C-terminus of VH and the N-terminus of VL. The linker is typically a fragment comprising a plurality of glycine (glycine) to increase flexibility and a plurality of serine (serine) or threonine (threonine) to increase solubility. Even if the constant region of the antibody is removed and the linker inserted, the scFv protein retains the specificity of the original immunoglobulin. Single chain Fv polypeptide antibodies can be expressed from nucleic acids comprising sequences encoding VH and VL.

"complementary determining regions" (CDRs) in this specification refers to the highly variable regions of an antibody molecule that form complementary surfaces with three-dimensional surfaces that bind antigen. From N-terminus to C-terminus, each antibody heavy and light chain comprises three CDRs (CDR 1, CDR 2 and CDR 3). Thus, one HLA-DR antigen binding site comprises 6 CDRs in total (3 CDRs of the heavy chain variant region and 3 CDRs of the light chain variant region). The amino acid residues of each CDR will be in intimate contact with the bound antigen, with the most intimate contact with the antigen typically being the heavy chain CDR 3.

As is well known to those skilled in the art, the term "canonical structure" (CS) refers to a main chain conformation formed by antigen binding (i.e., CDR) loop regions. Alignment of the structures revealed that of the 6 antigen binding circular regions, 5 of them were selected from the group consisting of limited existing conformational structures. Each canonical structure can be distinguished by the torsion angle (torsion angle) of the polypeptide backbone.

In this specification, "EC ₅₀ The term "refers to the concentration of an antibody or antigen binding region thereof in vitro or in vivoA reaction can be initiated in the test that is half the maximum reaction (i.e., the median of the maximum reaction and the reference).

In the present specification, the "association rate constant" (k) _on ) Refers to a value representing the strength of binding between an antibody and an antigen of an antibody target, which is usually determined by the kinetics of antigen-antibody reaction. "dissociation rate constant" (k) _off ) In the present specification, a numerical value is used to indicate the dissociation strength between an antibody and an antigen to which the antibody is directed, and the numerical value is usually determined by the kinetics of an antigen-antibody reaction. The "dissociation rate constant" (k) _off ) Divided by the "association rate constant" (k) _on ) The "dissociation constant" (K) can be obtained _d ). These constants can be used as indices that indicate the affinity of the antibody for its antigen and the activity of neutralizing the antigen.

The term "phagemid" (phagemid) as used herein refers to a vector that combines the properties of bacteriophages and plasmids. Bacteriophage refers to any virus that infects bacteria.

"nucleic acid sequence", "polynucleotide" or "nucleic acid" are used interchangeably in this specification and may refer to a double stranded deoxyribonucleic acid (DNA), a single stranded DNA or a transcript of said DNA (e.g.a ribonucleic acid molecule, RNA). It is to be understood that the present disclosure is not concerned with the polynucleotide sequence of a gene in nature or in its natural state. Methods that can be used to isolate or purify (or partially purify) a nucleic acid, polynucleotide, or nucleotide sequence of the invention include, but are not limited to, ion-exchange chromatography (ion-exchange chromatography), molecular size exclusion chromatography (molecular size exclusion chromatography), or genetic engineering techniques such as amplification (amplification), subtractive hybridization (subtractive hybridization), cloning (cloning), subcloning (sub-cloning), chemical synthesis (chemical synthesis), or combinations thereof.

The invention also encompasses all degenerate nucleotide sequences (e.g. CDRs) which are used to encode peptides/polypeptides/proteins (e.g. CDRs of the invention) having a specific activity or function in an organism. A "degenerate nucleotide sequence" refers to a nucleotide sequence that contains one or more degenerate codons (as compared to a reference polynucleotide molecule that encodes a polypeptide). Degenerate codons may contain different triplets of nucleotides (triplets), but may encode the same amino acid residue (e.g., GAU and GAC triplets are used to encode aspartic acid (Asp)).

"coding sequence" and "coding region" are used interchangeably in this specification to include nucleotide and nucleic acid sequences of RNA and DNA that can be used to encode genetic information required for the synthesis of RNA, protein, part of RNA or part of protein. "foreign nucleotide sequence", "heterologous nucleotide sequence" or "exogenous nucleotide sequence" refers to a nucleotide sequence other than a natural product of the genome of a particular organism. "Heterologous proteins" (Heterologous proteins) refer to proteins encoded by foreign, Heterologous, or exogenous nucleotides, which are not normally expressed in a cell. Nucleotide sequences that are isolated and reintroduced into organisms of the same species are not considered to be naturally occurring products of the genome of a particular organism, but rather are considered to be foreign or exogenous nucleotide sequences.

"similar" in this specification refers to the association of different nucleic acid or amino acid sequences, where portions of the sequences are identical or where one or more regions of the sequences share similarity. Similar amino acid residues can be identical amino acid residues between different amino acid sequences or amino acid substitutions that are conservative substitutions between different sequences.

The subject matter of the present disclosure is to provide a phage-expressed scFv library that recognizes and binds to a different antigenic protein, such as HER 2. The antibody library comprises a plurality of phage-expressed scFvs characterized by: (1) having a specific CS combination; (2) each CDR has a specific distribution of aromatic residues; and (3) each CDR has a specific sequence. Accordingly, antibodies having binding affinity and specificity for a specific antigen can be easily prepared by screening the antibody library of the present invention using the antigen without repeating conventional procedures (e.g., immunizing a host animal and/or preparing hybridomas), thereby greatly reducing the time and labor required for preparing the antibodies. Accordingly, in response to various experimental research and/or clinical needs, the present disclosure provides a method for preparing an antibody specific to an antigen.

To create the phage-expressed scFv antibody library of the present invention, CS combinations of individual scFv were first determined from an antibody group (antibody repertoire) of mice. In one embodiment of the present disclosure, a method for establishing a mouse antibody group comprises:

(A) immunizing a host with a protein antigen;

(B) isolating spleen cells from the immunized mice and extracting messenger ribonucleic acid (mRNA) from the spleen cells;

(C) synthesizing complementary deoxyribonucleic acid (cDNA) from the extracted mRNA;

(D) using the cDNA synthesized in step (C) as a template, respectively amplifying a plurality of first nucleic acid sequences encoding CDR-H1, CDR-H2 and CDR-H3 of the immunoglobulin gene and a plurality of second nucleic acid sequences encoding CDR-L1, CDR-L2 and CDR-L3 of the immunoglobulin gene by PCR;

(E) inserting the first and second nucleic acid sequences into a phagemid vector to prepare a phage; and

(F) sequencing the phage antibody library of step (E).

In step (a), a host animal (e.g., a mouse, rat, or rabbit) is first immunized with an appropriate amount of a protein antigen (e.g., a natural protein or a synthetic polypeptide) to elicit production of antibodies specific for the antigen by the host animal. According to one embodiment of the present disclosure, the host animal is administered a peptide of SEQ ID NO: 224 comprising an MBP and a polypeptide comprising amino acid residues 203-262 of the extracellular domain (ECD) of HER 2. In general, when immunizing a host animal, an adjuvant and an antigen are mixed and administered to the host animal. Exemplary adjuvants suitable for use in the present invention include Freund's Complete Adjuvant (FCA), Freund's Incomplete Adjuvant (FIA), TiterMax, and aluminum hydroxide adjuvant. According to one embodiment of the present disclosure, SEQ ID NO: 224 was mixed with TiterMax. The immunization is mainly to administer antigen into host animal body by intravenous injection, lymph node injection, subcutaneous injection, intraperitoneal injection or intramuscular injection to generate relevant immune response. According to another embodiment of the present disclosure, a polypeptide comprising SEQ ID NO: 224 and adjuvant TiterMax were administered to the inguinal lymph node (inguinal lymph node) of the mice. The interval time between each administration is not particularly limited. The interval may be days to weeks; preferably 2 times, with an interval of 4 weeks. According to a particular embodiment of the present disclosure, the method is performed by administering to a host animal a peptide of SEQ ID NO: 225 (ECD comprising HER 2; i.e. HER2/ECD) to increase an immune response (i.e. re-immunization) in a host animal.

In the step (B), spleen cells are isolated from the immunized host animal prepared in the step (A), and total mRNA is extracted from the spleen cells; thereafter, in step (C), the mRNA is inverted into cDNA using reverse transcriptase (reverse transcriptase). In the extraction method known to those skilled in the art, spleen cells extracted from the immunized host animal are first dissolved in a highly corrosive chemical solution (e.g., phenol, trichloroacetic acid, acetone, and Trizol) and then neutralized with chloroform (chloroform). After centrifugation, the aqueous layer containing the RNA sample is precipitated with an organic solution (e.g., ethanol and isopropanol). After washing the RNA sample with ethanol to remove residual proteins, the RNA sample is dried (e.g., air dried and vacuum dried) to obtain an RNA precipitate.

In the step (C), the RNA precipitate obtained in the step (B) is dissolvedDissolved in distilled water (DEPC H) to which diethyl pyrocarbonate (DEPC) is added ₂ O), RNA is inverted into corresponding cDNA using Reverse Transcription (RT). In general, RNA is mixed with primer oligo (dT) ₂₀ A deoxyribonucleoside triphosphate (dNTP; comprising dATP, dGTP, dTTP and dCTP), a reverse transcriptase, a reaction buffer and optionally a co-factor for the reverse transcriptase (e.g., MgCl) ₂ ) Mix well for RT. Preferably, the reaction mixture further comprises Dithiothreitol (DTT), which is an oxidation-reduction agent, that stabilizes the reverse transcriptase; and an RNase inhibitor, whereby the degradation of RNA during RT process is inhibited.

In step (D), the target gene is amplified by PCR reaction using the cDNA inverted in step (C) as a template and target specific primers. In one embodiment, the target gene is a first nucleic acid sequence encoding CDR-H1, CDR-H2, and CDR-H3 of an immunoglobulin gene; in another embodiment, the target gene is a second nucleic acid sequence encoding CDR-L1, CDR-L2, and CDR-L3 of the same immunoglobulin gene. According to certain embodiments of the present disclosure, the immunoglobulin is IgG, IgA, IgD, IgE, or IgM; preferably, the immunoglobulin is IgG. The first and second nucleic acid sequences were amplified separately using a primer mix (G.J. Phage Display A Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, New York; 2001) published by Barbas et al. One skilled in the art will readily be able to amplify specific first and second nucleic acid sequences from an immunoglobulin by using appropriate primers without undue experimentation.

In step (E), the amplified first and second nucleic acid sequences are inserted into a phagemid vector, respectively, to create a phage antibody library comprising a plurality of phage capable of expressing different scFv, respectively. According to the method disclosed by Barbas et al (G.J. phase Display A Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, New York; 2001), first and second nucleic acid sequences are combined and then inserted into the phagemid, wherein the first and second nucleic acid sequences are combined by overlap extension polymerase chain reaction (OE-PCR); OE-PCR is also known as splicing by overlap extension Polymerase Chain Reaction (PCR) or splicing by overhang extension (SOE-PCR), both of which are abbreviated as SOE-PCR. In general, 4 primers are required for OE-PCR, wherein the first and second primers are forward and reverse primers, respectively, for the first nucleic acid sequence and the third and fourth primers are forward and reverse primers, respectively, for the second nucleic acid sequence. In contrast to other PCR reactions, primers used in OE-PCR were designed such that the second primer contains a 3 'overhang (complement 1) that is complementary to the 5' overhang (complement 2) of the third primer. In the first round of PCR reaction, first, a first nucleic acid sequence is amplified by using a first primer and a second primer, and a second nucleic acid sequence is amplified by using a third primer and a fourth primer; thus, complement 1 is inserted at the 3 'end of the first nucleic acid sequence, and complement 2 is inserted at the 5' end of the second nucleic acid sequence. In a second round of PCR, two amplified nucleic acid sequences are mixed and only the first and fourth primers are used to perform the PCR reaction. Since complementary sequence 1 and complementary sequence 2 are complementary to each other, the 3 'end of the first nucleic acid sequence overlaps the 5' end of the second nucleic acid sequence and forms an intermediate product of a PCR amplification reaction with the first and fourth primers. Based on this concept, the 3 'end of the first nucleic acid sequence amplified in step (D) comprises the complementary sequence 1 (i.e., GGAAGATCTAGAGGAACCACC; SEQ ID NO: 335) and the 5' end of the second nucleic acid sequence comprises the complementary sequence 2 (i.e., GGTGGTTCCTCTAGATCTTCC; SEQ ID NO: 336), wherein the two complementary sequences form an overlapping region, such that the nucleotide sequence of SEQ ID NO: 226 and 227, to combine the first and second nucleic acid sequences. According to some embodiments of the disclosure, SEQ ID NO: 226 and 227 contain first and second restriction enzyme sites, respectively, whereby the combined product is inserted into a multiple cloning site (multiple cloning site) of a phagemid vector to produce a recombinant phagemid. In one embodiment, the first restriction enzyme cleavage site is SfiI and the second restriction enzyme cleavage site is NotI. The phagemid vector may be derived from the M13 phage or the T7 phage; preferably, the phagemid vector is derived from the M13 phage.

The recombinant phagemid is then transferred into a host cell. Generally, phagemids can be transferred into host cells using transformation (transformation) or electroporation (electroporation); preferably, the phagemid is transferred into the host cell by electroporation. The host cell is typically a bacterial cell; for example Escherichia coli (e.coli) cells. Each transformed host cell comprises a recombinant phagemid and can form a colony (colony) on a culture medium; thus, according to certain embodiments of the present disclosure, step (E) may yield about 10 ⁹ And scraping all the independent colonies, and freezing in a preservation buffer solution to obtain the phage antibody library.

In step (F), each scFv expressed from the phage antibody library of step (E) is analyzed in a sequencing assay. Firstly, extracting recombinant phagemids from a phage antibody library by using a traditional DNA extraction technology; for example, phenol/chloroform extraction and detergent (e.g., sodium dodecyl sulfate, Tween-20, NP-40, and tritium nuclear X-100) extraction/acetic acid (acetic acid) extraction. Subsequently, recombinant phagemids were analyzed by pyrosequencing (shotgun sequencing), single-molecule real-time sequencing (single-molecule real-time sequencing), or Next Generation Sequencing (NGS). According to a preferred embodiment, the nucleic acid sequence of SEQ ID NO: 228 and 229 to analyze VL sequences in phage antibody libraries and using SEQ ID NO: 230 and 231, to analyze VH sequences in phage antibody libraries.

According to the sequencing results, the main CS forms of CDR-H1 and CDR-H2 are type I and type II, respectively, and the main CS forms of CDR-L1, CDR-L2 and CDR-L3 are type II, type I and type I, respectively; accordingly, the phage-expressed scFv antibody libraries of the present invention were constructed based on the antibody architecture (the CS combination of CDR-H1, CDR-H2, CDR-L1, CDR-L2 and CDR-L3 is 1-2-2-1-1 in that order). Accordingly, one aspect of the present disclosure is directed to a method for creating a library of scFv antibodies expressed by a bacteriophage. The method comprises the following steps:

(2) inserting the first nucleic acid sequence into a first phagemid vector;

(6) these second and third nucleic acid sequences are inserted into a second phagemid vector to prepare a phage-expressed scFv antibody library of the invention.

In step (1), a first nucleic acid sequence is first synthesized as a backbone of an scFv antibody library of the present invention. As is well known to those skilled in the art, the synthesis step can be performed in vitro, without the need for an initial template DNA sample. According to some embodiments of the present disclosure, the first nucleic acid sequence is at least 90% similar to SEQ ID NO: 1 to encode CDR-L1, CDR-L2, CDR-L3, CDR-H1, CDR-H2 and CDR-H3 of a human anti-VEGF antibody. According to other embodiments of the present disclosure, the first nucleic acid sequence comprises first and second restriction enzyme sites, whereby the synthesized first nucleic acid sequence is inserted into the first phagemid vector in step (2). In one embodiment, the first restriction enzyme cleavage site is SfiI and the second restriction enzyme cleavage site is NotI.

In step (2), the synthesized first nucleic acid sequence is inserted into a first phagemid vector using the first and second restriction enzyme sites. According to one embodiment of the present disclosure, the first phagemid vector may be derived from M13 phage or T7 phage; preferably, the first phagemid vector is derived from the M13 phage.

In order to increase the diversity of the phage-expressed scFv, the first to sixth coding sequences comprising CDR-L1, CDR-L2, CDR-L3, CDR-H1, CDR-H2 and CDR-H3 were modified by site-directed mutagenesis in step (3), respectively; as is known to those skilled in the art, site-directed mutagenesis is a commonly used method for specifically and deliberately altering the sequence of genes (i.e., DNA and RNA). In general, the site-directed mutagenesis method is performed using a primer that contains a specific mutation and is complementary to a sequence in the vicinity of the site of mutation in the template DNA (thereby hybridizing to a specific gene); mutations may be single base changes (i.e., point mutations), multiple base changes, deletions, or insertions. In one embodiment of the present disclosure, the sequences having SEQ ID NOs: 107-115, 116-119 and 120-127 nucleotide sequences to modify the first to third coding sequences; preferably, the first to third coding sequences are modified simultaneously. The modified first coding sequence comprises SEQ ID NO: 2-10; the modified second coding sequence comprises SEQ ID NO: 11-14, and the modified third coding sequence comprises SEQ ID NO: 15-22. Phage-expressed scFv comprising modified CDR-L1, CDR-L2 and CDR-L3 constitute a VL (variable light chain) antibody repertoire.

In one embodiment of the present disclosure, the sequences having SEQ ID NOs: the fourth to sixth coding sequences were modified with the DNA fragments of the nucleotide sequences 128-, 131, 132-, 133-and 134-211; preferably, the fourth to sixth coding sequences are modified simultaneously. The modified fourth coding sequence comprises SEQ ID NO: 23-26; the modified fifth coding sequence comprises SEQ ID NO: 27 or 28, and the modified sixth coding sequence comprises the nucleotide sequence of SEQ ID NO: 29-106. Phage-expressed scFv comprising modified CDR-L1, CDR-L2 and CDR-L3 constitute a VH (variant heavy chain) antibody repertoire.

SEQ ID NO: 2-211 are each expressed according to the biochemical International Unit of Biochemistry (IUB) code well known to those skilled in the art, wherein a represents adenine (adenine); c represents cytosine (cytosine); g represents guanine (guanine); t represents thymine (thymine); b represents any one of C, G or T; d represents any one of nucleotide A, T or G; h represents A, C or T; k represents nucleotide G or T; m represents A or C; n represents any one of nucleotide A, T, C or G; r represents nucleotide A or G; s represents nucleotide G or C; v represents any one nucleotide of A, C or G; w represents nucleotide A or T; and Y represents the nucleotide C or T.

Since sequence mutations may affect scFv folding, step (4) further utilizes protein L and protein to screen VL and VH antibody repertoires, respectively. As is well known to those skilled in the art, protein L isolated from streptococcus magnus (Peptostreptococcus magnus) has binding affinity for the light chain of an immunoglobulin; whereas protein a isolated from Staphylococcus aureus (Staphylococcus aureus) has binding affinity for the heavy chain of immunoglobulins. In this procedure, protein L and protein A are immobilized on a substrate (e.g., Sepharose polyacrylamide), and then mixed with phage-expressed scFv of VL and VH antibody libraries, respectively. The intact folded scfvs can be bound to the immobilized protein and collected by disrupting the bonds between the immobilized protein and the phage-expressed scfvs using an elution buffer, typically an acidic solution such as glycine (pH 2.2). Thus, a third population of phage-expressing scfvs having intact folded light chains and which bind to protein L can be selected from the VL antibody library; a fourth population of phage-expressed scfvs having an intact folded heavy chain that can bind to protein a can be selected from the VH antibody repertoire.

In step (5), the sequence shown in SEQ ID NO: 212-215 primers were used to amplify the nucleic acid sequences of the third and fourth populations of phage using OE-PCR. Specifically, the peptide of SEQ ID NO: 212-213 amplifying a plurality of second nucleic acid sequences encoding the modified CDR-H1, CDR-H2 and CDR-H3 from the corresponding phage; as set forth in SEQ ID NO: 214-215 from the corresponding phage, a plurality of third nucleic acid sequences encoding the modified CDR-H1, CDR-H2, and CDR-H3 are amplified. It is to be understood that SEQ ID NO: 213 and 214 comprise two complementary sequences (i.e., GGAAGATCTAGAGGAACCACC and GGTGGTTCCTCTAGATCTTCC; SEQ ID NOS: 335 and 336, respectively) inserted at the 3 'end of the second nucleic acid sequence and at the 5' end of the third nucleic acid sequence, respectively. Using the overlap region between the two complementary sequences, the second and third nucleic acid sequences form an intermediate template, which can then be expressed as SEQ ID NO: 216 and 217 use a PCR reaction to combine the two nucleic acid sequences.

According to one embodiment of the present disclosure, SEQ ID NO: 216, and 217 comprise first and second restriction enzyme sites (i.e., SfiI and NotI), respectively; thus, in step (6), a recombinant phagemid can be prepared by inserting the combination product into the multiple cloning site of the second phagemid vector using the two restriction sites described above. The second phagemid vector may be derived from the M13 phage or the T7 phage; preferably, the second phagemid vector is derived from the M13 phage. The recombinant phagemid is then transferred into a host cell. Generally, phagemids can be transformed into host cells using transformation or electroporation; preferably, the phagemid is transferred into the host cell by electroporation. Each transformed host cell contains a recombinant phagemid and can form a population of cells on culture. According to one embodiment, the host cell is typically a bacterial cell; such as E.coli cells. Step (6) gives a total of about 10 ⁹ The individual cell populations, all of which were scraped, were frozen in storage buffer to form phage-expressed scFv antibody libraries of the present disclosure.

It is to be understood that the first and second phagemids are not necessarily the same phagemid. According to one embodiment of the present disclosure, the first and second phagemids are both derived from the M13 phage.

Thus, the phage-expressed scFv antibody library of the present invention comprises a plurality of phage-expressed scFv, wherein each phage-expressed scFv comprises a CDR-H1, a CDR-H2, a CDR-H3, a CDR-L1, a CDR-L2, and a CDR-L3, wherein

Each of CDR-H1, CDR-L2 and CDR-L3 has a first type of CS, and each of CDR-H2 and CDR-L1 has a second type of CS;

According to some embodiments of the present disclosure, CDR-L1 is formed from a sequence comprising SEQ ID NO: 2-10, and CDR-L2 is encoded by a first coding sequence comprising the nucleic acid sequence of SEQ ID NO: 11-14, and CDR-L3 is encoded by a second coding sequence comprising the nucleic acid sequence of any one of SEQ ID NOs: 15-22, and CDR-H1 is encoded by a third coding sequence comprising the nucleic acid sequence of SEQ ID NO: 23-26, and CDR-H2 is encoded by a fourth coding sequence comprising the nucleic acid sequence of any one of SEQ ID NOs: 27-28, and CDR-H3 is encoded by a fifth coding sequence comprising the nucleic acid sequence of any one of SEQ ID NOs: 29-106, or a pharmaceutically acceptable salt thereof.

According to certain embodiments of the present disclosure, each phage in the phage-expressed scFv antibody library of the present invention carries a single phagemid.

In one embodiment of the present disclosure, the at least one phage-expressed scFv is specific for a protein antigen selected from the group consisting of HER2, MBP, BSA, HSA, lysozyme, IL-1 β, HA, NP, VEGF, EGFR1, EGFR3, glucagon receptor, human deoxyribonuclease, PD-L1, SIGLEC 3, IgG, and rituximab. According to some embodiments of the present disclosure, the protein antigen HA is derived from H1N1, H3N2, or H5N 1. According to other embodiments of the present disclosure, the protein antigen NP is derived from H3N2 or H1N 1. According to one embodiment of the present disclosure, the at least one phage-expressed scFv has binding affinity and specificity for HER 2; preferably, the HER2 is derived from a human. In certain embodiments of the present disclosure, at least one phage-expressed scFv can bind to HER2, EGFR1, EGFR3, PD-L1, SIGLEC 3, and/or the ECD of the glucagon receptor. In other embodiments of the present disclosure, the at least one scFv expressed by the phage may bind to the Fc region of the IgG.

According to one embodiment, the scFv expressed by the phage-expressed scFv library has an intact folded structure; preferably, the scFv are expressed on the phage surface or in a soluble form that is secreted.

The constructed phage-expressed scFv antibody library can effectively prepare a recombinant antibody which has binding affinity and specificity to a protein antigen. Specifically, the method for preparing recombinant antibodies using the phage-expressed scFv antibody library of the present invention comprises the steps of:

(a) screening the scFv antibody library expressed by the phage according to the present invention with the protein antigen;

(f) amplifying a first nucleic acid sequence encoding CDR-H1, CDR-H2 and CDR-H3 and a second nucleic acid sequence encoding CDR-L1, CDR-L2 and CDR-L3 by PCR using the phagemid DNA of step (e) as a template;

(g) inserting the first and second nucleic acid sequences into an expression vector comprising a third and fourth nucleic acid sequences, wherein the third nucleic acid sequence encodes a heavy chain constant region of an immunoglobulin and the fourth nucleic acid sequence encodes a light chain constant region of an immunoglobulin; and

In step (a), the phage-expressed scFv antibody library of the present invention is first screened using protein antigens. Similar to the screening method of the aforementioned method step (4), the protein antigen is immobilized on a substrate (e.g., agarose resin polyacrylamide), and then mixed with the phage-expressed scFv antibody library of the present invention. According to certain embodiments of the present disclosure, the protein antigen may be HER2, MBP, BSA, HA, lysozyme, IL-1 β, NA, VEGF, EGFR1, EGFR3, glucagon receptor, or rituximab. In a particular embodiment, the protein antigen is HER 2.

In step (b), the binding between the immobilized protein and the phage-expressed scFv is disrupted with a wash buffer (usually an acidic solution such as glycine (pH 2.2)) to collect the phage-expressed scFv having binding affinity and specificity for the protein antigen.

In step (c), to exclude the possibility that the linkage is through a phage (rather than an antibody) to a protein antigen, the phage-expressed scFv selected in step (b) is further expressed in a secreted soluble form. According to some embodiments of the present disclosure, the second and third nucleic acids contained in the second phagemid constructed in the aforementioned step (6) are mobilized by a lactose operator (lac operator); as is well known to those of ordinary skill in the art, the addition of isopropyl-thio- β -D-galactoside (IPTG) triggers the expression of the lactose operon and thus drives the expression of the downstream genes (i.e., the second and third nucleic acid sequences). The scFv produced are thus secreted into the supernatant of the culture broth, from which they can be collected by the person skilled in the art.

In step (d), the scFv prepared in step (c) is screened using a protein antigen. Similar to the screening method of step (a), the protein antigen is first immobilized on a matrix (e.g., agarose resin polyacrylamide) and then mixed with the scFv. Then, scFv having binding affinity and specificity to the protein antigen is selected. In a particular embodiment, the protein antigen is HER 2.

In step (e), the phage selected in step (d) that will express the soluble form of scFv are lysed and their phagemid DNA is extracted. Phagemid DNA can be solubilized and extracted using any DNA extraction technique known to those skilled in the art; for example, phenol/chloroform extraction and detergents (e.g., sodium dodecyl sulfate, Tween-20, NP-40, and tritium X-100)/acetic acid extraction.

In step (f), the phagemid DNA extracted in step (e) is used as a template with the DNA sequence of SEQ ID NO: 220 and 221 are PCR reacted to amplify a first nucleic acid sequence comprising CDR-H1, CDR-H2, and CDR-H3 using the primers of SEQ ID NO: 218 and 219 to amplify a second nucleic acid sequence comprising CDR-L1, CDR-L2, and CDR-L3.

In step (g), the amplified first and second nucleic acid sequences are inserted into an expression vector comprising third and fourth nucleic acid sequences, wherein the third nucleic acid sequence encodes a heavy chain constant region of an immunoglobulin and the fourth nucleic acid sequence encodes a light chain constant region of the immunoglobulin. It is contemplated that the immunoglobulin may be IgG, IgA, IgD, IgE, and IgM. In a preferred embodiment of the present disclosure, the immunoglobulin is IgG. Specifically, the first and second nucleic acid sequences are linked to each other by a linker using the pIG vector as a template and the sequence set forth in SEQ ID NO: 222 and 223, and performing PCR amplification. According to some embodiments of the present disclosure, the connector comprises the following sequence in order: a constant region of a light Chain (CL), a bovine growth hormone polyadenylation signal (BGA-polyA signal), a human Cytomegalovirus (CMV) promoter, and a signal peptide of an IgG heavy chain (signal peptide). Using the complementary sequences of the 3 'end of the second nucleic acid sequence and the 5' end of the linker (i.e., TGCAGCCACCGTACGTTTGATTTCCACCTT and AAGGTGGAAATCAAACGTACGGTGGCTGCA; SEQ ID NOS: 337 and 338, respectively), and the complementary sequences of the 3 'end of the linker and the 5' end of the first nucleic acid sequence (i.e., CTGCACTTCAGATGCGACACG and CGTGTCGCATCTGAAGTGCAG; SEQ ID NOS: 339 and 340, respectively), the sequences of SEQ ID NOS: 218 and 221, wherein the primers of SEQ ID NO: 218 and 221 contain restriction enzyme cleavage points KpnI and NheI, respectively. The recombinant products were then inserted into the expression vector pIGG using these restriction sites. Structurally, the constructed expression vector sequentially comprises: the recombinant antibody comprises a first human CMV promoter, a signal peptide of an IgG light chain, a second nucleic acid sequence, CL, a first BGH-polyA information segment, a second human CMV promoter, a signal peptide of an IgG heavy chain, a first nucleic acid sequence, CH and a second BGH-polyA information segment, wherein the second nucleic acid sequence and the CL are driven by the first human CMV promoter to express the light chain of the recombinant antibody, and the first nucleic acid sequence and the CH are driven by the second human CMV promoter to express the heavy chain of the recombinant antibody.

In step (h), the expression vector constructed in step (g) is transfected into a host cell to produce a recombinant antibody of the present invention. Commonly used host cells are mammalian cells, such as HEK293 Freestyle cells. Transfection can be performed using methods well known to those skilled in the art, including chemical methods (e.g., calcium phosphate, liposomes (liposomes) and cationic polymers), non-chemical methods (e.g., electroporation, cell extrusion, sonoporation, light transfection, protoplast fusion, and hydrodynamic delivery), particle methods (e.g., gene gun, magnetotransfection, and puncture transfection), and viral methods (e.g., adenoviral vectors, similis viral vectors, and lentivirus vectors). The recombinant antibody produced will be secreted into the supernatant of the culture broth, from which it can be purified by any of the well-known methods by those skilled in the art; for example, purification can be performed using binding affinity to protein a or protein G.

According to certain embodiments of the present disclosure, the recombinant antibodies of the present invention have binding affinity and specificity for a protein antigen selected from the group consisting of HER2, MBP, BSA, HSA, lysozyme, IL-1 β, HA, NP, VEGF, EGFR1, EGFR3, glucagon receptor, human DNase I, PD-L1, SIGLEC 3, IgG/Fc regions, and rituximab. According to some embodiments of the present disclosure, the protein antigen HA is derived from H1N1, H3N2, or H5N 1. According to other embodiments of the present disclosure, the protein antigen NP is derived from H3N2 or H1N 1. In certain embodiments of the present disclosure, at least one recombinant antibody can bind to HER2, EGFR1, EGFR3, PD-L1, SIGLEC 3, and/or the ECD of the glucagon receptor. In other embodiments of the present disclosure, at least one recombinant antibody can bind to the Fc region of an IgG.

The method of the present invention can be used to prepare a recombinant antibody having binding affinity and specificity for a protein antigen. According to some embodiments of the present disclosure, recombinant antibodies are made that comprise (1) a CDR-L1 having a CS of type ii and consisting of a CDR comprising the amino acid sequence of SEQ ID NO: 2-10 is encoded by a first coding sequence of a nucleic acid sequence; (2) a CDR-L2 having a CS of type i consisting of a sequence comprising SEQ ID NO: 11-14, or a second coding sequence of a nucleic acid sequence; (3) a CDR-L3 having a CS of type i consisting of a sequence comprising SEQ ID NO: 15-22, or a third coding sequence of a nucleic acid sequence; (4) a CDR-H1 having a CS of type i and consisting of a sequence comprising SEQ ID NO: 23-26, or a fourth coding sequence of a nucleic acid sequence; (5) a CDR-H2 having CS of type ii and consisting of a sequence comprising SEQ ID NO: 27 or 28 is encoded by a fifth coding sequence; and (6) a CDR-H3 consisting of a CDR comprising SEQ ID NO: 29-106, or a pharmaceutically acceptable salt thereof. According to certain embodiments of the present disclosure, the distribution of aromatic residues in each of CDR-H1, CDR-H2, CDR-H3, CDR-L1, CDR-L2 and CDR-L3 is similar to the distribution of aromatic residues in the corresponding CDR-H1, CDR-H2, CDR-H3, CDR-L1, CDR-L2 and CDR-L3 of a natural antibody. In certain embodiments, recombinant antibodies of the invention have a dissociation constant of about 10 ^-7 To 10 ^-11 M。

According to one embodiment of the present disclosure, the recombinant antibody is prepared comprising a heavy chain variable region of SEQ ID NO: 241-330, wherein the nucleotide sequence has at least 90% similarity to the amino acid sequence of any one of the nucleic acid sequences; that is, the recombinant antibody comprises an amino acid sequence that is 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% similar to SEQ ID NO: 241 and 330. In a preferred embodiment, the recombinant antibody of the invention comprises a heavy chain variable region sequence substantially identical to the sequence set forth in SEQ ID NO: 241-330, and the nucleotide sequence of the nucleic acid sequence is 100% similar to the nucleotide sequence of the nucleic acid sequence of the first embodiment.

Alternatively, the disclosure also provides a recombinant antibody prepared and purified in vivo from HER 2-immunized mice. According to one embodiment, the recombinant antibody of the invention comprises a heavy chain variable region sequence substantially identical to SEQ ID NO: 233. 237 and 331-334, wherein the nucleic acid sequences have at least 90% similarity; that is, a recombinant antibody of the invention comprises an amino acid sequence that is 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% similar to SEQ ID NO: 233. 237 and 331-334. In a preferred embodiment, the recombinant antibody of the invention comprises a heavy chain variable region sequence substantially identical to the sequence set forth in SEQ ID NO: 233. 237 and 331-334, respectively.

In addition, the recombinant mouse-derived antibody may also be humanized and thus comprise a heavy chain variable region that is substantially identical to the heavy chain variable region of SEQ ID NO: 235 amino acid sequence with at least 90% similarity; that is, a recombinant antibody of the invention comprises an amino acid sequence that is 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% similar to SEQ ID NO: 235. In a preferred embodiment, the recombinant antibody of the invention comprises a heavy chain variable region sequence substantially identical to the sequence set forth in SEQ ID NO: 235 are identical in amino acid sequence.

In certain embodiments of the present disclosure, a recombinant antibody may specifically bind to an epitope of HER 2. According to one embodiment, the recombinant antibody causes a decrease in HER2 expression and internalization, thereby inhibiting the signaling pathway associated with HER 2.

Based on the efficacy of the recombinant antibodies of the present invention in inhibiting HER2 expression, the present disclosure also provides a method for treating a subject having or suspected of having a disease associated with HER 2; the method comprises administering to the subject a therapeutically effective amount of a recombinant antibody of the invention to alleviate or improve the symptoms of the HER 2-associated disease.

HER2 is a member of the human epidermal growth factor receptor (HER, EGFR, ERBB) family. It is known that amplification or overexpression of the oncogene may lead to the formation and progression of certain invasive tumors (e.g., breast cancer). In view of the fact that the recombinant antibody of the present invention inhibits the function of the HER2 receptor, the recombinant antibody can be used to prepare a medicament for treating diseases caused by the overexpression of HER2 (e.g., tumors). According to one embodiment of the present disclosure, the recombinant antibodies of the present invention inhibit tumors caused by overexpression of HER 2. According to another embodiment of the present disclosure, the subject is a mammal; preferably a human.

According to some embodiments of the present disclosure, a recombinant antibody for treating HER 2-related diseases comprises a heavy chain variable region comprising a heavy chain variable region of SEQ ID NO: 233. 235, 237 and 241-334, or a pharmaceutically acceptable salt thereof.

Another aspect of the disclosure relates to a composition for inhibiting HER2 expression. According to one embodiment of the present disclosure, the composition comprises a first recombinant antibody and a second recombinant antibody, wherein the first and the second recombinant antibodies are both prepared by the method of the present disclosure, and the first and the second recombinant antibodies are both IgG antibodies. According to another embodiment of the present disclosure, the first recombinant antibody binds to a first epitope of HER2 and the second recombinant antibody binds to a second epitope of HER2, wherein the first and second epitopes are different epitopes.

According to one embodiment of the present disclosure, the first recombinant antibody comprises SEQ ID NO: 253, and the second recombinant antibody comprises the amino acid sequence of SEQ ID NO: 274, or a pharmaceutically acceptable salt thereof. According to another embodiment of the present disclosure, the first recombinant antibody comprises SEQ ID NO: 253, and the second recombinant antibody comprises the amino acid sequence of SEQ ID NO: 301.

According to certain embodiments of the present disclosure, the compositions of the present invention cause HER2 receptor internalization. In accordance with other embodiments of the present disclosure, the compositions of the present invention inhibit the function of HER2 receptor.

In certain embodiments of the present disclosure, the first and second recombinant antibodies have additive (additive) efficacy in inhibiting the message pathway associated with HER 2; that is, the efficacy of the composition of the present invention is equal to the sum of the efficacies of the individual antibodies (i.e., the first antibody and the second antibody). In other embodiments of the present disclosure, the first and second recombinant antibodies produce an additive (synergistic) effect in inhibiting the message pathway associated with HER 2; that is, the efficacy of the composition of the invention is greater than the sum of the efficacies of the individual antibodies (i.e., the first antibody and the second antibody).

Based on the inhibitory efficacy of the compositions of the present invention, the present disclosure provides a method for treating a subject suffering from or suspected of suffering from a HER 2-related disease; the method comprises administering to the subject a therapeutically effective amount of a composition of the invention to alleviate or improve the symptoms of the HER 2-related disease. In a specific embodiment of the present disclosure, the disease is a tumor. According to one embodiment of the present disclosure, the subject is a mammal; preferably a human. In a preferred embodiment, the composition of the invention comprises two recombinant antibodies, wherein one recombinant antibody comprises the amino acid sequence of SEQ ID NO: 253, and the other recombinant antibody comprises the amino acid sequence of SEQ ID NO: 274 or 301.

The following experimental examples are presented to illustrate certain aspects of the present invention to facilitate those of ordinary skill in the art in practicing the invention, and should not be construed as limiting the scope of the invention. It is believed that one skilled in the art can, after reading the description set forth herein, utilize and practice the present invention to its fullest extent without undue interpretation. All publications cited herein are incorporated in their entirety into this specification.

Examples

Materials and methods

Cell line and reagent

SKBR3 cells were purchased from the American Type Culture Collection (ATCC) and cultured in RPMI 1640(Gibco) cell Culture medium containing 10% fetal bovine serum and antibiotics/antimycotics. The regulatory protein Heregulin (HRG) is the purchase of the R & D system. Anti-phosphorylated ERK antibody, anti-phosphorylated AKT antibody, and anti-AKT antibody used in Western blot analysis were purchased from Cell Signaling Technology; rabbit anti-HER 2 antibody and anti-tubulin antibody were purchased from Sigma.

Immunizing mice

Female BalbC/j mice 8-12 weeks old were bred in a certified SPF environment. Mice were divided into four groups according to the immunization protocol: (1) m0 group, which is mice not receiving immune source stimulation, and is used as an experimental control group; concession of m0 group of mice at 16 weeks of age, after which their spleens were collected for subsequent assay analysis; (2) m3 group, the mice were first administered SEQ ID NO: 224 (polypeptide comprising MBP and amino acid residues 203-262 of the human HER2 protein) to produce an immune response, followed by administration of the polypeptide of SEQ ID NO: 225 HER2/ECD to enhance an immune response in a mouse; concession and concession of the mice 5 weeks after the second antigen challenge, and then removal of their spleens for subsequent assay analysis; (3) m4 group, the mice are administered with the fusion protein MBP-3, and then the polypeptide HER2/ECD enhances the immune response in the mice; concession and concession of the mice 12 weeks after the second antigen stimulation, and then taking the spleen for subsequent experimental analysis; and (4) m6 group, in which only the mice were administered the polypeptide HER2/ECD and the mice were concession and concession 14 weeks after the administration.

Establishing a mouse antibody cohort

After concession of the immunized mouse, the spleen was removed and mixed with 2 ml of TRI reagent (Invitrogen). Immediately afterwards, the samples were homogenized, placed in 1.5 ml microtubes (0.5 ml per tube) and frozen at-80 ℃. RNA from thawed samples was extracted using QIAGEN RNeasy Plus Mini kit, and 60-80. mu.g total RNA was obtained from an average of one quarter of the spleen. According to the manual of operation, the first strand of SuperScript IIIThe extracted RNA was reverse transcribed by a synthetic System (SuperScript III First-Strand Synthesis System, Invitrogen). The reaction is as follows: will contain 10. mu.g of total RNA, 1. mu.l of 10. mu.M primer oligo (dT) ₂₀ And 1 microliter of 10mM dNTP were added to a 0.2 ml tube, and the volume was adjusted to 10 microliter with 0.1% DEPC water (distilled water with addition of diethyl pyrocarbonate). The mixture was allowed to react at 65 ℃ for 5 minutes and then immediately placed on ice to cool. Add 10. mu.l of cDNA synthesis mix (2. mu.l of 10 XTT buffer, 4. mu.l of 20mM MgCl) per tube ₂ 2. mu.l of 0.1M dithiothreitol, 1. mu.l of RNaseOut (40U per. mu.l) and 1. mu.l of SuperScript III RT (200U per. mu.l)). The mixture was left to react at 50 ℃ for 50 minutes to synthesize the first strand of cDNA. The mixture was left to react at 85 ℃ for 5 minutes to stop the reaction, and the vial was maintained at 4 ℃.1 μ l of RNase H was added to the sample and left to react at 37 ℃ for 20 minutes to remove the remaining RNA. Determination of OD ₂₆₀ After concentration of (c), the samples were stored at-20 ℃ for subsequent PCR reactions.

A mouse antibody cohort was established in two rounds of PCR reactions. In the first round of reaction, the cDNA was used as a template and a mixture of primers was used to amplify the variable regions of kappa and lambda (i.e., V.kappa.and V.lambda.) and the variable region of heavy chain (i.e., VH) respectively, according to the procedure established by Barbas et al (G.J. phase Display A Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, New York; 2001). The PCR reaction volume was 50. mu.l, containing MyTaq Hot Start polymerase (Bioline), 0.5. mu.g of cDNA template and 0.3. mu.M of each primer mix; after 25 cycles of reaction (95 ℃:30 seconds, 65 ℃:30 seconds, 72 ℃:1 minute), the final synthesis step was carried out for 10 minutes. The PCR product was analyzed and purified by agarose gel electrophoresis (agarose gel electrophoresis).

In a second round of PCR reaction, the PCR reaction was performed using SEQ ID NO: 226 and 227 combine V κ and V λ with VH, respectively. Briefly, 100 ng of the V κ, V λ and VH PCR products recovered from the first round of PCR products were added to a total volume of 50. mu.l of a mixture containing MyTaq thermal initiation polymerase (Bioline) and 0.3. mu.M of each primer,after 30 PCR cycles (95 ℃ C.: 30 seconds, 65 ℃ C.: 30 seconds, 72 ℃ C.: 1 min 30 seconds) of reaction, the final synthesis step was carried out for 10 minutes. The combined V.kappa. -VH or V.lambda. -VH fragments were cleaved with SfiI and NotI (New England BioLabs) and cloned into the phagemid vector pCANTAB 5E. 10-5. mu.g of the ligation product were transformed into E.coli ER2738 by electroporation (3,000 volts). The resulting mouse antibody population comprises at least 10 ⁹ And (4) scFv.

CS combinations of mouse antibody cohorts using next generation sequencing

To analyze the VL and VH sequences of each scFv expressing antibody, the sequences of SEQ ID NOs: 228-: 228 and 229 are flanked by VL sequences, respectively, and SEQ ID NOs: the primers 230 and 231 are positioned on both sides of the VH sequence. The sequence of the purified DNA fragment was analyzed by Roche 454 GS junior sequence according to titanium sequencing protocol (titanium sequencing protocol).

The original readout data for VH and VL sequences of control and immunized mice were collected by next generation sequencing, respectively. The raw read data was processed with the antibodies 1.0 package to filter the sequence length and translated into individual amino acids. In analyzing each antibody sequence, each CDR was identified by aligning the analyzed sequence with a Hidden Markov Model (HMM) that was either heavy chain-specific or light chain-specific and was constructed from 357 antibody structures. Genetic evolution trees were constructed using MEGA programs and neighbor-joining methods to analyze the genetic relationship between VH and VL sequences. The CS of each CDR was analyzed using the abysis website. And establishing a sequence label of each CDR according to Weblogo and unset background probability and parameters.

Construction of the phage-expressed scFv antibody library of the present invention (GH2)

Preparation of template Av1

The nucleic acid sequence encoding the G6 anti-VEGF Fab (SEQ ID NO: 1) was synthesized in vitro and cloned into the phagemid vector pCANTAB5E to create a template Av 1. Subsequently, TAA stop codons were transferred into each CDR to ensure that only antibodies carrying the modified gene could be expressed in the phageA surface. To obtain a polypeptide having the sequence of SEQ ID NO: 21 DNA fragments of the nucleic acid sequence of 107-127 were used to modify the nucleic acid sequences of CDR-L1, CDR-L2 and CDR-L3 in template Av1 to create a VL antibody library; to obtain a polypeptide having the sequence of SEQ ID NO: 27 DNA fragments of the nucleic acid sequence of 128-154 were used to modify the nucleic acid sequences of CDR-H1, CDR-H2 and CDR-H3 in template Av1 to create a VH2 antibody library; to obtain a polypeptide having the sequence of SEQ ID NO: 128-133 and 155 to modify the nucleic acid sequences of CDR-H1, CDR-H2 and CDR-H3 in template Av1 to create a VH3 antibody library; to obtain a polypeptide having the sequence of SEQ ID NO: the 8 DNA fragments of the nucleic acid sequences of 128-133 and 156-157 were used to modify the nucleic acid sequences of CDR-H1, CDR-H2 and CDR-H3 in template Av1 to create a VH4 antibody library; to obtain a polypeptide having the sequence of SEQ ID NO: 9 DNA fragments of the nucleic acid sequences of 128-133 and 158-160 were used to modify the nucleic acid sequences of CDR-H1, CDR-H2 and CDR-H3 in template Av1 to create a VH5 antibody library; to obtain a polypeptide having the sequence of SEQ ID NO: 10 DNA fragments of the 128-133 and 161-164 nucleic acid sequences were used to modify the CDR-H1, CDR-H2 and CDR-H3 nucleic acid sequences in template Av1 to create a VH6 antibody library; to obtain a polypeptide having the sequence of SEQ ID NO: 11 DNA fragments of the 128-133-and 165-169-nucleic acid sequences were used to modify the nucleic acid sequences of CDR-H1, CDR-H2 and CDR-H3 in template Av1 to create a VH7 antibody library; to obtain a polypeptide having the sequence of SEQ ID NO: the 12 DNA fragments of the 128-133 and 170-175 nucleic acid sequences were used to modify the nucleic acid sequences of CDR-H1, CDR-H2 and CDR-H3 in template Av1 to create a VH8 antibody library; to obtain a polypeptide having the sequence of SEQ ID NO: 13 DNA fragments of the 128-133 and 176-182 nucleic acid sequences were used to modify the nucleic acid sequences of CDR-H1, CDR-H2 and CDR-H3 in template Av1 to create a VH9 antibody library; to obtain a polypeptide having the sequence of SEQ ID NO: 16 DNA fragments of the nucleic acid sequences of 128-133 and 183-192 modified the nucleic acid sequences of CDR-H1, CDR-H2 and CDR-H3 in template Av1 to create a VH11 antibody library; to obtain a polypeptide having the sequence of SEQ ID NO: the 12 DNA fragments of the nucleic acid sequences of 128-133 and 193-198 were used to modify the nucleic acid sequences of CDR-H1, CDR-H2 and CDR-H3 in template Av1 to create a VH12 antibody library; to obtain a polypeptide having the sequence of SEQ ID NO: 9 DNA fragments of the nucleic acid sequences of 128-133 and 199-201 were used to modify the nucleic acid sequences of CDR-H1, CDR-H2 and CDR-H3 in template Av1 to create a VH13 antibody library; to obtain a polypeptide having the sequence of SEQ ID NO: 9 DNA fragments of the 128-133 and 202-204 nucleic acid sequences to modify the template Av1The nucleic acid sequences of CDR-H1, CDR-H2 and CDR-H3 to create a VH14 antibody repertoire; to obtain a polypeptide having the sequence of SEQ ID NO: 9 DNA fragments of the nucleic acid sequences of 128-133 and 205-207 were used to modify the nucleic acid sequences of CDR-H1, CDR-H2 and CDR-H3 in template Av1 to create a VH15 antibody library; to obtain a polypeptide having the sequence of SEQ ID NO: 128-133 and 208-209 to modify the nucleic acid sequences of CDR-H1, CDR-H2 and CDR-H3 in template Av1 to create a VH16 antibody library; and a nucleic acid sequence having SEQ ID NOs: the 8 DNA fragments of the 128-133 and 210-211 nucleic acid sequences were used to modify the CDR-H1, CDR-H2 and CDR-H3 nucleic acid sequences in template Av1 to create a VH17 antibody library. To modify the sequences, the DNA fragments corresponding to the CDRs and T4 polynucleotide kinase (New England BioLabs) were added to a medium containing 70mM Tris-HCl (pH 7.6), 10mM MgCl ₂ 1mM ATP and 5mM dithiothreitol, and then the mixture was reacted at 37 ℃ for 1 hour to phosphorylate each DNA fragment. The phosphorylated DNA fragments were ligated to uracil (uracilated) single-stranded DNA templates in a molar ratio of 3: 1 (oligonucleotide: ssDNA), the mixture was heated to 90 ℃ in a thermal cycler for 2 minutes and then gradually cooled at a rate of 1 ℃ per minute until the temperature reached 20 ℃. Next, the template-primer junction mixture was co-reacted with 0.32mM ATP, 0.8mM dNTP, 5mM DTT, 600 units of T4 DNA ligase, and 75 units of T7DNA polymerase (New England BioLabs) to synthesize DNA in vitro. After reaction at 20 ℃ until every other day, the reaction mixture was centrifuged through a centrifugal filter tube (centrifugal filter,

ultra 0.5mL 30K device) salts in the dsDNA were removed and concentrated, and the treated dsDNA was electroporated into e.coli ER2738 at a voltage of 3,000 volts. In general, a 1 microgram dU-ssDNA appointment yields 10 ⁷ -10 ⁸ Recombinant variants (variants), wherein about 75-90% of the scFv variants comprise three modified CDRs simultaneously.

Screening of functional scFv variants with protein A and protein L

Screening of VL antibody libraries with protein L (i.e., with modified CDR-L1, CDR-L2, and CDR-L3)scFv variants) and protein a was screened for the VH2-VH9 and VH11-VH17 antibody repertoires (i.e., scFv variants with modified CDR-H1, CDR-H2, and CDR-H3). In the screening, each scFv variant of the VL, VH2-VH9 and VH11-VH17 antibody libraries was precipitated with 20% PEG/NaCl and then resuspended in phosphate-buffered saline (PBS); meanwhile, the protein A and the protein L are respectively coated on a 96-hole Maxisorb immune disc (each hole contains 100 microliters of PBS and 1 microgram of protein A or L), and the immune disc is placed at 4 ℃ to every other day; then reacted with 5% skim milk in PBS-T (PBS containing 0.05% Tween-20) for 1 hour. Next, 100 microliters of suspended scFv variants (10 per milliliter) were added per well ¹³ cfu), gently shaken for 1 hour. Wash 12 and 2 times with 200 μ l PBST and 200 μ l PBS, respectively. 100 microliters of 0.1M HCl/glycine (pH 2.2) was added per well to elute the attached variants, followed by neutralization of the eluate with 8 microliters of 2M Tris-containing buffer (pH 9.1). The eluted scFv variants were mixed with 1 ml of E.coli ER2738 (A) _600nm 0.6) and incubated at 37 ℃ for 15 minutes. After titration analysis (titrate) of E.coli, the cells were placed in 50 ml of a 2-fold Yeast extract containing 100. mu.g of ampicillin (ampicillin) per ml and a tryptic protein medium (YT medium) and cultured at 37 ℃ to every other day. After centrifugation, the bacterial pellet was resuspended and its phagemid DNA was extracted as follows.

Combining functional scFv variants into the GH2 antibody repertoire

Phagemid DNA extracted from variants of the VL antibody library was used as a template with a DNA fragment having the sequence of SEQ ID NO: 212 and a forward primer having the nucleic acid sequence of SEQ ID NO: 213, amplifying the nucleic acid sequence of VL with a negative primer; phagemid DNA extracted from variants of the VH antibody repertoire (i.e., VH2-VH9 and VH11-VH17) was used as a template with a DNA fragment having the sequence of SEQ ID NO: 214 and a forward primer having the nucleic acid sequence of SEQ ID NO: 215, or a negative primer, amplifies the nucleic acid sequence of the VH. The PCR reaction volume was 50. mu.l, containing KOD Hot Start polymerase (Novagen), 100 ng of DNA template and 0.3. mu.M of each primer; after 25 cycles of reaction (95 ℃:30 seconds, 65 ℃:30 seconds, 72 ℃:1 minute), the final synthesis step was carried out for 10 minutes. After cleavage of the product with EcoRI, the product was purified by agarose gel electrophoresis.

Combining the VL and VH nucleic acid sequences in another PCR reaction; in this reaction, two primers have the sequences shown in SEQ ID NO: 216 and 217. In the second round of PCR, 100 ng of the first round PCR reaction products (i.e., purified VL and VH) were added to a total volume of 50. mu.L of a mixture containing MyTaq hot start polymerase and 0.3. mu.M of each primer, and after 30 PCR cycles (95 ℃:30 seconds, 65 ℃:30 seconds, 72 ℃:1 min 30 seconds), the final synthesis step was performed for 10 minutes. The combined VL-VH fragments were cleaved with SfiI and NotI (New England BioLabs) and cloned into the phagemid vector pCANTAB 5E. The ligation product was transformed into E.coli ER2738 by electroporation (3,000 volts).

The resulting phage-expressed scFv libraries were designated GH2 (genetic human, 2 nd edition) -GH9 and GH11-GH17, respectively, which comprise phage expressing specific VL and VH sequences, respectively (as shown in table 1).

TABLE 1 CDR sequences of specific antibody libraries

Preparation of recombinant antibodies from GH2-GH9 and GH11-GH17 antibody repertoires

The expression was performed in IgG format, using phagemids extracted from the GH2-GH9 and GH11-GH17 antibody repertoires as templates, and nucleic acid sequences encoding VH and VL were amplified by PCR reaction and cloned into the mammalian expression vector pIGG. The DNA polymerase with proof-reading function (KOD hot start DNA polymerase, Novagen) and SEQ ID NO: 218 and 219 to amplify VL sequence by PCR reaction; using SEQ ID NO: 220 and 221 to amplify VH sequences. The PCR reaction, which contained 100 ng of DNA template and 1. mu.l of each primer at 10. mu.M in a total volume of 50. mu.l, was carried out for 30 cycles (95 ℃ C.: 30 seconds, 56 ℃ C.: 30 seconds, 72 ℃ C.: 30 seconds) and then, for 10 minutes at 72 ℃ for the final synthesis step. Linking the VL and VH sequences using a linker which is represented by SEQ ID NO: the primers 222 and 223 were amplified from the pIG vector by PCR. The connectors comprise the following sequences in order: a constant region of light Chain (CL), a polyadenylation signal of bovine growth hormone (BGA-poly A signal), a human CMV promoter and a signal peptide of IgG heavy chain. To link the VL sequence, linker and VH sequence, SEQ ID NO: the primer pairs of 218 and 221 were subjected to PCR for 30 cycles (95 ℃ C.: 30 seconds, 58 ℃ C.: 30 seconds, 90 ℃ C.: 30 seconds). The PCR product was cloned into the pIGG vector. Briefly, 2. mu.l (20 ng) of linearized (cleaved with KpnI and NheI) pIGG vector, 2. mu.l (20 ng) of DNA to be cloned, and 4. mu.l of Gibson Assembly Master Mix (New England Biolabs Inc. Ipswich, MA, USA) were mixed uniformly and left to react at 50 ℃ for 1 hour. After that, half the volume of the conjugation mixture was transformed into E.coli JM109 competent cells. The correct DNA sequence of the inserted plasmid was confirmed by restriction enzyme cleavage site and DNA sequencing. The resulting construct contains both light and heavy chains of IgG, which are expressed kinetically by the human CMV promoter, respectively.

The above constructs were transfected into HEK293 Freestyle (293-F, Life Technologies, USA) cells and cultured in serum-free Freestyle 293 expression medium (Life Technologies), gently shaken (110rpm) and cultured in a 37 ℃ incubator containing 7% CO2 (Thermo Scientific). To transfect the construct into 500 ml of cell culture medium, 293-F cells were first suspended in a 2L Erlenmeyer flask and cell density adjusted to 1.0X10 per ml ⁶ A cell. Plasmid DNA (500. mu.g) was dissolved in 25 ml of serum-free cell culture medium and filtered through a 0.2 μm syringe filter; thereafter, the treated plasmid DNA was vigorously mixed with 25 ml of a cell culture solution containing 1 mg of polyethyleneimine (PEI, Polysciences). After 20 minutes at room temperature, the mixture was added to the cells and shaken gently, and then the cells were placed in an environment of 37 ℃Culturing in medium. 24 hours after transfection, trypsinin N1(Tryptone N1, ST Bio, Inc) was added at a final concentration of 0.5%. After 5 days of incubation, the supernatant was collected by centrifugation at 8000Xg for 30 minutes and filtered through a 0.8 micron membrane filter (Pall Corporation, Michigan). The supernatant was injected into a HiTrap Protein A affinity column (HiTrap Protein A affinity column, GE Healthcare, Uppsala, Sweden) and eluted into one-tenth volume of 1M Tris-HCl buffer (pH 9.1) with 0.2N glycine-HCl (pH 2.5). The high molecular weight aggregates were further removed using a Superdex 200 gel filtration column (Superdex 200 gel filtration column,10/300GL, GE Healthcare, Uppsala, Sweden) to purify the IgG proteins.

Competitive immunoassay (Competition assay)

HER2/ECD peptide dissolved in PBS buffer (pH7.4) was applied to NUNC 96-well Maxisorb immune discs (0.2. mu.g per well), placed at 4 ℃ to alternate days, and then 5% skim milk dissolved in PBST was added and reacted for 1 hour. Next, 1-3. mu.g of purified scFv or IgG antibody was added to each well, shaken gently for 30 minutes, and incubated for 1 hour after 50. mu.l of test phage was added. Each well was washed 6 times with 300. mu.l of PBST (containing 0.05% (v/v) Tween-20), and then with horseradish peroxidase (horse-radish peroxidase)/anti-M13 antibody conjugate (dilution ratio 1:2000) and horseradish peroxidase/anti-E-tag antibody conjugate (dilution ratio 1:3000) were added for 30 minutes. After washing 6 times and 2 times with PBST and PBS buffer, respectively, 3 ', 5, 5' -tetramethyl-benzidine peroxidase substrate (3,3 ', 5, 5' -tetramethyl-benzidine peroxidase substrate, Kirkegaard & Perry Laboratories) was added to react for 5 minutes, the reaction was stopped with 1.0M HCl, and the spectral reading at a wavelength of 450 nanometers (nm) was read. Competitive immunoassay values were calculated by aligning each control group sample without scFv or IgG antibodies. The competition values were analyzed using the gplots component of the R software to generate a heatmap of the treemap structure with competition results (normalizing the competition values to 0 to 100).

BIAcore test

Detection of antibodies and antigens HER2/ECD using BIAcore T200(GE Healthcare) instrumentBinding affinity and kinetic parameters. HER2/ECD dissolved in 10mM acetate buffer (pH 5.0) was immobilized on a CM5 sensor chip using an amine conjugate kit (amine conjugation kit) with a reaction unit (response unit) of 1000. Binding constant (k) between the detection of IgG and HER2/ECD interactions _on ) And dissociation constant (k) _off ) In this case, PBST (containing 0.05% Tween-20) was used as a running buffer (running buffer), and the flow rate was set to 30. mu.l/min. Before injecting the new IgG antibody, the sensor chip surface was regenerated (regenerate) with 10mM glycine (pH 1.5), and the reference (channels not coated with ligand (ligand)) was subtracted from the signal obtained. Global alignment (global alignment) was performed with the 1:1 binding mode of Biaeevaluation software (GE Healthcare) to determine binding kinetics.

Localization of epitopes (Epitope mapping)

Deuterated antigen-antibody complexes, deuterated antigens and non-deuterated antigens are respectively prepared, and the epitope positions are analyzed by using a hydrogen-deuterium exchange method (HDX-MS) by utilizing LC-tandem mass spectrometry. In the preparation of deuterated antigen-antibody complexes, 1.1 mg/ml of HER2/ECD and 6 mg/ml of antibody were mixed and allowed to react at room temperature for 1 hour to prepare an antigen-antibody complex in a molar ratio of 1: 2. The samples were mixed with 2. mu.g of the glycanase-PNGase (P0704S, NEB) and allowed to react at 37 ℃ for 2 hours to deglycate the proteins and increase the sequence coverage by mass spectrometry. Mu.l of antigen or antigen-antibody complex was mixed with 20. mu.l of deuterated buffer (100% D) ₂ O,10mM TRIS,140mM NaCl, pH 7.2), followed by 10 minutes of crossover culture at room temperature to deuterate the sample. The exchange reaction was quenched by adding 75 microliters of ice quenching solution (containing 0.15% formic acid, 8M urea and 1M TCEP, pH 2.5) and the sample volume was reduced to 20 microliters at 0 ℃ with a centrifugal concentrator (Vivaspin 500,10kDa, GE Healthcare) at 7,500 rpm. The sample was diluted by adding 40. mu.l of a pre-cooled acidic solution (containing 0.15% formic acid and 100 mM TCEP, pH 2.5) to reduce the urea concentration, after which the sample was diluted with 3. mu.l of pepsin (pepsin, per milli)L 5 mg) and 3. mu.l of a type XIII protease (protease type XIII, 50 mg per ml) were reacted on ice for 30 minutes. The reacted sample was frozen with liquid nitrogen and then frozen at-80 ℃. Non-deuterated antigens were prepared using a procedure similar to that described above (without performing a deuteration step).

To determine peptide mass, 10 microliters of thawed sample was injected into a tandem liquid chromatography system (Accela pump, Thermo Scientific) and ESI mass spectrometer (Velos Pro LTQ, Thermo Scientific) for isolation and analysis. With C ₁₈ Pipe column (Xbridge C) ₁₈ 3.5 μm,1.0x150mm, Waters) and from 10% to 60% of solvent B (solvent a: water and 0.15% formic acid; solvent B: acetonitrile and 0.1% formic acid) were separated with a linear gradient, the flow rate was set at 50. mu.l/min and the reaction time was 30 minutes. C is to be ₁₈ The column, syringe and centrifuge tube were placed on ice to reduce back-exchange. Mass spectral data were collected in resolution mode (m/z 300-. The centroid value (centroid value) of each peptide isotope distribution (isotopic evenlevel) was detected by HX-Express 2. The deuteration amount of each peptide derived from the antigen was calculated by the formula (1):

wherein, m (P), m (N), and m (F) are the centroids of the deuterated antigen-antibody complex, the non-deuterated antigen, and the deuterated antigen, respectively. The site is considered to be a binding site only when the amount of deuteration is changed by more than 10%.

EC for antibody-antigen interaction ₅₀

Antibodies were added to immobilized HER2/ECD in increments to analyze antibody for EC by ELISA ₅₀ . Briefly, HER2/ECD peptide dissolved in PBS buffer (pH7.4) was coated onto Maxisorb immune discs (0.2. mu.g per well) in NUNC 96 wells and placed at 4 ℃ to every other day; thereafter, 5% skim milk in PBST was added and reacted for 1 hour. At the same time, the milk can contain 5 percent of milkPBST serially diluted the antibody twice, resulting in 11 different concentrations of antibody. Thereafter, 100. mu.l of diluted antibody at various concentrations was taken, added to each well, and reacted for 1 hour with gentle shaking. After washing 6 times with 300. mu.l of PBST, 100. mu.l of horseradish peroxidase/anti-human IgG antibody conjugate (dissolved in PBST containing 5% milk at a dilution ratio of 1:2000) was added and reacted for 1 hour. After washing with PBST and PBS buffer for 6 times and 2 times, respectively, 3 ', 5, 5' -tetramethyl-benzidine peroxidase substrate (Kirkegaard) was added&Perry Laboratories) for 3 minutes, after which the reaction was stopped with 1.0M HCl and the spectral reading at a wavelength of 450 nanometers (nm) was read. EC calculation according to Stewart and Watson method ₅₀ (nanograms per milliliter).

Immunofluorescent staining

SKBR3 cells were plated on Lab-Tek II chamber slides (Nunc), grown overnight, and then antibody was added and allowed to stand at 37 ℃ for a specific time and fixed with methanol. After cell membrane perforation (permeabilize) with TBS-Tx (TBS containing 0.1% tritium nuclei X-100), blocking buffer (blocking buffer; TBS-Tx containing 2% BSA) was added and allowed to act at room temperature for 10 minutes. Then, adding a primary antibody dissolved in a blocking buffer solution, and acting at 4 ℃ until every other day; after washing, secondary antibodies (goat anti-rabbit antibody linked to Alexa-488, and goat anti-human antibody linked to Alexa-647, Invitrogen) dissolved in blocking buffer were added and reacted at room temperature for 60 minutes; after washing, blocking was performed with a blocking agent comprising dapi (life technologies). The slides were observed with a TCS-SP5-MP-SMD confocal microscope (Leica) equipped with 40-fold and 100-fold apochromatic objective lenses (apochromatat objects). Alexa fluorophores were excited at 488 nm and 647 nm with Argon and NeHe laser light, respectively. The resulting images were analyzed by LAS AF software (Leica).

Western blot analysis

Cell lysates taken from the antibody-treated cells and the control cells were injected into SDS-PAGE, respectively, and then transferred onto PVDF membrane. Adding 5% skimmed milk dissolved in TBS (containing 0.1% Tween-20) for 30 min, adding primary antibody, and allowing reaction at 4 deg.C until every other day; then, a secondary antibody (Amersham Biosciences, Piscataway) bonded to horseradish peroxidase was added to perform a reaction. Protein expression was observed using Pierce ECLWestern blotting substrate (Thermo Fisher Scientific) and ImageQuant LAS-4000(GE Healthcare).

Pseudo virus neutralization test (Pseudovirus neutralization assay)

The H1N1 pseudovirus was prepared by transfecting a lentiviral nuclear plasmid (lentivirus core plasmid) encoding luciferase (luciferase) into cells together with a plasmid encoding HA, NA and TMPRSS2 protein (A/California/04/2009). The final concentration of 293T cells was adjusted to 2X 10 per ml ⁵ And (4) cells. 50 microliters of 293T cells were added to a 96-well plate. Thus, each well contains 10,000 cells. Place the cells at 37 ℃ CO ₂ The incubator is 18 hours. Sterile scFv were prepared by passing through a 0.45 micron 96-well filter disc (PALL corp.). Sterile scFv were serially diluted in MEM cell culture medium (Gibco) containing 0.3% BSA. 80 microliters of pseudovirus was CO-cultured with 80 microliters of sterile scFv at 37 ℃ CO ₂ Incubate for 45 minutes to allow for neutralization. Cell culture medium of 293T cells cultured for 18 hours was removed before the test, and the mixture was added to the cells and then subjected to CO at 37 deg.C ₂ Culturing in an incubator for 10-12 hours. , replacing the pseudovirus/scFv mixture with fresh DMEM (Gibco) containing 10% FBS (Gibco). The cells were cultured for an additional 48 hours. The cell culture fluid was removed to detect luciferase expression. 20 μ l of 1-fold lysis buffer (Promega) was added to each well and mixed well with the solution cells by shaking for 15 minutes. 50 microliters of luciferase reagent (Promega) was added to each well of a white 96-well plate (Griiner Bio-one). Cell lysates from corresponding wells were transferred to white 96-well plates. Luciferase activity in the plates was analyzed by Victor3(Perkin Elmer).

Example 1 analysis of mouse antibody cohorts

To analyze the mouse antibody group, mrnas from m0, m3, m4, and m6 mice (as described in materials and methods) were extracted and inverted into corresponding cdnas, and then the cDNA was used as a template to amplify VH and VL sequences, wherein the VH sequences comprise V _H -D _H -J _H The DNA segment, the Vkappa sequence comprising a Vkappa-Jkappa DNA segment and the Vlambda sequence comprising a Vlambda-Jlambda DNA segment. The amplified VH and VL sequences were inserted into a phagemid vector pCANTAB5E, which was transformed into E.coli ER2738 to amplify scFv-expressing phages. A total of 316 phages were obtained which expressed scFv with binding affinity for the peptides HER2/ECD, respectively, and these were labeled S316.

Analyzing the CS type of each CDR by using the NGS; the results of the analysis indicated that VH, Vkappa and Vlambda of the four groups of mice and S316 have similar CS types, with the major CS types of CDR-H1 and CDR-H2 being type I and type II, respectively, and the major CS types of CDR-L kappa 1 and CDR-L kappa 2 being type II and type I, respectively, and that only one CS combination was observed in the CDR-V lambda sequence (results not shown). These results also suggest that neither differences in the immunization protocol nor the antibody screening process affect the distribution of antibody populations. It is known that VL in the mouse antibody group is mainly V κ, and the distribution of CDR-L3 of V κ is mainly concentrated in a length of 9 residues, where CDR-L3 is mainly CS of type I (results not shown). Thus, the CS combinations for all antibody groups are mainly: CDR-H1 of CS type I, CDR-H2 of CS type II, CDR-L1 of CS type II, CDR-L2 of CS type I, and CDR-L3 of CS type I. As for CDR-H3, although not having a particular form of CS type, the length distribution was mainly centered on a length of 11 residues.

These results indicate that the mouse antibody group contains at least 10 ⁹ scFv in which the major CS types of CDR-H1 and CDR-H2 are type I and type II, respectively, and the major CS types of CDR-L1, CDR-L2 and CDR-L3 are type II, type I and type I, respectively.

Example 2 establishment of the antibody libraries of the invention GH2-GH9 and GH11-GH17

2.1 construction and modification

Based on the analysis results of example 1 (i.e., CDR-H1, CDR-H2, CDR-L1, CDR-L2 and CDR-L3 of the mouse antibody group have CS combinations of 1-2-2-1-1, respectively), SEQ ID NOs were synthesized: 1, which can be used to encode a Fab of G6 anti-VEGF; the synthetic sequence was cloned into the phage vector pCANTAB5E to produce the recombinant phagemid Av 1. The recombinant phagemid Av1 had a similar aromatic residue distribution with CDR-H1, CDR-H2, CDR-H3, CDR-L1, CDR-L2 and CDR-L3 of an antibody group derived from four groups of mice (i.e., m0, m3, m4 and m6), S316 and 584 antibodies (labeled S584) published in the Protein Data Bank (results not shown).

Since short chain hydrophilic residues on the antibody-antigen interaction surface in the CDRs affect the specificity of the antibody for antigen recognition by short-range electrostatic interactions and direct hydrogen bonding, the antibody has the amino acid sequence shown in SEQ ID NO: 21 DNA fragments of the nucleic acid sequence of 107-127-modified antibody library the nucleic acid sequences of CDR-L1, CDR-L2 and CDR-L3 of recombinant phagemid Av1 to create a VL antibody library; and is expressed as a peptide having SEQ ID NO: the 84 DNA fragments of the 128-211 nucleic acid sequences modified the CDR-H1, CDR-H2 and CDR-H3 nucleic acid sequences of the recombinant phagemid Av1 to create a VH antibody library (i.e., VH2, VH3, VH4, VH5, VH6, VH7, VH8, VH9, VH11, VH12, VH13, VH14, VH15, VH16 or VH17 antibody library). Screening VL and VH antibody libraries by using protein L and protein A respectively; phagemid DNA was extracted from scFv variants having binding affinity for protein L and protein A, and VL and VH nucleic acid sequences were amplified using these phagemid DNAs as templates, respectively. The amplified nucleic acid sequences were inserted into a phagemid vector pCANTAB5E, which was then transformed into E.coli strain ER2738 to amplify the scFv-expressing phages. The scFv libraries obtained by phage expression were designated as antibody libraries GH2, GH3, GH4, GH5, GH6, GH7, GH8, GH9, GH11, GH12, GH13, GH14, GH15, GH16 and GH17, respectively.

The above results show that the antibody repertoire of the invention (i.e. GH2, GH3, GH4, GH5, GH6, GH7, GH8, GH9, GH11, GH12, GH13, GH14, GH15, GH16 and GH17) comprises a plurality of phage-expressed scfvs having the following characteristics: (1) specific combinations of CSs, wherein CDR-H1, CDR-L2 and CDR-L3 have a first type of CS and CDR-H2 and CDR-L1 have a second type of CS; (2) a specific aromatic residue distribution that is similar to that of a natural antibody; and (3) a nucleic acid sequence specified in each CDR, wherein CDR-L1 consists of a sequence comprising SEQ ID NO: 2-10, and CDR-L2 is encoded by a sequence comprising SEQ ID NO: 11-14, and CDR-L3 is encoded by a sequence comprising the nucleic acid sequence of SEQ ID NO: 15-22, and CDR-H1 is encoded by a sequence comprising SEQ ID NO: 23-26, and CDR-H2 is encoded by a sequence comprising the nucleic acid sequence of any one of SEQ ID NOs: 27-28, and CDR-H3 is encoded by a sequence comprising SEQ ID NO: 29-106, or a pharmaceutically acceptable salt thereof.

2.2 confirmation of antibody pools GH2-GH9 and GH11-GH17

The antibody libraries established in example 2.1, GH2-GH9 and GH11-GH17, were confirmed by the following assay: (1) competitive immunoassay for determining the epitope of an antigen; (2) EC (EC) ₅₀ And a BIAcore assay method for evaluating the binding affinity between antigen and antibody; and (3) locating epitopes, which are used for analyzing the epitopes of the antigen molecules recognized by the antibodies.

From the GH2 antibody repertoire, 90 anti-HER 2/ECD scfvs (labeled as S90 antibodies) were randomly picked, with three major antigen binding sites: antigen binding sites M32-M62, M63-M64 and M41-M61 (results not shown). The binding affinity of antibody S316 and 6 mouse antibodies (M32, M41, M61, M62, M63, and M64; all of which were obtained directly from immunized mice and have different gene segments) to peptides HER2/ECD was evaluated by competitive immunoassay; in this experiment, four antibodies known to be specific for HER2 (i.e., a21, Fab37, pertuzumab (pertuzumab), and trastuzumab (trastuzumab)) were used as controls. In structural analysis data, the known peptide HER2/ECD can be divided into four protein domains (domains; i.e., protein domains I, II, III and IV), wherein epitopes recognized by A21, Fab37, pertuzumab and trastuzumab are located in protein domains I, III, II and IV, respectively; epitopes recognized by antigen binding sites M32-M62, M63-M64 and M41-M61 were located in protein domains I, III and IV, respectively (results not shown). For competitive immunoassays, it was shown that a portion of the antigen binding sites M32-M62 overlaps with the antigen binding site of A21; antigen binding sites M63-M64 will overlap with the antigen binding site of Fab 37; whereas the antigen binding sites M41-M61 did not overlap with the antigen binding sites of any known antibodies (results not shown). Epitope mapping results indicate that epitope E1, which is recognized by antigen binding positions M32-M62, is adjacent to epitope E, which is recognized by A21, but that there is no overlap of epitopes; epitope E3, which may be recognized by antigen binding sites M41-M61, is located on a surface patch that is remote from the epitope recognized by trastuzumab.

Thus, these results show that the GH2 antibody repertoire comprises a plurality of scfvs that recognize different epitopes of an antigen (i.e., peptide HER 2/ECD); and epitopes recognized by the GH2 repertoire may be different from those recognized by known antibodies.

Example 3 preparation of recombinant antibodies from antibody libraries GH2-GH9 and GH11-GH17

3.1 preparation and analysis of recombinant antibodies from the antibody library GH2

To prepare recombinant antibodies with binding affinity for the antigen HER2, antibody repertoire GH2 was subjected to 2-3 rounds of selection/amplification steps to select scFv variants that bind to peptide HER 2/ECD. The selected scFv variants were expressed as soluble scFv and then screened for the same peptide HER 2/ECD. To prepare the recombinant antibody as an immunoglobulin, the scFv that binds to HER2/ECD was converted to IgG antibodies according to the "materials and methods" procedure. Evaluation of recombinant antibodies by ELISA and BIAcore to determine the EC of recombinant antibodies against the peptide HER2/ECD ₅₀ And antigen binding affinity.

The S90 antibodies of example 2.2 were used to randomly select 29 scfvs and express these in IgG form (i.e. GH2-3, GH2-7, GH2-8, GH2-13, GH2-14, GH2-16, GH2-18, GH2-21, GH2-23, GH2-36, GH2-40, GH2-42, GH2-54, GH2-59, GH2-60, GH2-61, GH2-65, GH2-66, GH2-72, GH2-75, GH2-78, GH2-81, GH2-87, GH2-91, GH2-95, GH2-96, GH2-98, GH2-102 and GH2-104), hereinafter denoted as S2 IgG. 6 antibodies (i.e., M32, M41, M61, M62, M63, and M64) and a commercial antibody, trastuzumab, were used as controls in this experiment. As shown in table 2EC of S29 IgG compared to affinity-matured (affinity-matured) antibodies (i.e., M32, M41, M61, M62, M63, M64, and trastuzumab) ₅₀ The lower limit. Of note, the EC for 12 IgG antibodies out of S29 IgG ₅₀ EC lower than trastuzumab ₅₀ . With respect to binding affinity, BIAcore measurements indicated K for S29 IgG _D Has a lower limit of about 10 ^-11 M, which is the value associated with the K of the affinity matured antibody (i.e., M32, M41, M61, M62, M63, M64 and trastuzumab) _D The lower limit is similar.

TABLE 2 analysis of S29 IgG, affinity matured, humanized and commercial antibodies in 6 mice

Furthermore, CDR sequences of S29 IgG, 6 mouse affinity matured antibody, humanized antibody and commercial antibody were also analyzed and assigned to SEQ ID NO: 233. 235, 237 and 241, 334 wherein antibody M32 is represented by SEQ ID NO: 232 is encoded by the nucleic acid sequence of (a); antibody M62 is a polypeptide consisting of SEQ ID NO: 236 is encoded by a nucleic acid sequence; the CDR sequence of humanized antibody H32 is represented by SEQ ID NO: 234, or a pharmaceutically acceptable salt thereof.

In addition to the peptides HER2/ECD, the GH2 repertoire was also used to generate recombinant antibodies with binding affinity for other antigens. A similar procedure to the first paragraph of example 3.1, using 22 different protein antigens, a GH2 antibody library was screened, of which 20 protein antigens could be recognized by antibodies made with GH2 (table 3).

TABLE 3 binding specificity of the GH2 antibody repertoire for specific protein antigens

^a The ratio refers to the positive strains that have a positive response to the corresponding antigen in the total analysis population.

^b The ratio refers to the positive strains whose sequence is unique among all positive strains sequenced.

^C ECD: the extracellular domain of a receptor.

Taken together, the results indicate that the GH2 repertoire can be used to produce different recombinant antibodies with high binding affinity (about 10) for different antigens ^-7 To 10 ^-11 M), and the recombinant antibodies have antigen binding affinity similar to that of affinity matured or commercial antibodies.

3.2 analysis of recombinant antibodies prepared from antibody libraries GH3-GH9 and GH11-GH17

This example will be further analyzed to detect recombinant antibodies prepared from antibody libraries GH3-GH9 and GH11-GH 17.

Tables 4-17 illustrate the binding specificity of recombinant antibodies prepared from antibody libraries GH3-GH9 and GH11-GH17, respectively, for particular protein antigens.

TABLE 4 binding specificity of the GH3 antibody repertoire for specific protein antigens

^C ECD: the extracellular domain of a receptor.

TABLE 5 binding specificity of the GH4 antibody repertoire for specific protein antigens

^a Ratio means that in a single population of the total analysis, pairs correspondThe antigen of (3) has a positive strain with a positive reaction.

^C ECD: the extracellular domain of a receptor.

TABLE 6 binding specificity of the GH5 antibody repertoire for specific protein antigens

^C ECD: the extracellular domain of a receptor.

TABLE 7 binding specificity of the GH6 antibody repertoire for specific protein antigens

^C ECD: the extracellular domain of a receptor.

TABLE 8 binding specificity of the GH7 antibody repertoire for specific protein antigens

^C ECD: the extracellular domain of a receptor.

TABLE 9 binding specificity of the GH8 antibody repertoire for specific protein antigens

^a The ratio is the positive strains that have a positive response to the corresponding antigen in the total analysis population.

^C ECD: the extracellular domain of a receptor.

TABLE 10 binding specificity of the GH9 antibody repertoire for specific protein antigens

^C ECD: the extracellular domain of a receptor.

TABLE 11 binding specificity of the GH11 antibody repertoire for specific protein antigens

^b The ratio means that among all sequenced positive strains,positive strain with unique sequence.

^C ECD: the extracellular domain of a receptor.

TABLE 12 binding specificity of the GH12 antibody library for particular protein antigens

^C ECD: the extracellular domain of a receptor.

TABLE 13 binding specificity of the GH13 repertoire for particular protein antigens

^C ECD: the extracellular domain of a receptor.

TABLE 14 binding specificity of the GH14 antibody repertoire for specific protein antigens

^a The ratio is positive for the corresponding antigen in a single population of the total assayAnd (4) a corresponding positive strain.

^C ECD: the extracellular domain of a receptor.

TABLE 15 binding specificity of the GH15 antibody repertoire for specific protein antigens

TABLE 16 binding specificity of the GH16 antibody repertoire for specific protein antigens

^C ECD: the extracellular domain of a receptor.

TABLE 17 binding specificity of the GH17 antibody repertoire for specific protein antigens

^a The ratio refers to the ratio of the total analysis in a single population,positive strains having a positive response to the corresponding antigen.

^C ECD: the extracellular domain of a receptor.

These results indicate that recombinant antibodies prepared from GH3-GH9 and GH11-GH17, respectively, have binding specificity for different protein antigens, including IL-1 β, HA, NP, EGFR1, EGFR 2, EGFR3, human DNase I, PD-L1 and SIGLEC 3.

3.3 analysis of the biological function of recombinant antibodies

Functional assays were used to assess the biological function of 6 antibodies (i.e., M32, M41, M61, M62, M63, and M64) directly taken from HER2/ECD immunized mice and recombinant antibodies prepared from the GH2 antibody repertoire. Compared to trastuzumab and pertuzumab, antibody M32 binds to a novel epitope of domain I of HER2/ECD (results not shown) and causes HER2 to be internalized, thereby reducing the amount of receptor expression on the surface of SKBR3 cells that overexpress HER2 (fig. 1A and 2). Antibody M62 has similar epitope positions as M32 (results not shown), and similar effect on reducing cell surface HER2 expression as M32 (fig. 1A and 2). Antibodies M63 and M41 bound to epitopes of domain III and domain IV of HER2, respectively, and neither reduced HER2 expression (results not shown).

With respect to recombinant antibodies, although recombinant antibodies GH2-42 and GH2-75 recognize similar epitopes and have similar binding affinities (about 10) to M32 ^-10 M, table 2), however recombinant antibodies GH2-42 and GH2-75 did not cause a decrease in HER2 expression as did M32 (fig. 1B and fig. 2). Co-administration of GH2-42 and trastuzumab or GH2-18 (a recombinant antibody with a similar antigen binding site to trastuzumab) resulted in a decrease in HER2 expression. In addition, co-administration of GH2-75 and GH2-18 also caused HER2 to be internalized (fig. 1B and 2). These results suggest that antibody binding to both protein domains I and IV of HER2/ECD results in decreased expression of HER2, while binding to both protein domains II and IV of HER2 does not result in this effect.

Since HER2 is involved in different information transmission pathways, it was then analyzed whether binding of different antibodies of the invention to HER2 would affect expression or activation of downstream genes. As shown by the Western blot analysis results in fig. 2, various antibodies that bind to different epitope positions of HER2 inhibit activation of AKT and ERK to varying degrees.

These results indicate that the recombinant antibodies prepared from the GH2 library of the invention are diverse and can recognize different epitopes of an antigen, thus resulting in different biological functions.

3.4 analysis of the binding and neutralizing Properties of recombinant antibodies prepared from GH2-GH9 and GH11-GH17 antibody libraries

Based on the recombinant HA binding results from the ELISA assay, three screens with HA derived from a/california/2009H 1N1 yielded 125 unique scfvs. The binding properties of these scFv to native HA protein were analyzed by FACS and H1N1 CA/09 pseudovirus neutralization assay. In this example, F10 scFv (an antibody known to strongly neutralize H1N1 influenza virus) was used as a positive control; s40 as another positive control group; and AV1 was used as a negative control.

From the total number of 125 unique scFv, 14 scFv were selected, which had better neutralizing ability than F10 scFv (approximately 1500 RLU-3000 RLU; FIG. 3A). Further analysis of the binding ability to the native protein and neutralization revealed that 12 out of 14 scFv bound to the native protein with high specificity. Presumably, the other two scfvs were secreted into the cell culture medium in small amounts, resulting in poor binding.

The binding affinity of 14 scfvs to native HA and synthetic HA was evaluated using FACS analysis and ELISA assay, respectively. As shown in fig. 3B, half of the scFv that reacted positive in the ELISA assay failed to bind to the native HA protein. Interestingly, 14 scfvs showed a positive correlation in ELISA and FACS analysis. This result reflects different scFv contents and affinities in cell culture broth.

In summary, the present disclosure provides a phage-expressed scFv repertoire (i.e., a GH2 repertoire) comprising a plurality of phage-expressed scFv having a specific CS combination, aromatic residues specifically distributed in the CDRs, and specific CDR sequences. The GH2 antibody repertoire of the present disclosure can be used to efficiently produce a plurality of recombinant antibodies that have a high binding affinity for a particular antibody. The recombinant antibodies produced have diverse CDRs and therefore bind to different epitopes of a particular antigen, thereby producing different biological effects. The present disclosure provides a method for preparing different antigen-specific antibodies in real time in response to different experimental studies and/or clinical applications.

Although the foregoing embodiments have been described with reference to specific embodiments, it will be understood by those skilled in the art that various changes and modifications may be made without departing from the spirit and scope of the invention as defined in the following claims.

Sequence listing

<110> Taiwan area, Central research institute "

Claims

1. A phage-expressed scFv library comprising a plurality of phage-expressed scFvs, wherein each of the phage-expressed scFvs comprises a first heavy chain complementarity determining region, a second heavy chain CDR, a third heavy chain CDR, a first light chain CDR, a second light chain CDR, and a third light chain CDR,

wherein the content of the first and second substances,

each of the CDR-H1, CDR-L2 and CDR-L3 has a regular structure of a first type, and each of the CDR-H2 and CDR-L1 has a regular structure of a second type; and

the distribution of aromatic residues in each of CDR-H1, CDR-H2, CDR-H3, CDR-L1, CDR-L2 and CDR-L3 is similar to the distribution of aromatic residues in the corresponding CDR-H1, CDR-H2, CDR-H3, CDR-L1, CDR-L2 and CDR-L3 of a natural antibody;

it is characterized in that the preparation method is characterized in that,

the CDR-L1 is formed from a sequence comprising SEQ ID NO: 2-10, or a second coding sequence,

the CDR-L2 is formed from a sequence comprising SEQ ID NO: 11-14, or a second coding sequence of a nucleic acid sequence,

the CDR-L3 is formed from a sequence comprising SEQ ID NO: 15-22, or a third coding sequence of a nucleic acid sequence,

the CDR-H1 is composed of a CDR comprising SEQ ID NO: 23-26, or a fourth coding sequence of a nucleic acid sequence,

the CDR-H2 is composed of a CDR comprising SEQ ID NO: 27-28, and a fifth coding sequence of a nucleic acid sequence,

and the CDR-H3 is formed from a sequence comprising SEQ ID NO: 29-106, or a pharmaceutically acceptable salt thereof.

2. The phage-expressed scFv antibody library of claim 1, wherein the phage is a M13 phage or a T7 phage.

3. The phage-expressed scFv antibody library of claim 1 wherein at least one of the phage-expressed scFv is specific for a protein antigen selected from the group consisting of type II hEGF receptor, maltose binding protein, bovine serum albumin, human serum albumin, lysozyme, interleukin-1 β, influenza hemagglutinin, influenza nucleoprotein, VEGF, type I EGF receptor, type III EGF receptor, glucagon receptor, hDNA, type I programmed death ligand, type III sialic acid-binding immunoglobulin-like lectin, crystalline fragment region of immunoglobulin G, and rituximab.

4. A method for preparing a phage-expressed scFv library of claim 1 comprising:

(1) synthesizing a first nucleic acid sequence comprising a first, a second, a third, a fourth, a fifth and a sixth coding sequence encoding CDR-L1, CDR-L2, CDR-L3, CDR-H1, CDR-H2 and CDR-H3, respectively, of an immunoglobulin gene, wherein the first nucleic acid sequence is as set forth in SEQ ID NO: 1;

(2) inserting the first nucleic acid sequence into a first phagemid vector;

(3) the method comprises the following steps of respectively carrying out site-directed mutagenesis on the sequences shown in SEQ ID NO: 107-115, 116-119 and 120-127 nucleic acid sequences are modified to prepare a variable light chain antibody library comprising a first set of phage-expressed scFvs, wherein each scFv comprises a modified CDR-L1, CDR-L2 and CDR-L3; and the site-directed mutagenesis methods are respectively represented by SEQ ID NO: 128-, 131-, 132-, 133-and 134-211 nucleic acid sequences modifying the fourth, fifth and sixth coding sequences to generate a variant heavy chain antibody library comprising a second set of phage-expressed scFvs, wherein each scFv has a modified CDR-H1, CDR-H2 and CDR-H3;

(4) screening the VL library with a protein L, and selecting a third set of phage-expressed scfvs from the VL library; screening the VH antibody library by using protein A, and selecting a fourth group of scFv expressed by the phage from the VH antibody library;

(6) inserting the second and third nucleic acid sequences into a second phagemid vector to produce the phage-expressed scFv antibody library of claim 1.

5. The method of claim 4, further comprising a step of comparing the distribution of aromatic residues in CDR-H1, CDR-H2, CDR-H3, CDR-L1, CDR-L2 and CDR-L3 of the immunoglobulin gene with the distribution of aromatic residues in the corresponding CDR-H1, CDR-H2, CDR-H3, CDR-L1, CDR-L2 and CDR-L3 of a natural antibody before step (3).

6. The method of claim 4, wherein the first and second phagemid vectors are both derived from the M13 phage.

7. A method of producing a recombinant antibody using the phage-expressed scFv library of claim 1, wherein the recombinant antibody has binding affinity and specificity for a protein antigen; the method comprises the following steps:

(1) screening the phage-expressed scFv antibody library of claim 1 with the protein antigen;

(2) selecting a plurality of phage, wherein the phage express scFv with binding affinity and specificity for the protein antigen;

(3) allowing the phages selected in step (2) to respectively express scFv in a soluble form;

(4) selecting a soluble form scFv with high binding affinity and specificity to the protein antigen from the scFv obtained in the step (3);

(5) extracting a phagemid DNA from the phage which expresses the soluble form of scFv of step (4);

(6) respectively amplifying a first nucleic acid sequence for coding CDR-H1, CDR-H2 and CDR-H3 and a second nucleic acid sequence for coding CDR-L1, CDR-L2 and CDR-L3 by using the phagemid DNA of the step (5) as a template and utilizing polymerase chain reaction;

(7) inserting the first and second nucleic acid sequences into an expression vector comprising a third and a fourth nucleic acid sequences, wherein the third nucleic acid sequence encodes a heavy chain constant region of an immunoglobulin and the fourth nucleic acid sequence encodes a light chain constant region of the immunoglobulin; and

(8) transfecting the expression vector comprising the first, second, third and fourth nucleic acid sequences of step (7) into a host cell to produce the recombinant antibody.

8. The method of claim 7, wherein the first nucleic acid sequence is located upstream of the third nucleic acid sequence and the second nucleic acid sequence is located upstream of the fourth nucleic acid sequence.

9. The method of claim 7, wherein the immunoglobulin is selected from the group consisting of immunoglobulin G, immunoglobulin A, immunoglobulin D, immunoglobulin E, and immunoglobulin M.

10. The method of claim 7, wherein the host cell is a mammalian cell.

11. The method of claim 7, wherein the protein antigen is HER2, MBP, BSA, HSA, lysozyme, IL-1 β, HA, VEGF, EGFR1, EGFR3, glucagon receptor, or rituximab.

12. A recombinant antibody produced from the phage-expressed scFv library of claim 1, wherein the recombinant antibody comprises the amino acid sequence of SEQ ID NO: 253 in the sequence listing.

13. Use of the recombinant antibody of claim 12 for the preparation of a medicament for treating a subject having or suspected of having a HER 2-related disease.

14. The use of claim 13, wherein the HER 2-related disease is a tumor.

15. A composition for treating a HER 2-related disease comprising a first recombinant antibody and a second recombinant antibody, each produced from the phage-displayed scFv library of claim 1, wherein the first recombinant antibody comprises the amino acid sequence of SEQ ID NO: 253, and the second recombinant antibody comprises the amino acid sequence of SEQ ID NO: 274 or 301.

16. Use of the composition of claim 15 for the preparation of a medicament for treating a subject having or suspected of having a HER 2-related disease.

17. The use of claim 16, wherein the HER 2-related disease is a tumor.