CN107604003A - One kind knocks out kit and its application based on linearisation CRISPR CAS9 lentiviral vector genomes - Google Patents
One kind knocks out kit and its application based on linearisation CRISPR CAS9 lentiviral vector genomes Download PDFInfo
- Publication number
- CN107604003A CN107604003A CN201710935589.8A CN201710935589A CN107604003A CN 107604003 A CN107604003 A CN 107604003A CN 201710935589 A CN201710935589 A CN 201710935589A CN 107604003 A CN107604003 A CN 107604003A
- Authority
- CN
- China
- Prior art keywords
- crispr
- cas9
- slow virus
- ligases
- genetic recombination
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Abstract
The invention discloses a kind of gene knockout kit based on CRISPR CAS9 slow virus carriers, the kit includes the CRISPR CAS9 slow virus carriers and corresponding T4 ligases and competent cell of linearisation, it is characterized in that the CRISPR CAS9 slow virus carriers of described linearisation are made up of the circular vectors of endonuclease ferment treatment, described T4 ligases are the T4 ligases of optimization, and described competent cell is with the Stbl3 competence for suppressing restructuring characteristic.The kit can directly carry out the structure of CRISPR CAS9 slow virus carriers, its it is more easy to operate than domestic and international commercial kit and structure recombinate speed is fast, the structure efficiency for being currently based on CRISPR CAS9 slow virus carriers can be effectively improved, reduces the expense of gene knockout.
Description
Technical field
The present invention relates to biological field, and in particular to a kind of research preparation, is particularly used to be based on CRISPR-CAS9
The gene knockout kit of slow virus carrier.
Background technology
Genetic modification is the major issue of current biological field, and in recent years, the fast development of genome editing technique is made a living
Thing research brings new era.Different from traditional gene clone technology, genome editing technique can be directly on genome
Carry out the knockout of DNA sequence dna, insert people, rite-directed mutagenesis and assemble editing etc., realize that the system of gene function and controlling element is ground
Study carefully, had broad application prospects in industrial bio engineering etc..In early days, genome editing technique mainly utilizes homologous recombination
The Knockout technology of mediation, but due to less efficient, significantly limit its application.To solve this problem, a series of artificial nucleus
The genome editing technique of sour restriction endonuclease mediation is developed, and can be broken, borrowed by forming DNA double chain on genome ad-hoc location
Help the repair system such as non-homologous end joining or homologous recombination of cell itself, so as to realize in different biologies and cell type
In effective fixed point genome editor.At present, 4 kinds of different artificial endonucleases mainly are applied to genome editor：
Macronucleus zymotechnic, zinc finger endonuclease (ZFN), class activating transcription factor effector nuclease (TALEN).With RNA target to DNA
The specific dna sequence that restriction endonuclease Cas9, ZFN and TALEN can be interacted on identification genome by the DNA of albumen one.Macronucleus
Zymotechnic has endonuclease enzyme domains and DNA binding domain, and ZFN and TALEN has recognizable 3 and 1 nucleosides respectively
The DNA binding domain of acid, after fusion protein need to be formed with endonuclease FokI inscribe enzyme domains, complete genome certain bits
The cutting of point.But these technologies respectively have deficiency, as macronucleus zymotechnic amino acid residue and DNA target sequence between without clearly special
Property；ZFN DNA binding domain can then be influenceed by DNA target sequence upstream and downstream, need to be navigated to by building different fusion proteins
Different DNA sequence dnas, structure operation is relatively complicated, and cost is higher, and risk of missing the target is higher.RNA target to restriction endonuclease CRISPR-
The genome editing technique of Cas9 mediations then identifies specific DNA sequence dna by one section short of guiding RNA (guideRNA), only
By changing this section of guiding RNA sequence Cas9 need to can be made to navigate to new DNA sequence dna.The technology has been applied to a variety of lifes
Thing, including people, mouse, rat, zebra fish, Caenorhabditis elegans, plant and bacterium.Its technology is also constantly expanded, and is such as utilized
Multiple guiding RNA sequences can carry out the editor of multiple different locis on genome simultaneously；Its DNA binding domain is adjusted from different transcriptions
Control albumen blends, and the transcriptional activation to specific gene or suppression can be achieved；By to the modulin module and base of particular sequence
Because the modification enzyme of group or apparent gene group blends, then the dynamic control to genome can be achieved.
Slow virus is that current transfection field uses a kind of most technologies, can be efficient by building slow virus packaging plasmid
Target gene is incorporated on the chromosome of cell, realize the high-efficiency transfection of difficult transfectional cell and reach the expensive transfection examination of reduction
The effect of agent.
The genome editing technique of CRISPR-Cas9 mediations turns into research heat with the characteristics of its is simple to operate, specificity is high
Point, and still lack the operation that commercialized kit is used for gene editing technology at present, therefore research and develop accurately and reliably, simply in fact
Kit is knocked out as current urgent need, this hair with, the CRISPR-CAS9 lentiviral vector genomes that are adapted to various researchers to operate
The high-efficiency transfection characteristic of bright combination slow virus carrier and high efficiency gene editor's feature of CRISPR-CAS9 technologies, will solve the neck
The important problem in domain.
The content of the invention
The technical problem to be solved in the present invention is the efficiency for the gene knockout for controlling slow virus carrier, reduces gene knockout
Otherness.
Technical proposal that the invention solves the above-mentioned problems is：
One kind knocks out kit based on CRISPR-CAS9 lentiviral vector genomes, and the kit includes linearisation CRISPR-
CAS9 slow virus carriers, the buffer solution of T4 ligases and T4 ligases, high convertibility Stbl3 competent cells, it is characterised in that：
1. linearisation CRISPR-CAS9 slow virus carriers described in are by CRISPR-CAS9 slow virus carriers through endonuclease
Enzyme obtains；
2. ligase described in is T4 ligases；
3. competent cell described in is high convertibility Stbl3 competent cells prepared by Calcium Chloride Method.
In kit of the present invention, the CRISPR-CAS9 slow virus carriers of linearisation include but are not limited to slow virus carrier,
It can be used for common CRISPR-CAS9 carriers；T4 ligases are T4 ligases commonly use or commercialized；Stbl3 competence
Cell is prepared by Calcium Chloride Method.
It is the side by molecular cloning that kit of the present invention, which prepares the knockout plasmid based on CRISPR-CAS9 slow virus carriers,
What formula was realized, i.e., by building the guiding RNA sequence of target gene, restructuring enters linearisation CRISPR-CAS9 slow virus carriers
Form, detailed process is as follows：
In the linearization procedure of 1.CRISPR-CAS9 slow virus carriers, cumulative volume is preferably 50 μ l, wherein CRISPR-
CAS9 slow virus carriers are the μ l of 2 μ g, BsmBI enzyme, 2 μ l, BsmBI enzyme buffer liquid 5, and residue complements to 50 μ l with sterile deionized water.
Then placed 1 hour at 37 DEG C, then carry out gel extraction, specific digestion step is as follows：
2 μ g CRISPR-CAS9 slow virus circular vectors
2 μ l BsmBI enzymes
5 μ l BsmBI enzyme buffer liquids (10U/ μ l)
41 μ l sterile deionized waters
50 μ l cumulative volumes
Carrier is seen after 1% Ago-Gel carries out electrophoresis after nucleic acid staining dye under uviol lamp after digestion
Examine, cut 1% Ago-Gel no more than 400mg, carry out carrier recovery after 55 DEG C of dissolvings, the carrier after recovery carries out dense
Degree measure.
Inventor is evaluated with digesting efficiency by adjusting the dosage of carrier amount and BsmBI enzymes, has filtered out digestion effect
Rate highest matches.
Linearize the screening of the preparation process conditional of CRISPR-CAS9 slow virus carriers
| Carrier amount (μ g) | BsmBI enzymes (μ l) | Cumulative volume (μ l) | Digesting efficiency (%) |
| 1 | 1 | 20 | 55 |
| 1 | 2 | 20 | 70 |
| 2 | 1 | 20 | 50 |
| 2 | 2 | 20 | 65 |
| 1 | 5 | 50 | 95 |
| 1 | 10 | 50 | 90 |
| 2 | 5 | 50 | 98 |
| 2 | 10 | 50 | 80 |
2. building the guiding RNA sequence of target gene, the selection of gRNA target spots and its oligonucleotide chain close (http://
Crispr-mit.edu/ websites) sgRNA target spots select and its oligonucleotide chain synthesis：It is as follows using design standard：Positive-sense strand mould
5 ' end addition CACC of plate；5 ' end addition AAAC of antisense strand template.
The single-stranded annealing of sgRNA oligonucleotides is formed into double-strand：Take positive-sense strand and the antisense strand mixing (final concentration of 10 of equivalent
μl).Program is as follows：37 DEG C, 30 minutes；95 DEG C, 5 minutes；94 DEG C, 12sec ,-l DEG C/circulation, 70 circulations；Final is 24 DEG C,
The sample volume and concentration specifically reacted is as follows.
1 μ l positive-sense strands templates (100mM)
1 μ l antisense strands templates (100mM)
1 μ l T4 ligase buffer solutions
7.5 μ l sterile deionized waters
10 μ l cumulative volumes
3. the restructuring of target gene and linearisation CRISPR-CAS9 slow virus carriers, by positive-sense strand obtained above and instead
Adopted chain is diluted to 0.5 μm of oL/L.Obtained linearisation CRISPR-CAS9 carrier 10ng are added in (1), add the connection of T4 ligases
20 minutes.High convertibility Stbl3 competence, picking monoclonal are converted, idiographic flow is：
1 μ l linearisation CRISPR-CAS9 carriers 10ng
1 μ l positive-sense strands and antisense strand mixture
1 μ l T4 ligase buffer solutions
1 μ l T4 ligases (20U/ μ l)
Sterile deionized water is added to the μ l of cumulative volume 10.
Inventor changes T4 ligase volumes, and determines T4 connection enzyme dosages by joint efficiency.The inspection of joint efficiency
To convert bacterium after being attached reaction, the control plasmid with same content relatively grows how many bacterial spot survey method.
The screening of T4 ligases and buffers combinations
| T4 ligase volumes (μ l) | T4 ligases accounting (%) | Joint efficiency (%) |
| 0.5 | 5 | 80 |
| 1 | 10 | 95 |
| 1.5 | 15 | 95 |
| 2 | 20 | 95 |
4. slow virus carrier is sequenced
The monoclonal that picking obtains is enlarged culture in Stbl3 bacteria culture medias, while adds ampicillin
Resistance screening is carried out, the Stbl3 bacteriums that collection obtains are cracked, recombinant plasmid therein is extracted and is sequenced.It is sequenced into
The carrier of work(shows that recombinant clone successfully constructs.
Stbl3 competence and DH5 competent cell contrast experiments
Kit of the present invention based on linearisation CRISPR-CAS9 slow virus carriers structure gene knockout kit have with
Lower advantage：
(1) linearisation CRISPR-CAS9 slow virus carriers eliminate inconsistent phenomenon of the different experiments person to carrier, reduce
The interference of differential responses, saves the time of vehicle treated, improves conventional efficient；
(2) the T4 ligases and buffer solution provided in the present invention is to test a kind of obtained optimal combination by a variety of,
The difference of joint efficiency between different brands is avoided, improves the uniformity of experiment；
(3) the high infectious Stbl3 competence built with Calcium Chloride Method of the present invention, it is thin compared to traditional DH5 competence
Born of the same parents reduce the generation of restructuring.
4. using the present invention, the positive and negative strand primer can that user only needs to synthesize target gene carries out gene immediately
The structure of knockout carrier, there is time saving, laborsaving, the effect to reduce the cost.
Brief description of the drawings
Fig. 1 is the agarose gel electrophoresis figure for linearizing CRISPR-CAS9 slow virus carriers, is shown which to linearize
Carrier, and the fragment after BsmBI nuclease digestions.Due to having one section of 2000bp insetion sequence, digestion inside carrier
The sequence is cut afterwards, the CRISPR- that can prove to be linearized by the sequence of the 2000bp being cut
CAS9 slow virus carriers, convenient recovery.
Fig. 2 is situation after recombinant plasmid coated plate after successful conversion Stbl3.
Fig. 3 is situation about being transformed into cell, and showing with green fluorescence transfects successfully, facilitates subsequent experimental.
Embodiment
Common clone's recombination method described in following embodiments 1 is slow for the CRISPR-CAS9 established using conventional gene
The gene knockout of viral vector structure, the clpp gene of the CRISPR-CAS9 vector constructions with green fluorescent label on the carrier
Except method.
(the CRISPR-CAS9 slow virus carrier bases with puromycin-resistant of common clone's recombination method structure of embodiment 1
Because knocking out, by taking SNX10 genes as an example)
1st, mouse SNX10 genes sgRNA is designed：
(1) design obtains the positive and negative adopted strand primer sequence of SNX10 genes：
sgRNA1F：AAACGCAACGCATTACTTTGGAGTC SEQ ID No.1
sgRNA1R：CACCGCACGTGGATCAGCGTCGCCA SEQ ID No.2
sgRNA2F：CACCGCACGTGGATCAGCGTCGCCA SEQ ID No.3
sgRNA2R：AAACTGGCGACGCTGATCCACGTGC SEQ ID No.4
(2) CRISPR-CAS9 slow virus carrier of the linearisation with puromycin-resistant described in kit；
(3) T4 ligases and T4 ligase buffer solutions；
(4) high activity of conversion Stbl3 competence；
2nd, the restructuring of the CRISPR-CAS9 slow virus cloning vectors with puromycin-resistant
(1) positive-sense strand and antisense strand are annealed to form double-strand：Take positive-sense strand and the antisense strand mixing (final concentration of 10 of equivalent
μM).Program is as follows：37 DEG C 30 minutes；95 DEG C, 5 minutes；94 DEG C, 12sec ,-l DEG C/circulation, 70 circulations；Final is 24 DEG C,
The sample volume and concentration specifically reacted is as follows.
1 μ l positive-sense strands templates (100mM)
1 μ l antisense strands templates (100mM)
1 μ l T4 ligase buffer solutions
Sterile deionized water is added to the μ l of cumulative volume 10.
After the completion of reaction, 2ml sterile deionized waters are added in 10 μ l.
(2) by the linearisation CRISPR-CAS9 carriers in positive-sense strand obtained above and antisense strand mixture and kit
The T4 ligases connection added in kit, is connected 20 minutes.Specific method is：
The CRISPR-CAS9 carriers with puromycin-resistant of 1 μ l linearisations
1 μ l positive-sense strands and antisense strand mixture
1 μ l T4 ligase buffer solutions
1 μ l T4 ligases
Sterile deionized water is added to the μ l of cumulative volume 10.
(3) the Stbl3 competence of high activity of conversion in this kit is thawed on ice, by above-mentioned 11 μ l positive-sense strand and
Antisense strand mixture adds competent cell and shaken up, and places on ice about 30 minutes.After 42 DEG C of water-bath heat shock 90 seconds, 1 milli is added
Rise LB culture mediums (sodium chloride 10g, peptone 10g；Yeast extract 5g, used after adding 1 liter of sterilizing of water), 170 turns at 37 DEG C/
After being cultivated 1 hour in minute shaking table, 5000 revs/min centrifuge 1 minute.Precipitation is coated in the LB agaroses containing antibiotic activity
(sodium chloride 10g, peptone 10g；Yeast extract 5g, agar powder 3g, used after adding the sterilizing of 1 liter of water) on plate, to be grown 16 is small
When after take out, choose monoclonal bacterium colony.
3rd, CRISPR-CAS9 slow virus cloning vector is sequenced, and the above-mentioned monoclonal bacterium colony selected is added in LB culture mediums
Culture is enlarged, while adds ampicillin antibiotic (100g/ml) progress resistance screening, 220 revs/min at 37 DEG C
After being cultivated 12 hours in clock shaking table, plasmid order-checking is extracted.
Sequencing result shows in recombinant clone plasmid that two above positive-sense strand template is had been inserted into carrier：
Recombinant clone successfully constructs.
(the CRISPR-CAS9 slow virus carrier bases with puromycin-resistant of common clone's recombination method structure of embodiment 2
Because knocking out, by taking HSF1 genes as an example)
1st, people HSF1 genes sgRNA is designed：
(1) design obtains the positive and negative adopted strand primer sequence of HSF1 genes：
sgRNA1F：TCGTGAGCGACCCGGACACCGTTTT SEQ ID No.5
sgRNA1R：GGTGTCCGGGTCGCTCACGACGGTG SEQ ID No.6
sgRNA2F：CAGCTTCCACGTGTTCGACCGTTTT SEQ ID No.7
sgRNA2R：GGTCGAACACGTGGAAGCTGCGGTG SEQ ID No.8
sgRNA3F：GGAGTCAATGAGGGCGGTCGGTTTT SEQ ID No.9
sgRNA3R：CGACCGCCCTCATTGACTCCCGGTG SEQ ID No.10
(2) CRISPR-CAS9 slow virus carrier of the linearisation with puromycin-resistant described in kit；
(3) T4 ligases and T4 ligase buffer solutions；
(4) high activity of conversion Stbl3 competence；
2nd, the restructuring of the CRISPR-CAS9 slow virus cloning vectors with puromycin-resistant
(1) positive-sense strand and antisense strand are annealed to form double-strand：Take positive-sense strand and the antisense strand mixing (final concentration of 10 of equivalent
μM).Program is as follows：37 DEG C, 30 minutes；95 DEG C, 5 minutes；94 DEG C, 12sec ,-l DEG C/circulation, 70 circulations；Final is 24 DEG C,
The sample volume and concentration specifically reacted is as follows.
1 μ l positive-sense strands templates (100mM)
1 μ l antisense strands templates (100mM)
1 μ l T4 ligase buffer solutions
Sterile deionized water is added to the μ l of cumulative volume 10.
After the completion of reaction, 2ml sterile deionized waters are added in 10 μ l.
(2) by the linearisation CRISPR-CAS9 carriers in positive-sense strand obtained above and antisense strand mixture and kit
The T4 ligases connection added in kit, is connected 20 minutes.Specific method is：
The CRISPR-CAS9 carriers with puromycin-resistant of 1 μ l linearisations
1 μ l positive-sense strands and antisense strand mixture
1 μ l T4 ligase buffer solutions
1 μ l T4 ligases
Sterile deionized water is added to the μ l of cumulative volume 10.
(3) the Stbl3 competence of high activity of conversion in this kit is thawed on ice, by above-mentioned 11 μ l positive-sense strand and
Antisense strand mixture adds competent cell and shaken up, and places on ice about 30 minutes.After 42 DEG C of water-bath heat shock 90 seconds, 1 milli is added
Rise LB culture mediums (sodium chloride 10g, peptone 10g；Yeast extract 5g, used after adding 1 liter of sterilizing of water), 170 turns at 37 DEG C/
After being cultivated 1 hour in minute shaking table, 5000 revs/min centrifuge 1 minute.Precipitation is coated in the LB agaroses containing antibiotic activity
(sodium chloride 10g, peptone 10g；Yeast extract 5g, agar powder 3g, used after adding the sterilizing of 1 liter of water) on plate, to be grown 16 is small
When after take out, choose monoclonal bacterium colony.
3rd, CRISPR-CAS9 slow virus cloning vector is sequenced, and the above-mentioned monoclonal bacterium colony selected is added in LB culture mediums
Culture is enlarged, while adds ampicillin antibiotic (100g/ml) progress resistance screening, 220 revs/min at 37 DEG C
After being cultivated 12 hours in clock shaking table, plasmid order-checking is extracted.
Sequencing result shows in recombinant clone plasmid that two above positive-sense strand template is had been inserted into carrier：
Recombinant clone successfully constructs.
(the CRISPR-CAS9 slow virus carrier bases with puromycin-resistant of common clone's recombination method structure of embodiment 3
Because knocking out, by taking PKA genes as an example)
1st, P of Rats KA genes sgRNA is designed：
(1) design obtains the positive and negative adopted strand primer sequence of PKA genes：
sgRNA1F：AACGCCGCCGCCGCCAAGAAGTTTT SEQ ID No.11
sgRNA1R：TTCTTGGCGGCGGCGGCGTTCGGTG SEQ ID No.12
sgRNA2F：CCTCCCAATCCGCCGTAAGTGTTTT SEQ ID No.13
sgRNA2R：ACTTACGGCGGATTGGGAGGCGGTG SEQ ID No.14
sgRNA3F：CGATCTGCGCCGCGTAGAAAGTTTT SEQ ID No.15
sgRNA3R：TTTCTACGCGGCGCAGATCGCGGTG SEQ ID No.16
(2) CRISPR-CAS9 slow virus carrier of the linearisation with puromycin-resistant described in kit；
(3) T4 ligases and T4 ligase buffer solutions；
(4) high activity of conversion Stbl3 competence；
2nd, the restructuring of the CRISPR-CAS9 slow virus cloning vectors with puromycin-resistant
(1) positive-sense strand and antisense strand are annealed to form double-strand：Take positive-sense strand and the antisense strand mixing (final concentration of 10 of equivalent
μM).Program is as follows：37 DEG C, 30 minutes；95 DEG C, 5 minutes；94 DEG C, 12sec ,-l DEG C/circulation, 70 circulations；Final is 24 DEG C,
The sample volume and concentration specifically reacted is as follows.
1 μ l positive-sense strands templates (100mM)
1 μ l antisense strands templates (100mM)
1 μ l T4 ligase buffer solutions
Sterile deionized water is added to the μ l of cumulative volume 10.
After the completion of reaction, 2ml sterile deionized waters are added in 10 μ l.
(2) by the linearisation CRISPR-CAS9 carriers in positive-sense strand obtained above and antisense strand mixture and kit
The T4 ligases connection added in kit, is connected 20 minutes.Specific method is：
The CRISPR-CAS9 carriers with puromycin-resistant of 1 μ l linearisations
1 μ l positive-sense strands and antisense strand mixture
1 μ l T4 ligase buffer solutions
1 μ l T4 ligases
Sterile deionized water is added to the μ l of cumulative volume 10.
(3) the Stbl3 competence of high activity of conversion in this kit is thawed on ice, by above-mentioned 11 μ l positive-sense strand and
Antisense strand mixture adds competent cell and shaken up, and places on ice about 30 minutes.After 42 DEG C of water-bath heat shock 90 seconds, 1 milli is added
Rise LB culture mediums (sodium chloride 10g, peptone 10g；Yeast extract 5g, used after adding 1 liter of sterilizing of water), 170 turns at 37 DEG C/
After being cultivated 1 hour in minute shaking table, 5000 revs/min centrifuge 1 minute.Precipitation is coated in the LB agaroses containing antibiotic activity
(sodium chloride 10g, peptone 10g；Yeast extract 5g, agar powder 3g, used after adding the sterilizing of 1 liter of water) on plate, to be grown 16 is small
When after take out, choose monoclonal bacterium colony.
3rd, CRISPR-CAS9 slow virus cloning vector is sequenced, and the above-mentioned monoclonal bacterium colony selected is added in LB culture mediums
Culture is enlarged, while adds ampicillin antibiotic (100g/ml) progress resistance screening, 220 revs/min at 37 DEG C
After being cultivated 12 hours in clock shaking table, plasmid order-checking is extracted.
Sequencing result shows in recombinant clone plasmid that two above positive-sense strand template is had been inserted into carrier：
Recombinant clone 1：AAACGCAACGCATTACTTTGGAGTC SEQ ID No.17
Recombinant clone 2：CACCGCACGTGGATCAGCGTCGCCA SEQ ID No.18
Recombinant clone successfully constructs.
SEQUENCE LISTING
<110>Nanfang Medical Univ
<120>One kind knocks out kit and its application based on linearisation CRISPR-CAS9 lentiviral vector genomes
<160> 18
<170> PatentIn version 3.3
<210> 1
<211> 25
<212> DNA
<213> sgRNA1F
<400> 1
aaacgcaacg cattactttg gagtc 25
<210> 2
<211> 25
<212> DNA
<213> sgRNA1R
<400> 2
caccgcacgt ggatcagcgt cgcca 25
<210> 3
<211> 25
<212> DNA
<213> sgRNA2F
<400> 3
caccgcacgt ggatcagcgt cgcca 25
<210> 4
<211> 25
<212> DNA
<213> sgRNA2R
<400> 4
aaactggcga cgctgatcca cgtgc 25
<210> 5
<211> 25
<212> DNA
<213> sgRNA1F
<400> 5
tcgtgagcga cccggacacc gtttt 25
<210> 6
<211> 25
<212> DNA
<213> sgRNA1R
<400> 6
ggtgtccggg tcgctcacga cggtg 25
<210> 7
<211> 25
<212> DNA
<213> sgRNA2F
<400> 7
cagcttccac gtgttcgacc gtttt 25
<210> 8
<211> 25
<212> DNA
<213> sgRNA2R
<400> 8
ggtcgaacac gtggaagctg cggtg 25
<210> 9
<211> 25
<212> DNA
<213> sgRNA3F
<400> 9
ggagtcaatg agggcggtcg gtttt 25
<210> 10
<211> 25
<212> DNA
<213> sgRNA3R
<400> 10
cgaccgccct cattgactcc cggtg 25
<210> 11
<211> 25
<212> DNA
<213> sgRNA1F
<400> 11
aacgccgccg ccgccaagaa gtttt 25
<210> 12
<211> 25
<212> DNA
<213> sgRNA1R
<400> 12
ttcttggcgg cggcggcgtt cggtg 25
<210> 13
<211> 25
<212> DNA
<213> sgRNA2F
<400> 13
cctcccaatc cgccgtaagt gtttt 25
<210> 14
<211> 25
<212> DNA
<213> sgRNA2R
<400> 14
acttacggcg gattgggagg cggtg 25
<210> 15
<211> 25
<212> DNA
<213> sgRNA3F
<400> 15
cgatctgcgc cgcgtagaaa gtttt 25
<210> 16
<211> 25
<212> DNA
<213> sgRNA3R
<400> 16
tttctacgcg gcgcagatcg cggtg 25
<210> 17
<211> 25
<212> DNA
<213>Recombinant clone 1
<400> 17
aaacgcaacg cattactttg gagtc 25
<210> 18
<211> 25
<212> DNA
<213>Recombinant clone 2
<400> 18
caccgcacgt ggatcagcgt cgcca 25
Claims (7)
1. a kind of genetic recombination kit based on CRISPR-CAS9, the kit includes CRISPR-CAS9 carriers, T4 connections
Enzyme and competent cell, it is characterised in that described CRISPR-CAS9 carriers are linear CRISPR-CAS9 carriers, are preferably slow
Viral vector, plasmid vector or adenovirus vector.
2. genetic recombination kit according to claim 1, described linear CRISPR-CAS9 carriers pass through with BsmBI
Enzyme digestion CRISPR-CAS9 slow virus circular vectors obtain, and are reclaimed by Ago-Gel；Wherein described digestion it is anti-
Answer in liquid that CRISPR-CAS9 slow virus circular vectors are 2 μ g, BsmBI enzymes 50U in every 50 μ l.
3. genetic recombination kit according to claim 1, described competent cell is Stbl3 competent cells, excellent
Elect the Stbl3 competent cells by chlorination Calcium treatment as.
4. genetic recombination kit according to claim 1, wherein also including T4 ligase buffer solutions, the agent of T4 ligases
Measure and match somebody with somebody 20U T4 ligases for every 10ng linearisation CRISPR-CAS9 carriers.
5. genetic recombination kit according to claim 1, wherein also including the sgRNA oligonucleotides of target gene just
Adopted chain template and antisense strand template, 5 ' end addition CACC of positive-sense strand template；5 ' end addition AAAC of antisense strand template.
6. genetic recombination kit according to claim 1, the kit includes the linear CRISPR-CAS9 slow virus of 10ng
Carrier, 1-2 μ l 20U/ μ l T4 ligases, 1 μ l T4 ligase buffer solutions and Stbl3 competent cells.
7. a kind of method that genetic recombination kit with described in claim any one of 1-6 carries out genetic recombination, it is included such as
Lower step：
1) the positive-sense strand template of sgRNA oligonucleotides and antisense strand template annealing are formed into double-strand；
2) the linearisation CRISPR-CAS9 in the positive-sense strand and antisense strand mixture and genetic recombination kit that obtain step 1)
Carrier is attached reaction with T4 ligases, obtains the carrier of the sgRNA oligonucleotides of connection target gene；
3) carrier for the sgRNA oligonucleotides for connecting target gene is cultivated with competent cell, and trained by culture medium
Support and obtain monoclonal bacterium colony.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710935589.8A CN107604003A (en) | 2017-10-10 | 2017-10-10 | One kind knocks out kit and its application based on linearisation CRISPR CAS9 lentiviral vector genomes |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710935589.8A CN107604003A (en) | 2017-10-10 | 2017-10-10 | One kind knocks out kit and its application based on linearisation CRISPR CAS9 lentiviral vector genomes |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN107604003A true CN107604003A (en) | 2018-01-19 |
Family
ID=61067643
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710935589.8A Pending CN107604003A (en) | 2017-10-10 | 2017-10-10 | One kind knocks out kit and its application based on linearisation CRISPR CAS9 lentiviral vector genomes |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107604003A (en) |
Cited By (23)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US10113163B2 (en) | 2016-08-03 | 2018-10-30 | President And Fellows Of Harvard College | Adenosine nucleobase editors and uses thereof |
| US10323236B2 (en) | 2011-07-22 | 2019-06-18 | President And Fellows Of Harvard College | Evaluation and improvement of nuclease cleavage specificity |
| US10465176B2 (en) | 2013-12-12 | 2019-11-05 | President And Fellows Of Harvard College | Cas variants for gene editing |
| US10508298B2 (en) | 2013-08-09 | 2019-12-17 | President And Fellows Of Harvard College | Methods for identifying a target site of a CAS9 nuclease |
| US10597679B2 (en) | 2013-09-06 | 2020-03-24 | President And Fellows Of Harvard College | Switchable Cas9 nucleases and uses thereof |
| US10682410B2 (en) | 2013-09-06 | 2020-06-16 | President And Fellows Of Harvard College | Delivery system for functional nucleases |
| US10704062B2 (en) | 2014-07-30 | 2020-07-07 | President And Fellows Of Harvard College | CAS9 proteins including ligand-dependent inteins |
| US10745677B2 (en) | 2016-12-23 | 2020-08-18 | President And Fellows Of Harvard College | Editing of CCR5 receptor gene to protect against HIV infection |
| US10858639B2 (en) | 2013-09-06 | 2020-12-08 | President And Fellows Of Harvard College | CAS9 variants and uses thereof |
| US11046948B2 (en) | 2013-08-22 | 2021-06-29 | President And Fellows Of Harvard College | Engineered transcription activator-like effector (TALE) domains and uses thereof |
| US11214780B2 (en) | 2015-10-23 | 2022-01-04 | President And Fellows Of Harvard College | Nucleobase editors and uses thereof |
| US11268082B2 (en) | 2017-03-23 | 2022-03-08 | President And Fellows Of Harvard College | Nucleobase editors comprising nucleic acid programmable DNA binding proteins |
| US11306324B2 (en) | 2016-10-14 | 2022-04-19 | President And Fellows Of Harvard College | AAV delivery of nucleobase editors |
| US11319532B2 (en) | 2017-08-30 | 2022-05-03 | President And Fellows Of Harvard College | High efficiency base editors comprising Gam |
| US11447770B1 (en) | 2019-03-19 | 2022-09-20 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| US11542509B2 (en) | 2016-08-24 | 2023-01-03 | President And Fellows Of Harvard College | Incorporation of unnatural amino acids into proteins using base editing |
| US11542496B2 (en) | 2017-03-10 | 2023-01-03 | President And Fellows Of Harvard College | Cytosine to guanine base editor |
| US11560566B2 (en) | 2017-05-12 | 2023-01-24 | President And Fellows Of Harvard College | Aptazyme-embedded guide RNAs for use with CRISPR-Cas9 in genome editing and transcriptional activation |
| US11661590B2 (en) | 2016-08-09 | 2023-05-30 | President And Fellows Of Harvard College | Programmable CAS9-recombinase fusion proteins and uses thereof |
| US11732274B2 (en) | 2017-07-28 | 2023-08-22 | President And Fellows Of Harvard College | Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE) |
| US11795443B2 (en) | 2017-10-16 | 2023-10-24 | The Broad Institute, Inc. | Uses of adenosine base editors |
| US11898179B2 (en) | 2017-03-09 | 2024-02-13 | President And Fellows Of Harvard College | Suppression of pain by gene editing |
| US11912985B2 (en) | 2020-05-08 | 2024-02-27 | The Broad Institute, Inc. | Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105316324A (en) * | 2015-10-20 | 2016-02-10 | 芜湖医诺生物技术有限公司 | Streptococcus thermophilus derived human CXCR3 gene target sequence recognizable by CRISPR (clustered regularly interspaced short palindromic repeat)-Cas9 (CRISPR associated 9) system and sgRNA (single guide ribonucleic acid) and application thereof |
-
2017
- 2017-10-10 CN CN201710935589.8A patent/CN107604003A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105316324A (en) * | 2015-10-20 | 2016-02-10 | 芜湖医诺生物技术有限公司 | Streptococcus thermophilus derived human CXCR3 gene target sequence recognizable by CRISPR (clustered regularly interspaced short palindromic repeat)-Cas9 (CRISPR associated 9) system and sgRNA (single guide ribonucleic acid) and application thereof |
Non-Patent Citations (2)
| Title |
|---|
| DAVID P. SANTOS ET AL.: "Comprehensive protocols for CRISPR/Cas9-based gene editing in human pluripotent stem cells", 《CURR PROTOC STEM CELL BIOL》 * |
| SHALEM O ET AL.: "Genome-scale CRISPR-Cas9 knockout screening in human cells", 《SCIENCE》 * |
Cited By (36)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US10323236B2 (en) | 2011-07-22 | 2019-06-18 | President And Fellows Of Harvard College | Evaluation and improvement of nuclease cleavage specificity |
| US11920181B2 (en) | 2013-08-09 | 2024-03-05 | President And Fellows Of Harvard College | Nuclease profiling system |
| US10508298B2 (en) | 2013-08-09 | 2019-12-17 | President And Fellows Of Harvard College | Methods for identifying a target site of a CAS9 nuclease |
| US10954548B2 (en) | 2013-08-09 | 2021-03-23 | President And Fellows Of Harvard College | Nuclease profiling system |
| US11046948B2 (en) | 2013-08-22 | 2021-06-29 | President And Fellows Of Harvard College | Engineered transcription activator-like effector (TALE) domains and uses thereof |
| US10597679B2 (en) | 2013-09-06 | 2020-03-24 | President And Fellows Of Harvard College | Switchable Cas9 nucleases and uses thereof |
| US10682410B2 (en) | 2013-09-06 | 2020-06-16 | President And Fellows Of Harvard College | Delivery system for functional nucleases |
| US10858639B2 (en) | 2013-09-06 | 2020-12-08 | President And Fellows Of Harvard College | CAS9 variants and uses thereof |
| US10912833B2 (en) | 2013-09-06 | 2021-02-09 | President And Fellows Of Harvard College | Delivery of negatively charged proteins using cationic lipids |
| US11299755B2 (en) | 2013-09-06 | 2022-04-12 | President And Fellows Of Harvard College | Switchable CAS9 nucleases and uses thereof |
| US10465176B2 (en) | 2013-12-12 | 2019-11-05 | President And Fellows Of Harvard College | Cas variants for gene editing |
| US11053481B2 (en) | 2013-12-12 | 2021-07-06 | President And Fellows Of Harvard College | Fusions of Cas9 domains and nucleic acid-editing domains |
| US11124782B2 (en) | 2013-12-12 | 2021-09-21 | President And Fellows Of Harvard College | Cas variants for gene editing |
| US10704062B2 (en) | 2014-07-30 | 2020-07-07 | President And Fellows Of Harvard College | CAS9 proteins including ligand-dependent inteins |
| US11578343B2 (en) | 2014-07-30 | 2023-02-14 | President And Fellows Of Harvard College | CAS9 proteins including ligand-dependent inteins |
| US11214780B2 (en) | 2015-10-23 | 2022-01-04 | President And Fellows Of Harvard College | Nucleobase editors and uses thereof |
| US11702651B2 (en) | 2016-08-03 | 2023-07-18 | President And Fellows Of Harvard College | Adenosine nucleobase editors and uses thereof |
| US10113163B2 (en) | 2016-08-03 | 2018-10-30 | President And Fellows Of Harvard College | Adenosine nucleobase editors and uses thereof |
| US10947530B2 (en) | 2016-08-03 | 2021-03-16 | President And Fellows Of Harvard College | Adenosine nucleobase editors and uses thereof |
| US11661590B2 (en) | 2016-08-09 | 2023-05-30 | President And Fellows Of Harvard College | Programmable CAS9-recombinase fusion proteins and uses thereof |
| US11542509B2 (en) | 2016-08-24 | 2023-01-03 | President And Fellows Of Harvard College | Incorporation of unnatural amino acids into proteins using base editing |
| US11306324B2 (en) | 2016-10-14 | 2022-04-19 | President And Fellows Of Harvard College | AAV delivery of nucleobase editors |
| US11820969B2 (en) | 2016-12-23 | 2023-11-21 | President And Fellows Of Harvard College | Editing of CCR2 receptor gene to protect against HIV infection |
| US10745677B2 (en) | 2016-12-23 | 2020-08-18 | President And Fellows Of Harvard College | Editing of CCR5 receptor gene to protect against HIV infection |
| US11898179B2 (en) | 2017-03-09 | 2024-02-13 | President And Fellows Of Harvard College | Suppression of pain by gene editing |
| US11542496B2 (en) | 2017-03-10 | 2023-01-03 | President And Fellows Of Harvard College | Cytosine to guanine base editor |
| US11268082B2 (en) | 2017-03-23 | 2022-03-08 | President And Fellows Of Harvard College | Nucleobase editors comprising nucleic acid programmable DNA binding proteins |
| US11560566B2 (en) | 2017-05-12 | 2023-01-24 | President And Fellows Of Harvard College | Aptazyme-embedded guide RNAs for use with CRISPR-Cas9 in genome editing and transcriptional activation |
| US11732274B2 (en) | 2017-07-28 | 2023-08-22 | President And Fellows Of Harvard College | Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE) |
| US11932884B2 (en) | 2017-08-30 | 2024-03-19 | President And Fellows Of Harvard College | High efficiency base editors comprising Gam |
| US11319532B2 (en) | 2017-08-30 | 2022-05-03 | President And Fellows Of Harvard College | High efficiency base editors comprising Gam |
| US11795443B2 (en) | 2017-10-16 | 2023-10-24 | The Broad Institute, Inc. | Uses of adenosine base editors |
| US11795452B2 (en) | 2019-03-19 | 2023-10-24 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| US11643652B2 (en) | 2019-03-19 | 2023-05-09 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| US11447770B1 (en) | 2019-03-19 | 2022-09-20 | The Broad Institute, Inc. | Methods and compositions for prime editing nucleotide sequences |
| US11912985B2 (en) | 2020-05-08 | 2024-02-27 | The Broad Institute, Inc. | Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107604003A (en) | One kind knocks out kit and its application based on linearisation CRISPR CAS9 lentiviral vector genomes | |
| CN107858346B (en) | Method for knocking out saccharomyces cerevisiae chromosome | |
| CN105907785B (en) | Application of chemically synthesized crRNA in CRISPR/Cpf1 system in gene editing | |
| CN104846010B (en) | A kind of method for deleting transgenic paddy rice riddled basins | |
| CN103343120B (en) | Wheat genome site-specific modification method | |
| WO2017190664A1 (en) | Use of chemosynthetic crrna and modified crrna in crispr/cpf1 gene editing systems | |
| CN108504657A (en) | The method for knocking out HEK293T cell KDM2A genes using CRISPR-CAS9 technologies | |
| CN107435051A (en) | A kind of cell line gene knockout method that large fragment deletion is quickly obtained by CRISPR/Cas9 systems | |
| CN105543266A (en) | CRISPR (Clustered Regularly Interspaced Short Palindromic Repeat sequences)-Cas (CRISPR-associated proteins) system in Streptomyces virginiae IBL14 and method for carrying out gene editing by using CRISPR-Cas system | |
| CN105821075A (en) | Establishment method of caffeine synthetase CRISPR/Cas9 genome editing vector | |
| CN110747187B (en) | Cas12a protein for identifying TTTV and TTV double-PAM sites, plant genome directed editing vector and method | |
| CN108165581B (en) | Method for repairing HBA2 gene mutation in vitro by using single-stranded nucleotide fragment | |
| CN110268063A (en) | The method for establishing fungi production bacterial strain using automation genetic manipulation and bacterial strain purification step | |
| CN105481955B (en) | Fast-growing water plant nitrate transport protein GeNRT2.1 and its encoding gene and application | |
| CN106947827A (en) | One kind obtains flathead sex specific molecular marker and its screening technique and application | |
| CN114829600A (en) | Plant MAD7 nuclease and PAM recognition capacity of amplification thereof | |
| CN110541002A (en) | method for constructing zebra fish asap1b gene knockout mutant by using CRISPR/Cas9 technology | |
| CN111057654B (en) | Cas9 gene knockout vector applicable to morinda officinalis endophytic fungus A761 and construction method and application thereof | |
| CN109355290B (en) | Plant circular RNA expression frame and application thereof | |
| CN109929862B (en) | Method for screening cellulase genes from ruminant rumen macrotranscriptome data for cloning | |
| CN104745584B (en) | One kind is for disturbing arrenotokous nucleic acid molecules of Macrobrachium rosenbergii and preparation method thereof | |
| CN107686845A (en) | A kind of rice high efficient conversion carrier pCXUN Cas9 sgRNA and its construction method | |
| CN114990093B (en) | Protein sequence MINI RFX-CAS13D with small amino acid sequence | |
| CN104212837B (en) | Lentiviral vector for expression of human serum albumin and construction method thereof | |
| CN112359092B (en) | Construction method of genome short fragment library |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20180119 |
|
| RJ01 | Rejection of invention patent application after publication |